Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal
models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by Milestone
Active milestones: 2, 7, 8, 9, 10, 11(UNM &LBERI), 12/13 (UNM &LBERI), 14, 17, 18, 19, 21(UNM
&LBERI),
29 (UNM &LBERI), 35 (UNM/ASU), 36, 49, 52, 53.
Completed milestones: 1, 3, 4, 5, 6, 16, 25, 26, 27, 28, 32, 33, 34, 39, 40, 43, 48, 50, 51
Inactive milestones: 15, 20, 22, 23, 24, 30, 37, 38, 54
Milestones terminated after initiation: 41, 42, 44, 46, 55, 56, and 57 (MSCR will be written)
Milestones terminated before initiation: 43 (Cerus) 45, 47, 58, and 59 (MSCR will not be written)
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LRRI
1. Date started: 11/01/2005
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. Three UNM and possibly 6 LBERI scientists will receive LVS vaccinations in 2009.
b. USAMRIID (United States Army Medical Research Institute for Infectious Disease) tentative
vaccination date is August 2009, pending FDA (Federal Drug Administration) approval
4. Significant decisions made or pending
a. USAMRIID tentatively will resume offering vaccinations to UNM and LBERI in August 2009 if
FDA approval is given.
b. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI will offer the LVS vaccinations to 9
more scientists to total up to 46.
c.Dr. Lyons received UNM IRB re-approval to allow blood draws on the vaccinated LBERI and
UNM scientists after their LVS vaccinations
d.UNM, True, LBERI, USAMMDA and USAMRIID fully executed the CRDA modification #1 to
extend the termination date from 6/29/09 to September 29, 2010.
5. Problems or concerns and strategies to address
a.Nine scientists could be vaccinated in 2009 if USAMRIID receives FDA approval for the new
Tularemia vaccination protocol.
b.USAMRIID may restart LVS vaccinations in August 2009 pending FDA approval
6. Deliverables completed
a. A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS
vaccination since 9/11/07.
b. 37 participants have terminated from the USAMRIID SIP, after completing the one year health
follow-up at UNM EOH (Employee Occupational Health).
7. Quality of performance
Excellent
Page 1 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
8. Percentage completed
76% of the scientific work is complete
9. Work plan for upcoming month
Schedule LVS vaccinations for 9 remaining LBERI and UNM scientists in August 2009, if USAMRIID
has FDA approval to reopen the SIP(Special Immunizations Program).
Milestone 7
Milestone description: SCHU S4 ED50 in primates determined from selection of challenge
dosing
Institution: LBERI
1. Date started: 2/25/08
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions:
a. Histopathology analysis was completed.
i.Aerosol exposure to Schu S4 F. tularensis resulted in primary inflammatory lesions in the
nasal cavity and lungs, and in the associated draining lymph nodes
(tracheobronchial, retropharyngeal and mandibular). After hematogenous
dissemination of Schu S4, secondary lesions developed in the spleen, liver, bone
marrow and non-draining lymph nodes. Disseminated lesions were sporadically
present in other organs (brain, eyes, kidneys) in animals that survived a sufficient
length of time after exposure. The paucity of lesions in the mesenteric lymph nodes
and the relative lateness of their appearance during the clinical course of disease
suggested that gastrointestinal uptake was not a major route of infection after aerosol
exposure.
ii.In the animals exposed to the highest doses of Schu S4, evidence of hematogenous
dissemination to the spleen was consistently present by day 3 post exposure, the
earliest time point examined. After dissemination, the spleen was generally involved
earlier and to a greater extent than other non-respiratory organs. Dissemination to
the bone marrow, with subsequent necrosis of hematopoietic tissues, likely
contributed to the development of multiple cytopenias. Hepatic sinusoidal
microthrombi identified in many animals were consistent with the development of a
systemic coagulopathy as a terminal event.
iii.In general, animals exposed to the lowest aerosol doses of Schu S4 (<100 cfu
presented) had the longest clinical course, developed only minimal to mild lung
disease, but more severe disseminated disease ( NHP ID numbers 28615, 28581,
28643, 28499, and 28664). In contrast, animals exposed to the highest aerosol
doses of Schu S4 (>25,000 cfu presented) had a rapidly progressive clinical course,
developed severe lung disease, and died quickly, prior to the development of severe
disseminated disease (NHP ID numbers 28617, 28570, 28549, 28525, 28395,
28569). Animals exposed to the mid-range (237-1150 cfu) aerosol doses of Schu S4
had an intermediate clinical course and developed both substantial lung disease and
disseminated disease. Death is presumed to have resulted from decreased lung
function (high-dose animals), the sequela of disseminated inflammatory disease
(low-dose animals), or a combination of the two processes (intermediate-dose
animals).
iv. Anemia was evident in several animals and was attributed to a combination of bone
marrow hypoproliferation and extravascular hemolysis.
v.Slight decreases in peripheral lymphocyte counts were evident after several days, and
were attributed to the physiologic stress of illness. Neutrophil counts exhibited a
Page 2 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
transient increase, followed by a decrease which was attributes to peripheral
consumption and bone marrow hypoproliferation.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
LD50 is 1.26 CFU of SCHU S4. The LD99 is 4.23 CFU.
7. Quality of performance
Excellent
8. Percentage completed
98% of the scientific work is complete.
9. Work plan for upcoming month
a. Respiratory rates and temperatures previously reported will be modified as per the format
provided by Kristin DeBord.
b. The final pathology report will be completed by the end of June 2009.
Milestone 8
Milestone description: LVS vaccination protection of aerosol Schu S4 confirmed in primates
Institution: LBERI
1. Date started: 8/15/2008
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions
a.
The purpose of this milestone is to describe the natural history of SCHU S4 aerosol
exposure in non-human primates (NHPs) that have been previously vaccinated with LVS (F.
tularensis live vaccine strain)
b. In January 2009, six NHPs were vaccinated with LVS by either scarification (n = 3) or by subcutaneous inoculation (n = 3)
i. Peripheral blood mononuclear cells (PBMCs) and spleen cells were prepared from
these survivors These cells’ ability to produce IFNγ in response to LVS antigens is
presented in Figures 1 and 2.
ii. (NOTE: J.Wilder prepared the 6/7/09 report, departed for vacation, and UNM could
not confirm whether the cells were fresh or frozen for this testing)
A
Pre-SCHU S4
Exposure
21 Days PostSCHU S4
Exposure
Page 3 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
IFNγ Spots (Mean +/- S.D.)
B
Pre-LVS
Vaccination
Post-LVS
Vaccination
C
700
600
500
400
A00937
LVS by ID
(dose of 1.5 x 107)
300
200
100
0
Day 795
Day 836
Post-LVS
Vaccination
Post-LVS
Vaccination; Day
21 post-SCHU S4
aerosol
Figure 1: IFNγ production by PBMCs from naïve (A) or LVS-vaccinated (B and C) NHPs pre- and postSCHU S4 aerosol exposure. These three NHPs (one control naive (A03152), one ID vaccinated
(A00937) and one scarified vaccinated (28643)) survived SCHU S4 aerosol exposure and were
euthanized day 21 post-SCHU S4 exposure. All PBMCs were cultured at 200,000 cells/well and
stimulated with either heat-killed (HK) or formalin-fixed (FF) LVS or SCHU S4 antigens or were left
unstimulated (Media). Antigen doses are 4 x 105 CFU/ml (Super), 1 x 105/ml (Hi), 0.25 x 105/ml (Mid) or
0.06 x 105/ml. Wells in which the spots were too numerous to count (TNTC) were represented as having
600 spots in order to graph the data. Not all stimuli were used in every case due to insufficiency of
PBMCs and thus missing bars represent no testing was done using those stimuli. Panel A represents a
non-vaccinated NHP (A03152) and PBMCs from experiment TUL61 were prepared before SCHU S4
aerosol exposure whereas PBMCs from TUL70 were prepared post-SCHU S4 aerosol exposure. Panel B
represents an LVS-vaccinated NHP (scarified) and PBMCs were tested on Day 0 (pre-LVS vaccination),
Day 25 post-LVS vaccination and Day 56 post-LVS vaccination and 21 days post SCHU S4 aerosol
exposure. Panel C represents an LVS-vaccinated NHP (ID) and PBMCs were prepared on Day 795 postLVS vaccination (pre-SCHU S4 aerosol exposure) and on Day 836 post-LVS vaccination, 21 days post
SCHU S4 aerosol exposure.
Page 4 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 2: IFNγ production by spleen cells from naïve (A03152) or LVS-vaccinated NHPs (28643,
A00937) on day 21 post- SCHU S4 aerosol exposure. All cells were cultured at 150,000 cells/well and
stimulated with either heat-killed (HK) or formalin-fixed (FF) LVS or SCHU S4 antigens or were left
unstimulated (Media). Antigen doses are 4 x 105 CFU/ml (Super), 1 x 105/ml (Hi), 0.25 x 105/ml (Mid) or
0.06 x 105/ml. Wells in which the spots were too numerous to count (TNTC) were represented as having
600 spots in order to graph the data.
c.
iii. Data interpretation: NHPs which survived the SCHU S4 aerosol challenge until
Day 21 were boosted by the aerosol challenge itself in that they produced more
IFNγ post-aerosol challenge than pre-aerosol challenge in response to both LVS
and SCHU S4 stimuli tested. Of particular interest is the LVS-naïve NHP
(A03152) which produced equivalent levels of IFNγ as the LVS vaccinated NHPs
post-SCHU S4 aerosol.
iv. Data storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay
statview\PBMC assays 05312009.svd and in the TVDC 4 (9235) bound notebook
pages 57 – 61, the TVDC 6 (9616) bound notebook pages 4 – 12, 19 – 25 and
38 - 41 and in the ABSL3 TVDC Binder (Experiment TUL70).
A new LVS vaccination/SCHU S4 challenge experiment, termed TUL08B, was initiated in
May 2009.
i. 15 NHPs were released from quarantine on May 7 and underwent physicals and
blood draws for baseline clinical chemistry and immune reactivity to LVS
antigens.
1. IFNγ production by PBMCs from these NHPs was measured and is
reported in Figure 3.
Page 5 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
60
50
40
30
A
20
1.33, A07686
1.33, A07682
1.33, A07610
1.33, A07566
1.33, A07386
1.33, A06882
1.33, A06694
.67, A07686
.67, A07682
.67, A07610
.67, A07566
.67, A07386
.67, A06882
LVS hk Mid
LVS ff Hi
LVS ff Mid
LVS ff Lo
1.33, A07427
1.33, A06702
LVS hk Super
1.33, A06674
40
20
0
B
.67, A07427
140
120
100
80
60
Media
LVS hk Hi
.67, A06702
200
180
160
.67, A06694
10
0
IFNg Spots (Mean +/- S.D.)
Media
LVS hk Hi
LVS hk Mid
LVS ff Hi
LVS ff Mid
LVS ff Lo
LVS hk Super
.67, A06674
IFNg Spots (Mean +/- S.D.)
70
Page 6 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
600
Media
LVS hk Hi
LVS hk Mid
500
LVS ff Hi
400
LVS ff Mid
C
LVS ff Lo
300
LVS hk Super
200
1.33, A07418
1.33, A07395
1.33, A06873
1.33, A06693
1.33, A06675
.67, A07418
.67, A07395
.67, A06873
0
.67, A06693
100
.67, A06675
IFNg Spots (Mean +/- S.D.)
700
Figure 3: PBMCs from non-LVS vaccinated NHPs were resuspended at 1.33 or 0.67 x 10 6/ml (100,000 –
200,000/well) and stimulated with LVS antigens as indicated. Media indicates no antigen was added.
Antigen doses are 4 x 105 CFU/ml (Super), 1 x 105/ml (Hi), 0.25 x 105/ml (Mid) or 0.06 x 105/ml. Not all
stimuli were used in every case due to insufficiency of PBMCs and thus missing bars represent no testing
was done using those stimuli. Panel A represents the 7 animals which had low responses, Panel B
shows 3 animals with mid-level responses and Panel C shows 6 animals that had high responses to the
LVS antigens (wells in which spots were TNTC were entered as 600 spots for data graphing).
2. None of these animals had an IgG anti-LVS response above 1 Unit/ml
when tested against a positive control plasma made from LVSvaccinated NHPs set at 1000 U/ml. The level of detection in the assay
was 0.312 U/ml.
3. Data Interpretation: Only 6/15 NHPs tested had background levels that
exceeded 100 spots/well detected in the IFNγ ELISPOT assay.
Interestingly, the highest responses were observed after stimulation with
HK, rather than FF LVS. This is the opposite of what we observed in
most earlier studies where the highest background responses were
detected in FF LVS stimulated wells. The technician has, since
reviewing these results, made new working stock aliquots of the antigens
in case the labeling of the last tubes was reversed.
4. Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay
statview\PBMC assays 05312009.svd and in the TVDC 7 (9633) bound
notebook pages 26 – 40, 45 – 47.
ii. Twelve of the 15 NHPs were vaccinated with LVS either by the scarfication or
sub-cutaneous route. Three were used as unvaccinated controls.
1. 12 NHPs were vaccinated during the week of May 17 (2 scarified and 2
s.c. vaccinated/day on 3 separate days).
2. The LVS was resuspended in 0.25 mL sterile water and a “drop” (60
microliters) of neat material was used for vaccination by scarification.
This was the highest dose possible from the DVC LVS Lot 16. For the
subcutaneous dose, 0.12 ml of LVS was diluted 1:1 with saline and
Page 7 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
injected. Both scarified and subcutaneous vaccinations were applied to
the upper shaved back of the monkeys.
Preparation Date:
Dilution
10-1
10-2
10-3
10-4
10-5
10-6
10-7
10-8
18-May-09
Scarification Inoculum Raw Data
Vol. Plated
Plate 1
Plate 2 Plate 3
(mL)
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
162
198
189
0.1
22
14
18
0.1
2
2
1
0.1
0
0
0
Mean
Mean CFU/mL
> 300
> 300
> 300
> 300
183
18
1.7
0
TNTC
TNTC
TNTC
TNTC
1.83E+08
1.80E+08
1.67E+08
0.00E+00
Dose Data
Mean
CFU/dose
10-1
TNTC
10-2
TNTC
10-3
TNTC
10-4
TNTC
10-5
1.10E+07
10-6
1.08E+07
10-7
1.02E+07
-8
10
0.00E+00
Dilution
Table 1: Culture data from 18MAY09 vaccine preparation. The shaded cells represent the
acceptable values. The left table presents CFU/mL values whereas the table on the right
presents the actual LVS CFU administered dose. These data are located in the following folder:
\\Saturn\absl3\Agent and Study Specific Data and Miscellaneous Documents\STUDY SPECIFIC
DATA\FY07\FY07-083 (TUL-08).
Preparation Date:
Dilution
10-1
10-2
10-3
10-4
10-5
10-6
10-7
10-8
20-May-09
Scarification Inoculum Raw Data
Vol. Plated
Plate 1
Plate 2 Plate 3
(mL)
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
230
230
120
0.1
18
18
18
0.1
2
0
2
0.1
0
0
0
Mean
Mean CFU/mL
> 300
> 300
> 300
> 300
193
18
1.3
0
TNTC
TNTC
TNTC
TNTC
1.93E+08
1.80E+08
1.33E+08
0.00E+00
Dose Data
Mean
CFU/dose
10-1
TNTC
10-2
TNTC
-3
10
TNTC
10-4
TNTC
10-5
1.16E+07
10-6
1.08E+07
10-7
7.80E+06
10-8
7.80E+06
Dilution
Table 2: Culture data from 20MAY09 vaccine preparation. The shaded cells represent the acceptable
values. The left table presents CFU/mL values whereas the table on the right presents the actual LVS
CFU administered dose. These data are located in the following folder: \\Saturn\absl3\Agent and Study
Specific Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY07\FY07-083 (TUL-08).
Page 8 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Preparation Date:
Dilution
10-1
10-2
10-3
10-4
10-5
10-6
10-7
10-8
21-May-09
Scarification Inoculum Raw Data
Vol. Plated
Plate 1
Plate 2 Plate 3
(mL)
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
n/a
n/a
n/a
0.1
15
15
12
0.1
1
1
3
0.1
0
0
0
Mean
Mean CFU/mL
> 300
> 300
> 300
> 300
n/a
14
1.7
0
TNTC
TNTC
TNTC
TNTC
n/a
1.40E+08
1.67E+08
0.00E+00
Scarification Inoculum Raw Data (after sitting at RT 2-3 hrs)
Vol. Plated
Dilution
Plate 1
Plate 2 Plate 3
Mean
Mean CFU/mL
(mL)
-1
10
0.1
> 300
> 300 > 300
> 300
TNTC
10-2
0.1
> 300
> 300 > 300
> 300
TNTC
10-3
0.1
> 300
> 300 > 300
> 300
TNTC
10-4
0.1
440
382
377
400
4.00E+07
10-5
0.1
26
25
46
32
3.23E+07
10-6
0.1
3
4
5
4
4.00E+07
10-7
0.1
1
0
0
0.3
3.33E+07
10-8
0.1
0
0
0
0
0.00E+00
Table 3: Culture data from 21MAY09 vaccine preparation. Vaccine was not administered on this
day due to a veterinary technician delay which resulted in the LVS suspension remaining at room
temperature for a minimum of two hours. Because of this, the stability was questioned and the
vaccinations halted. The vaccine preparation was retrieved and re-cultured to evaluate the
stability. The top table presents CFU/mL values as cultured immediately following preparation.
The bottom table presents culture data following the extended dose incubation at room
temperature. Results demonstrated a small decrease in titer following room temperature
incubation indicating a poor stability. Based on these data, the decision to delay the vaccinations
was valid. These data are located in the following folder: \\Saturn\absl3\Agent and Study
Specific Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY07\FY07-083 (TUL-08).
Preparation Date:
Dilution
10-1
10-2
10-3
10-4
10-5
10-6
10-7
10-8
22-May-09
Scarification Inoculum Raw Data
Vol. Plated
Plate 1
Plate 2 Plate 3
(mL)
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
> 300
> 300 > 300
0.1
0
0
0
0.1
0
0
0
0.1
3
2
0
0.1
0
0
0
0.1
0
0
0
Mean
Mean CFU/mL
> 300
> 300
> 300
0
0.0
1.7
0.0
0
TNTC
TNTC
TNTC
0.00E+00
0.00E+00
1.67E+07
0.00E+00
0.00E+00
Dose Data
Mean
Dilution
CFU/dose
10-1
TNTC
10-2
TNTC
10-3
TNTC
10-4
0.00E+00
10-5
0.00E+00
10-6
1.02E+06
10-7
0.00E+00
10-8
0.00E+00
Table 4: Culture data from 22MAY09 vaccine preparation. The shaded cells represent the
acceptable values. The left table presents CFU/mL values whereas the table on the right
presents the actual LVS CFU administered dose. As shown, the 10-4, 10-5, 10-7, and 10-8 dilution
Page 9 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
samples presented no growth. This was expected for the 10-8 dilution. It was hypothesized that
the lack of growth for the remaining dilutions was due to defective CHAB plates. An unusual
CHAB plate color was observed post incubation that was not seen on the plates prior to
incubation. This also was supported by the fact that the 10-3 dilution contained LVS colonies at
concentrations too numerous to count; dilution or plating errors would not result in such a drastic
decrease in CFU counts. This observation is currently being investigated. These data are located
in the following folder: \\Saturn\absl3\Agent and Study Specific Data and Miscellaneous
Documents\STUDY SPECIFIC DATA\FY07\FY07-083 (TUL-08).
Taken together, the data presented in Tables 1-4 indicate that the NHPs were vaccinated with
approximately 1.1 x 107 viable LVS bacteria.
3.
One week after LVS vaccination, all NHPs were bled and PBMCs were
prepared to assess their ability to produce IFNγ after stimulation with
LVS antigens. The data is shown in Figure 4.
Page 10 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
700
600
LVS hk Hi
A
LVS hk Mid
500
LVS ff Hi
400
LVS ff Mid
300
LVS ff Lo
LVS hk Super
200
700
600
Media
LVS hk Hi
B
LVS hk Mid
500
LVS ff Hi
400
LVS ff Mid
1.33, A07686
1.33, A07682
1.33, A07386
1.33, A06873
1.33, A06693
1.33, A06674
.67, A07686
.67, A07682
.67, A07386
.67, A06873
.67, A06693
.67, A06674
100
0
LVS ff Lo
300
LVS hk Super
200
1.33, A07610
1.33, A07566
1.33, A07418
1.33, A07395
1.33, A06702
1.33, A06675
.67, A07610
.67, A07566
.67, A07418
0
.67, A07395
100
.67, A06702
IFNg Spots (Mean +/- S.D.)
Media
.67, A06675
IFNg Spots (Mean +/- S.D.)
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 4: PBMCs from LVS vaccinated NHPs (one week post-vaccination) were resuspended at 1.33
or 0.67 x 106/ml (100,000 – 200,000/well) and stimulated with LVS antigens as indicated. Media
indicates no antigen was added. Antigen doses are 4 x 105 CFU/ml (Super), 1 x 105/ml (Hi), 0.25 x
105/ml (Mid) or 0.06 x 105/ml. Not all stimuli were used in every case due to insufficiency of PBMCs
and thus missing bars represent no testing was done using those stimuli. Panel A represents those
NHPs receiving LVS by scarification, Panel B shows those receiving LVS by sub-cutaneous
inoculation. Wells in which spots were TNTC were entered as 600 spots for data graphing.
4. Data Interpretation: 14 out of 15 LVS vaccination NHPs appeared to respond
to LVS vaccination by producing more IFNγ in response to LVS antigens as
compared to pre-vaccination levels (See Figure 3). One NHP, A06693
(scarification) appeared not to be mounting a response above its baseline
levels (comparing responses at 0.67 x 106/ml plated).
Page 11 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
5. Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay
statview\PBMC assays 05312009.svd and in the TVDC 7 (9633) bound
notebook pages 48 - 61.
4. Significant decisions made or pending
For LVS vaccinations of NHP, the DVC lot#16 LVS vials will be resuspended consistently in 250ul of
sterile water.
5. Problems or concerns and strategies to address
We may have reversed the FF and HK stocks of LVS antigens. New working stocks are being made
from the original stock.
6. Deliverables completed
None
7. Quality of performance
Excellent in May 2009
8. Percentage completed
45% of the scientific work is complete.
9. Work plan for upcoming month
a. Continue to bleed the May 2009 vaccinated NHPs weekly for assessment of immunity
b. Add SCHU S4 antigens to the set of stimuli used to assess immunity
c.Train NHPs to poles/collars and primate chairs.
d. Move animals to the ABSL3 and begin thrice daily observations for temperatures and
respirations.
e. The 3 control and 12 vaccinated NHP will be challenged with SCHU S4 in July 2009
Milestone 9
Milestone description: Aerosol SOP developed for GLP transition
Institution: LBERI
1. Date started: 8/13/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
No new work was performed during the month of May.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
LBERI needs to determine what will be considered an acceptable range of delivered SCHU S4 in the
aerosol (keeping in mind that pulmonary disease is established at or above 89 CFU).
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
40% of the scientific work is complete.
9. Work plan for upcoming month
a. Establish a broader acceptable challenge dose range (with input from the UNM TVDC team
and NIAID) and conduct an additional day of mock-qualification runs.
b. Revise and complete qualification plan for the aerosol and submit to UNM for review. New
data from the mock qualification runs and NHP exposures will be incorporated into the
pre-qualification data. This will alter (i.e., improve) the acceptable criteria (e.g., spray
factors, pre- versus post-bioaerosol values, etc.) and change the current draft version.
Page 12 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
All target challenge dose values will change since the challenge dose has been revised
from 500 to 1000 CFU presented.
Milestone 10
Milestone description: Efficacy testing of vaccine candidates (LBERI) and Characterization of
selected small animal model (UNM)
Institution: LBERI /UNM
1. Date started: 1/1/2009
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
None
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
This Milestone is active, but paused until a vaccine candidate is ready to test in NHP. The first
proposed vaccine candidate is the USAMMDA IND 157 LVS vaccine which has been used in humans
at USAMRIID. LBERI will not test any vaccine candidates, until MS8 shows that the DVC LVS lot#16
can protect NHP from SCHU S4 aerosol challenge.
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
2%
9. Work plan for upcoming month
a. Nothing is planned for the month of June as the experiment comparing USAMMDA IND 157
and DVC Lot 16 has been delayed until after the completion of TUL08B (MS 8).
Milestone 11
Milestone description: In vivo GLP NHP model efficacy SOP and efficacy testing of vaccine
candidates
Institution: LBERI
1. Date started: 1/16/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
Necropsy tissues were fixed and cut. Slide preparation was started.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
For the telemetered arm of the Natural History Study, NHP need to be larger and physically weigh
more to accommodate the telemeters, thus animals greater than 2.5 kg were requested. Availability
of these larger animals is being investigated in conjunction with orders. These NHP will likely have to
be between approximately 2 and 5 years of age.
6. Deliverables completed
Page 13 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
In-life non-telemetered arm of the SCHU S4 natural history study is completed.
7. Quality of performance
Good
8. Percentage completed
50% of the scientific work is complete.
9. Work plan for upcoming month
a. Final clinical chemistry and hematology data for the non-telemetered arm of the study was
obtained.. This data will be plotted and results will be analyzed.
b. Animals for telemetered portion arrive in early June. Quarantine will end early July and
surgeries to implant the telemeters will be scheduled after animals are released from
quarantine in August.
c.Histopathology slides for lungs, spleen, liver, kidney, nasal cavity, oropharynx with tonsils,
brain, bone with marrow (rib/femur), lymph nodes (tracheobronchial, retropharyngeal,
submandibular, mesenteric, axillary and inguinal), and representative lesions will be read for
the non-telemetered arm of the study.
Milestone 11
Milestone description: In vivo GLP model efficacy SOPS developed in one small species
and primate and efficacy testing of vaccine candidates
Institution: UNM
1. Date started: 1/16/2008
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Pdose3 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Gopi's experiments\Pdose 3)
i. The purpose of this experiment was to titer the volume of immune serum necessary to
protect Fischer 344 rats against i.t. SCHU S4 challenge. This is a repeat of
Experiment Pdose2, which showed that 250 l of immune rat serum protected rats
against an i.t. challenge dose of 360 SCHU S4, but the protection was lost when the
transferred serum volume was reduced to 25 l.
ii. In this experiment, rats were passively immunized with 25 or 250 l immune rat serum
one day before challenge with 233 SCHU S4. The results confirmed that 250 l of
immune serum are needed to protect rats against a challenge dose of 200 to 400
CFU SCHU S4 (Fig.1).
Page 14 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
233 CFU SCHU S4
Percent survival
100
80
NRS 250ul
IRS 250ul
NRS 25ul
IRS 25ul
60
40
20
0
0
10
20
30
Days Postchallenge
Figure 1. Titration of immune serum required to protect Fischer 344 rats against i.t.
SCHU S4 challenge. Fischer 344 rats (n = 6) were passively immunized i.p. with 25 or
250 l immune rat serum (IRS) or normal rat serum (NRS) 1 day before i.t. challenge with
233 SCHU S4. Survival was monitored daily.
b. Experiment Cdep8.1 (Notebook 141, pages 50-53)
i. The purpose of this experiment was to determine whether the OX-38 antibody can
deplete rat CD4 T cells in vivo. This antibody has been reported as a depleting
antibody and was obtained as a replacement for the W3/25 antibody which
inactivates but does not deplete CD4 T cells.
ii. Fischer 344 rats were injected i.p. with 0.5 mg/kg OX-38 or the isotype control antibody
55-6 and the rat splenocytes were analyzed 48 h later by flow cytometry to determine
the CD4 T cell depletion efficiency.
iii. CD4+ T cells constituted ~ 19% of the total splenocyte population in the rats treated with
the isotype control antibody. OX-38 treatment reduced the percent of CD4 T cells to
16% in one animal and 11% in a second animal. Our results thus far all indicate that
the maximum depletion of CD4 T cells by OX-38 antibody is 10%
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
The OX-38 and W3/25 antibodies do not completely deplete CD4 T cells in vivo. UNM will inactivate
CD4 T cells using a combination of OX-38 and W3/25 and confirm inactivation functionally
6. Deliverables completed
Showed that humoral immunity can play a role in controlling low dose respiratory SCHU S4 infection
7. Quality of performance
Good
8. Percentage completed
48%
9. Work plan for upcoming month
a. Humoral immunity
i. Determine the antibody level after passive immunization and just before SCHU
S4 challenge
ii. Isolate and passively immunize rats with purified IgG from immune rat serum
iii. In passively immunized rats, SCHU S4 growth is initially controlled but then
resumes by day 7 of infection. We will determine whether the resumption of
bacterial growth is due to depletion of transferred antibodies
Page 15 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
iv. Analyze cytokine profiled associated with passive immunization
b.Cellular immunity
i. Determine the importance of CD4 and/or CD8 T cells in the protection of LVS
vaccinated rats.
ii. Develop procedures for adoptive transfer of immune T cells into naïve rats.
Milestone 12/13
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and compared to those in other species.
Institution: LBERI
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
None in May 2009
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Protein assays are being developed in order to compare antigen preparation CFU to
LBERI and UNM wish to standardize the quantitation of antigen preparations.
protein mass.
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
90% of the scientific work is complete.
9. Work plan for upcoming month
a. Repeat the LVS CFU:Protein content assay
i. Make 1:1 dilutions rather than 1:9 dilutions
ii. Sonicate the LVS in lysis buffer to possibly elaborate more protein from the HK and FF
preparations
b. Construct a pooled negative control plasma sample for use in IgG anti-LVS ELISAs; this would
be used in conjunction with the positive control sample reported on in April.
c.Develop the microagglutination assay, per the procedure provided by Freyja Lynn at NIAID.
Milestone 12/13-UNM
Milestone description: Assays for detecting relevant immune responses in animals & humans
developed and Compare assays in animal models (sensitivity)
Institution: UNM
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc80.4 (Notebook 128, pages 84-86)
i. The purpose of this series of experiments was to optimize the Mabtech human IFN
ELISpot kit for detecting F. tularensis-specific responses in LVS vaccinated
Page 16 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
humans. We optimized the number of PBMC and concentration of antigens (HK
or FF-LVS) to minimize non-specific reactivity while maximizing sensitivity. In two
previous experiments, we tested: 1) dilutions of formalin-fixed and heat-killed
LVS from 1:100 to 1:10,000 at a constant cell number of 2.5 x 105 per well and 2)
cell numbers from 2.5 x 105 to 7.8 x 103 at a constant dilution of FF-LVS of 1:103.
ii. This current experiment confirmed our previous results and showed that the optimal
number of PBMC is 1.25 x 105/well and the optimal dilution of HK-LVS and FFLVS is 1:10,000 (Fig. 2).
250
Naive
Vaccinated
Spots/well
200
150
100
50
0
HK-LVS
FF-LVS
Figure 2. Optimization of human IFN ELISpot assay. Human IFN ELISpot assay was
optimized by titrating both the stimulating antigen (HK-LVS or FF-LVS) and PBMC from
unvaccinated (naïve) and LVS-vaccinated (vaccinated) donors. This figure shows
optimal response with 1.25 x 105 cells per well and 1:10,000 dilution of HK-LVS and FFLVS.
b. Experiment Ftc79.5 (Notebook 128, pages 87-90)
i. The purpose of this experiment was to optimize the ELISA to measure the titer of F.
tularensis antibodies in LVS vaccinated humans
ii. Human plasma samples collected from 3 unvaccinated and 2 vaccinated donors
were tested using heat killed LVS as the capture antibody
iii. Both serum samples from LVS vaccinated donors had clearly high titers (Fig. 3).
Two of the three serum samples from unvaccinated donors had clearly low titer, but
the third unvaccinated sample (had a titer as high as the vaccinated samples,
suggesting that this individual was previously exposed to Ft. This is not surprising
because USAMRIID found some UNM/LBERI LVS vaccinees to have high titers to
LVS when they were pre-screened prior to vaccination. Tularemia is endemic in New
Mexico rabbits and hunters could have been exposed this way.
Page 17 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
5
Naive 1
Vacc 1
Naive 2
Vacc 2
Naive 3
OD405nm
4
3
2
1
0
100
1000
10000
100000
Dilution
Figure 3.
Optimization of ELISA to measure the titer of human plasma antibodies against F.
tularensis. Dilutions of plasma from unvaccinated and LVS vaccinated donors were
analyzed by ELISA using heat-killed LVS as the capture antigen.
c. Experiment Ftc86.3 (Notebook 130, pages 84-90)
i. The purpose of this series of experiments is to correlate the amount of protein in heat
killed or formalin fixed bacterial preparations to the number of bacteria so that we
can normalize cellular responses to different antigen preparations across
experiments. In Ftc86.2, we found that protein concentration fell below the
detection limited after only a single 10-fold dilution.
ii. To increase the dynamic range of the standard curve, we increased the culture
period from 24 to 48 h. We did not complete this experiment because the 48 h
culture contained only 3.6 x 107 cfu/ml, similar to the yield after 24 h. We will
repeat this experiment as soon as more Chamberlains broth is available. UNM
ordered all of the Chamberlain’s components needed to prepare a new batch of
media powder.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Need to correlate the amount of protein in heat killed or formalin fixed bacterial preparations to the
number of bacteria so that we can normalize responses to different antigen preparations across
experiments.
6. Deliverables completed
ELISA for measuring FT-specific antibody titer in vaccinated humans
7. Quality of performance
Good
8. Percentage completed
78%
9. Work plan for upcoming month
a. Repeat IFN ELISpot assay and ELISA with additional human samples in order to establish
robustness of assay and to generate distinguishing profiles of vaccinated individuals.
UNM is aiming to test plasma/sera from approximately 20 unvaccinated humans and 20
LVS vaccinated humans.
b. Repeat experiment to correlate amount of protein to number of LVS in the antigen
preparations
c. Establish the microagglutination assay to measure humoral immune responses, per Freyja
Lynn’s request
Page 18 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 14
Milestone description: Assays in vaccinated humans validated (sensitivity)
Institution: UNM/LBERI
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
No work was done
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
None
7. Quality of performance
None in May 2009.
8. Percentage completed
5%
9. Work plan for upcoming month
a. All work is contingent on the availability of assays and reagents described in MS21
b. Determine the titer of anti-Ft antibodies in sera from convalescent tularemia patients on
Martha’s Vineyard
c. Quantify the number of IFN producing cells in PBMCs from convalescent tularemia
patients on Martha’s Vineyard
Milestone 17
Milestone description: In vitro assay for analysis of cellular and humoral elements of the
immune response in vaccinated human and animal’s response to F. tularensis established
Institution: UNM
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
No work was done during this month.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
No work was done during this month because UNM is developing human and rat assays to
selectively deplete effector subsets in vitro , under Milestone 11.
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
0%
9. Work plan for upcoming month
No work planned
Page 19 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 18
Milestone description: Role of specific  T cells in protection
Institution: UNM/LBERI
1. Date started: 7/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
No work was done
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
UNM cannot re-start this milestone until a human assay is developed in MS21.
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8. Percentage completed
5%
9. Work plan for upcoming month
No work planned
Milestone 19
Milestone description: Interaction between human alveolar macrophages and F. tularensis
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
No new work done this period
4. Significant decisions made or pending
Will terminate work with human alveolar macrophages if all required alveolar macrophage work has
been completed on the contract.
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
Characterized the uptake and bacterial replication in alveolar macrophages and the anti-bacteria
activities of alveolar macrophages after cytokine stimulation
7. Quality of performance
None in May 2009
8. Percentage completed
25%
9. Work plan for upcoming month
Reviewed contract documents and will confer with NIAID Contract and Project Officers at the July 8,
2009 UNM Prime Tech call.
Page 20 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 21
Milestone description: Correlates of protection: in vitro assay or other readout of effector
function of Ft developed for multiple species.
Institution: LBERI
1. Date started: 4/8/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
700
600
500
400
300
Media
LVS hk Hi
LVS hk Mid
LVS ff Hi
LVS ff Mid
LVS ff Lo
LVS hk Super
200
1.33, Day 211
1.33, Day 175
1.33, Day 35
.67, Day 211
0
.67, Day 175
100
.67, Day 35
IFNg Spots (Mean +/- S.D.)
a. Processed PBMCs from an NHP (A06199) that had been vaccinated with LVS by
scarification in October 2008 (dose of 2.7 x 105 CFU) and which received a bronchoscopy to
deliver 800 CFU SCHU S4.
b. NHP A06199 survived the SCHU S4 bronchoscopic challenge and was euthanized on
5/15/09 (21 days post-SCHU S4 delivery).
a.Note: Two other NHPs that received LVS by scarification in October 2008 were also
subjected to SCHU S4 bronchoscopy and were euthanized on day 4 postbronchoscopy. Data from these studies will be presented in the UNM technical call
and report.
b.Figure 5 compares PBMCs from A06199 harvested on Day 35 post-LVS vaccination,
Day 175 post-LVS vaccination (shortly before SCHU S4 bronchoscopy) and Day 21
post SCHU S4 bronchoscopy as to their ability to produce IFNγ.
Figure 5: PBMCs from one LVS vaccinated NHP who was subsequently exposed to SCHU S4 by
bronchoscopy were resuspended at 1.33 or 0.67 x 106/ml (100,000 – 200,000/well) and stimulated with
LVS antigens as indicated. Media indicates no antigen was added. Antigen doses are 4 x 10 5 CFU/ml
(Super), 1 x 105/ml (Hi), 0.25 x 105/ml (Mid) or 0.06 x 105/ml. Not all stimuli were used in every case due
to insufficiency of PBMCs and thus missing bars represent no testing was done using those stimuli. Wells
Page 21 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
in which spots were TNTC were entered as 600 spots for data graphing. Days indicated refer to the day
post-LVS vaccination. SCHU S4 bronchoscopy was performed on Day 190 post vaccination.
c. Data Interpretation: SCHU S4 bronchoscopy elicits a strong immune response in LVS
vaccinated NHP as evident by increased IFNγ production as compared to pre-SCHU S4
delivery. This LVS vaccinated NHP’s survival to day 21 supported that the DVC Lot#16
LVS is protective against a SCHU S4 challenge.
d. Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC
assays 05312009.svd and in the TVDC 5 (9247) bound notebook pages 63 - 67, the
TVDC 7 (9633) bound notebook pages 10 – 19, – 25 and 38 - 41 and in the ABSL3
TVDC Binder (Experiment TUL76).
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
4% of the scientific work is complete
9. Work plan for upcoming month
a. Repeat ICCS assay and include a positive mitogen control (Con A); use PBMCs from newly
vaccinated NHPs (for MS8)
b. Test 20 – 48 hours of stimulation with LVS
Milestone 21
Milestone description: T cell-induced macrophage killing of intracellular bacteria
Institution: UNM
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment FT-AH-18 (L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Andrew's experiments\FT-AH-18) and Experiment FT-AH-20 (18
(L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and Results\Andrew's
experiments\FT-AH-20)
i.
UNM showed previously that pre-stimulation of human PBMC with TNF and
IFN 48 h before SCHU S4 infection was sufficient to reduce SCHU S4 growth.
IFN was clearly detected by IFN ELISpot assays within 24 h of stimulating
vaccinated human PBMC with killed bacteria; however, HK-LVS or FF-LVS has
so far failed to specifically activate the PBMCs to control SCHU S4 growth in
vitro. It is possible that HK and FF-LVS does not induce human PBMC to
produce enough IFN and TNF to induce control of SCHU S4 growth by the
human PBMC.
Page 22 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
ii.
In Experiment FT-AH-18, we compared the amount of TNF and
IFNproduced in FF-LVS stimulated human PBMC cultures to the amount of
these cytokines in measured in human PBMC cultures stimulated with
recombinant TNFα and IFN. UNM found, for the first time, that FF-LVS prestimulation reduced the number of SCHU S4 growing in human PBMC in an
antigen specific manner (Fig. 4). Interestingly, the human PBMC cultures
stimulated with FF-LVS had much lower levels of TNFα and IFN at 72 h post
SCHU S4 infection than the untreated human PBMC cultures which had at least
10-fold higher bacterial burden. This suggests that FF-LVS stimulation has some
effect on the SCHU S4 infected macrophages and closer examination of this
effect may lead to an alternative correlate of protection assay.
Page 23 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A
B
Figure 4. Correlation between human PBMC antibacterial activity and cytokine levels 72
h after infection. PBMC from an unvaccinated and an LVS vaccinated human donors
were either left untreated, pre-stimulated with IFN and TNFα or with killed bacteria 48 h
before SCHU S4 infection. Bacterial burden (A) and cytokine levels (B) were measured
72 h after infection.
Page 24 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
iii.
In FT-AH-20, UNM determined whether IFN was produced earlier in the
experimental course. PBMC from an LVS vaccinated donor were either left
untreated, pretreated with recombinant IFN and TNFα or pretreated with FFLVS 48 h before SCHU S4 infection (Fig. 5). Culture supernatants were
collected daily and analyzed for TNFα and IFN. 24 h after FF-LVS prestimulation, the amount of TNFα and IFN was over 10-fold higher than that
found when the PBMC was pre-treated with recombinant TNFα and IFN. This
suggested that FF-LVS pre-stimulation induced production of more than enough
cytokine necessary to limit bacterial growth in the human PBMC. Indeed, 100fold less SCHU S4 was recovered from the FF-LVS stimulated culture than from
the cultures treated with recombinant cytokines. Since this experiment did not
include unvaccinated PBMCs as controls, we do not know if the reduction is
antigen specific. Experiments with additional vaccinated and unvaccinated
donors will be needed to confirm this result.
Page 25 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
A
B
8
control - no pretreatment
FF-LVS
total CFU / well (log 10)
7
IFNg + TNFa
6
5
4
3
2
0
72
hours post-infection
Figure 5. Kinetics of cytokine production by vaccinated human PBMC pre-stimulated with
FF-LVS or recombinant TNFα and IFNγ. PBMC from a LVS vaccinated human donors
were either left untreated, pre-stimulated with IFN and TNF or with FF-LVS 48 h before
SCHU S4 infection. (A) Culture supernatants were collected daily and analyzed for
cytokine levels. (B) 72 h after SCHU S4 infection was determined.
Page 26 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
b. Experiment PFT7(L:\Lyonslab\Personal Folders\Amanda\NHP phenotyping data
analysis\PFT7&D:\My Documents\NHP studies\PFT7)
i. In this experiment, 3 cynomolgus macaques vaccinated in October 2008 via
scarification (3x105 cfu LVS) were challenged with approximately 750 cfu of Schu
S4 via bronchoscope instillation. The purpose of this experiment was to evaluate
the ability of LVS vaccinated NHP to control a lethal Schu S4 challenge, as
measured by bacterial burden and survival (for 1 NHP), and the immune
response to the challenge by IFNγ ELISpot and intracellular cytokine staining,
each of which is being evaluated as a potential correlate of protection.
ii. Lung, tracheobronchial lymph nodes (TBLN), spleen, liver, blood and serum samples
were collected from 2 NHPs on day 4 and 1 NHP on day 21 after Schu S4
challenge and bacterial burden was assessed. Single cell suspensions from lung,
TBLN, and spleen were used in an IFNγ ELISpot and for intracellular cytokine
staining to determine the percentage of CD4+ cells simultaneously secreting
TNF, IL-2, or IFN (multifunctional cells).
iii. Schu S4 was detected in the lung, TBLN, spleen and liver of NHPs sampled on day 4
(Fig. 6) but these levels were reduced compared to bacteria detected in the
corresponding tissues of unvaccinated animals after a similar Schu S4 challenge
(Figure 7). Bacterial levels were reduced in the lungs and TBLN on day 21 and
were not detectable in the spleen or liver. Schu S4 was not detected in the blood
of any animal. These data indicate that while the bacteria is able to undergo
expansion in the lungs and draining lymph nodes and disseminate systemically,
both can be controlled to some extent by vaccination. These data together with
the survival of the NHP to day 21 is the strongest evidence collected thus far that
LVS vaccination can be protective against a lethal pulmonary Schu S4 challenge.
iv. IFNγ ELISpot was performed using fresh lung, TBLN, and spleen cells from the LVS
vaccinated/SchuS4 challenged NHP collected on day 21 post-challenge and
frozen, thawed cells from an untreated NHP. Cells were plated at 150,000
cell/well for lung and TBLN and 100,000 cells/well for spleen and treated with
media, dilutions of heat-killed (HK) and formalin-fixed (FF) LVS, or
PMA+Ionomycin (mitogen) for approximately 12 hours. LVS-specific responses
were detected in all three tissues from an LVS vaccinated/LVS challenged NHP
but none from an untreated NHP. Cells isolated from the untreated NHP could
respond equally well to mitogenic stimulation (Figure 8).
Page 27 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 6. Bacterial burden (cfu/g) in tissues isolated from LVS vaccinated/SchuS4 challenged NHP 4 and
21 days after challenge.
Figure 7. Bacterial burden (cfu/g) in tissues isolated from untreated (A) and LVS vaccinated (B) NHPs at
indicated days after SchuS4 challenge.
Page 28 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 8. IFNγ ELISpot responses in frozen, thawed cells from an unvaccinated NHP and fresh cells
isolated from indicated tissues of an LVS vaccinated NHP 21 days after SchuS4 challenge. Bars
represent the mean ± standard deviation of spots in indicated wells.
v. Intracellular cytokine staining was performed using fresh lung, TBLN, and spleen
cells from the LVS vaccinated/Schu S4 challenged NHP only. (Previous
experiments have confirmed tularemia-specific responses can not be detected
using cells from untreated NHPs). Cells were treated with media alone, α-human
CD28, α-human CD28+HK-LVS, or PMA/ Ionomycin for 6 hours or α-human
CD28+HK-LVS for 12 hours. An extended stimulation time was included based
on data from other groups indicating some cells require more than 6 hours of
stimulation before cytokines can be detected, even with intracellular staining. No
increases in the frequency of multifunctional cells were detected in any of the
tissues examined on day 4 or in TBLN on day 21 (Fig. 9). A slight increase was
seen in splenocytes stimulated for 6 hours, but this increase was no longer
detectable after 12 hours of stimulation (Fig. 9A). Almost 1% of lung cells were
secreting all 3 cytokines without stimulation and this level was not increased with
6 or 12 hours of stimulation (Fig. 9B).
Page 29 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 9. Percentage of multifunctional cells (CD4+TNFα+IL-2+IFNγ+; y-axis) in indicated tissues of an
LVS vaccinated NHP 21 days after Schu S4 challenge following various in vitro re-stimulation. Blue and
green bars represent data from the individual animals on day 4, the red bars data from the animal on day
21 (mean ± standard deviation).
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
64 %
9. Work plan for upcoming month
a. Repeat experiment to examine human PBMC cytokine production after FF-LVS prestimulation and antibacterial activity.
b. Determine the minimum amount of recombinant IFN and TNFα required to control SCHU
S4 growth
c. Determine method to maximize IFN and TNFα production by PBMC
Page 30 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 29
Milestone description: Analysis of T cells from lymph nodes & T cell epitopes
Institution: LBERI
1. Date started: 8/7/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
No new work was performed during the month of May.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
None in May 2009
8.
Percentage completed
16% of the scientific work is complete
9. Work plan for upcoming month
a. We are planning to boost the LVS immunity of the one primate remaining that was vaccinated
with LVS in October 2008 by sub-cutaneous inoculation. The boost will occur by injecting
0.12 ml of DVC Lot #16 LVS diluted 1:1 with saline via the sub-cutaneous route. LBERI will
wait for UNM to request the boost.
Milestone 29
Milestone description: Analysis of T cells from NHP lymph nodes and T cell epitopes
Institution: UNM
1. Date started: 10/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
a. When UNM screened ASU’s F. tularensis polypeptide library, UNM found several potential
stimulatory peptides but most of them were not reproducible in the replicate well or the
2nd tissue (spleen and lymph node). In order to verify the results from the first screen,
UNM plans to rescreen individual polypeptides with splenocytes and lymph node cells
frozen at the time of the initial screen. The stimulatory polypeptides were selected based
on statistical analyses by Phil Stafford at ASU.
b. In a previous experiment, UNM recovered 61% viable splenocytes and 53% viable LN cells
post thawing the frozen NHP cells. There are enough frozen splenocytes and lymph
node cells for 656 wells and 360 wells, respectively.
c. Experiment Ftc82 (Notebook 139, pages 8-9)
i. The purpose of this experiment was to determine whether the frozen cells retained
similar reactivity to FF LVS antigens as fresh cells. As shown in Table 1 results from
an IFNγ ELIspot assay, frozen cells appeared to have lost some reactivity to formalinfixed LVS. This suggests that UNM may not be able to confirm the results of the
initial screen with frozen cells.
Page 31 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Table 1. Reactivity of fresh and frozen cells to formalin fixed LVS*
Lymph node cells
Splenocytes
Fresh
18 ± 8
20 ± 14
Frozen
3, 12
3,1
* values in the table are numbers of spots detected
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
Cells frozen during the initial screen may not be as reactive as fresh cells in the IFN ELIspot assay.
UNM will increase the number of frozen cells per well to increase the assay sensitivity.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
18%
9. Work plan for upcoming month
a. Determine whether increasing the number of frozen cells will increase the assay sensitivity
b. Test individual stimulatory peptides from the stimulatory pools identified by Phil Stafford
with LN cells and splenocytes frozen from Experiment Ftc82 or with freshly harvested LN
cells and splenocytes from a different LVS vaccinated and LVS boosted NHP
Milestone 35
Milestone description: Array hybridization with mouse RNA from virulent SCHU S4
infection and RT PCR confirmation of candidates
Institution: UNM/ASU Johnston
1. Date started: 8/1/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ftc86,1 (Notebook 130, pages 71-79) and Experiment Ftc86,2 (Notebook
130, pages 80-83)
i. The purpose of these experiments was to isolate lung RNA from BALB/c
mice 1, 3, 5, 7, and 24 h after infection with SCHU S4. ASU specifically
asked for a minimum lung deposition of 1,000 cfu to increase sensitivity of
detecting Ft gene expression in the mouse lung RNA preparations
ii. The two sets of mouse RNAs have been isolated and shipped to ASU.
4. Significant decisions made or pending
No work done
5. Problems or concerns and strategies to address
Increasing the sensitivity of ASU’s microarray detection of Ft gene expression in mouse lung RNA
preparations, by increasing the SCHU S4 bacterial burdens in the mouse lungs
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
30%
9. Work plan for upcoming month
Page 32 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
a. UNM will isolate lung RNA from Fischer 344 rats 1, 3, 5, 7, and 24 h after i.t.
challenge with SCHU S4, as requested by ASU.
Milestone 35
Milestone description: Array hybridizations with mouse RNAs from virulent Schu 4 infection &
RT PCR confirmation of candidates.
Institution: UNM/ ASU-Johnston
1. Date started: 04-01-2007
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
 Previous Results: ASU LAPT tested the two mouse and one rat time course experiments using
the previously standardized static ArrayIt chamber system. While troubleshooting microarray
processing problems, ASU identified a better microarray hybridization condition using the Agilent
hybridization chambers that mix during hybridization.
Current status: ASU processed one of mouse and the rat time course sample sets using the
Agilent hybridization chamber with mixing. In addition, these samples were processed with the
genomic normalization process. The previous samples were processed without genomic
normalization while ASU was troubleshooting the hybridization conditions. The raw signal
intensities of the rat time course samples (1, 3, 5, 7, and 24 hours post infection) of the LAPT
cDNA and the genomic signals are shown in Figure 1. The goal of genomic normalization is to
utilize a constant-low-level genomic DNA signal on each probe spot to normalize the values of
the cDNA signal. This allows for more consistent experiment to experiment and slide to slide
comparisons. The upper panel in Figure 1 shows the raw signal intensities for the various time
course cDNA samples. The median signal intensities are well within the expected range at >
1000 fluorescent units. The lower panel shows the genomic DNA signals from each array with
the predicted signal levels. The data are processed to provide a ratio of the each specific gene
to its genomic signal for subsequent data processing in the GeneSpring microarray analysis
software. This type of signal acquisition shows expected patterns and indicates that we have
generated good quality arrays.
Page 33 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 1. Raw signal intensities of the Rat time course samples processed on the Agilent hybridization
chamber with both cDNA and genomic DNA for normalization. The upper panel is the cDNA signal scan
and lower panel is the genomic DNA control signal scan.
File locations …, R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT 31 (NM tc III second run
lp)\050709lp\cDNA_Genomic_Signals.JPG
Notebook 966, LAPT 29 and 31 Re-Hyb, page 83-90.
ASU received kinetic timecourse sets of RNA samples from Terry Wu (UNM) from two mouse
challenge experiments (FTC 64,6 and FTC 64,7). The results of the bacterial burden performed
at UNM are shown in Table 1. ASU had requested at least a 2,000 CFU burden at T1 hour to
increase the sensitivity of FTU gene expression detection in both the microarray gene
expression and qPCR validation experiments. For both the experiments, the CFU burden values
indicate that there was a highly reproducible and well-targeted deposition of bacteria in the lung.
The total CFU burden for both experiments was relatively stable around 4,000 for each time
point from 1- 7 hours. By 24 hours, the bacterial burden had increased by slightly more than 2
logs. These results indicate that UNM was accurate and achieved the targeted challenge dose.
Hour
FTC 64,6
FTC 64,7
1
4,490
4,960
3
3,890
7,130
5
3,820
4,090
7
4,010
2,850
24
616,000
680,000
Table 1. Average Francisella tularensis burden per lung at each time point post infection.
File locations …, R:\GeneVac\FTU\Contract\Microarray\Milestones\35\NM tc IV (Ftc 64,6)\ 64,6 S4
inoc+burden.xls;
R:\GeneVac\FTU\Contract\Microarray\Milestones\35\NM tc V (Ftc 64,7)\ 64,7 S4 inoc+burden.xls
Page 34 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
The RNA was pooled for each of replicate mice (3 mice per time point) in each kinetic timecourse
series and processed by RNAeasy cleanup and each pool was tested for integrity by
Bioanalyzer. The results shown in Figure 2 (FTC 64,6) and Figure 3 (FTC 64,7) reveal that each
sample has the expected two key ribosomal bands with no sign of degradation. This indicates
that ASU has good quality RNA which is ready for processing by LAPT.
Figure 2. Bioanalyzer results of pooled, purified
RNA from FTC 64,6. Lane L is the Ladder, Lane 1
is Time 0 RNA, Lane 2 is 1 Hr RNA, Lane 3 is 3 Hr
RNA, Lane 4 is 5 Hr RNA, Lane 5 is 5 Hr RNA,
Lane 6 is 24 Hr RNA,
Figure 3. Bioanalyzer results of pooled, purified
RNA from FTC 64,7. Lane L is the Ladder, Lane 1
is Time 0 RNA, Lane 2 is 1 Hr RNA, Lane 3 is 3 Hr
RNA, Lane 4 is 5 Hr RNA, Lane 5 is 5 Hr RNA,
Lane 6 is 24 Hr RNA,
File locations …,
R:\GeneVac\FTU\Contract\Microarray\Milestones\3
5\NM tc IV (Ftc 64,6)\ 2100 expert_ProkaryoteTotal
RNA Nano_DE11400759_2009-06-04_11-3218.pdf
File locations …,
R:\GeneVac\FTU\Contract\Microarray\Milestones\3
5\NM tc V (Ftc 64,7)\ 2100 expert_ProkaryoteTotal
RNA Nano_DE11400759_2009-06-04_13-5524.pdf
Notebook 966, New NM TC’s, page 99.
Notebook 966, New NM TC’s, page 101
4. Significant decisions made or pending
ASU will use the Agilent hybridization chamber with mixing, replacing the static Arrayit hybridization
system
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
85%
9. Work plan for upcoming month
The new mouse time course RNA’s will be LAPT processed and hybridized using the Agilent
hybridization chambers.
Page 35 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 36
Milestone description: Final integration of expression data and informatics analysis
Institution: UNM/ ASU-Johnston
1. Date started: 03-01-2009
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
From the Agilent-processed arrays, ASU selected the top 200 genes that were either Up-Regulated or
Down-Regulated in the Rat and Mouse time course experiments. Figure 4 shows a Venn diagram
analysis of the two gene lists. The two species have 36 Up-regulated and 15 Down-Regulated genes in
common. This result is similar in percentage to previous cross-species comparisons. Having results from
two species may increase the confidence in the final gene selections for potential vaccine candidates.
This result indicates that the level of overlap of gene lists is comparable to previous gene selections.
ASU performed a bioinformatic comparison to previous transcriptome data which showed minimal gene
expression overlap (data not shown). The significant differences between the static and mixed
hybridization conditions and the normalization conditions were expected to result in the differences in the
final gene lists. The current process with the Agilent hybridization chambers using genomic DNA
normalization will be the standard for future comparisons.
Figure 4. Venn diagram analysis of gene lists from Agilent processed arrays between one of
the mouse and the rat sample sets.
File locations …,
R:\GeneVac\FTU\Contract\Microarray\Milestones\36\LAPT_29_&31_Re-Hybs\Rat_Mouse
_Agilent_Venn.JPG
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
Page 36 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
12%
9. Work plan for upcoming month
Continue to scan literature for virulence or antigenicity-related F. tularensis genes. Will include
literature reported genes in databases for comparisons to proteomic and transcriptome data
generated at ASU.
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis (SCHU S4) (iglC,
pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F. tularensis subsp.
tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F. tularensis subsp.
tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
In order to generate mutants in SCHU S4 we need to develop tools to generate successful deletions.
Therefore, our focus is two fold, one is cloning experiments to get our target deletions into vectors that we
can use in creating these deletions and experiments with SCHU S4 itself using constructs that we believe
will allow us to make deletions into SCHU S4.
I. Cloning:
a. Using the F.novicida T20 NadM genomic as a template we generated a PCR (≈3700
bp) product with the new nadM Bgl II oligo and the previously used nadM Sal I stop
primer. This PCR product along with the pJC84 plasmid were treated with Sal I
restriction endonuclease and subsequently cleaned up via phenol chloroform extraction.
This was followed with treatment with Bgl II for the PCR product and BamHI for the
pJC84 plasmid. These treated DNAs were loaded on a 1% agarose gel and
electrophoresed. Using Qiagen’s gel extraction kit we isolated each of the treated
DNAs. A ligation reaction was performed with pJC84 Sal I BamHI treated and T20
NadM PCR Sal I Bgl II treated DNA. This ligation was used to transform DH5α cells and
hundreds of transformants resulted. Eleven of these transformants were randomly
selected and plasmids were isolated. Restriction endonuclease digestion with BamHI
was the initial screen. Then a few of the initial plasmids were digested with Pst I (Figure
1). Data located in TVD UTSA Notebook 7, page 95, 96, 103 and 104.
Page 37 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 1.
Figure 1 represents ten pJC84 +T20 NadM plasmid digestion profiles; panel A is a BamHI digestion of all
ten plasmids and panel B shows just three select plasmids digested with Pst I enzyme. Lanes 2 (uncut) and
3 (restriction digested) represent the parent plasmid pJC84. Lanes 4 thru 15 represent the potential
pJC84=T20NadM constructs. Panel A illustrated a linearization of the plasmid pJC84 parent and the desired
pJC84+T20 NadM construct; therefore, the correct plasmid shifted in size to ≈7500 bp and the parent
plasmid remained at ≈3800 bp. The BamHI digested showed one clone to be correct (C5pJC84T20NadM,
lane 8, at 7500bp). In Panel B, UTSA further verified clone 5 by doing a Pst I digestion which cut the
correct construct within the cloned T20 NadM sequence and also within the plasmid pJC84 generating a two
band profile. The correct plasmid cut with Pst I should have a band at ≈6300 bp and ≈1200 bp compared to
the parent plasmid yielding only one band at ≈3800 bp. Lane 8 in Panel B shows the correct Pst I
restriction pattern for the NadM plasmid. Data located in TVD UTSA Notebook 7, pages 103 and 104.
b. The pJC84 + T20 nadM (Sal I/Bgl II) construct may be completed. UTSA will verify the
construct by PCR on the potential correct plasmid (C5) and by sequencing this plasmid.. Once
the NadM construct is confirmed, this plasmid will be used in an electroporation and
cryotransformation experiment with Schu S4 (KKT1).
II. Experiments to generate mutants in Schu S4:
a. The last report indicated various potential NadM mutants which were selected for further
passaging to generate more isolated clones. The clones N2F-3A, N3-4B, 4-33h3A, N7-6,423A2B, N7-6,5-3D4B, C and D were used to continue with passaging to generate single
colonies. These single colonies were used to prepare genomic isolations and used in a
polymerase chain reaction using the earlier mentioned oligos:
nadM-NcoI: 5’- cgcgcgccatgggcatgtatgatatttcagtttttataggaagatttcag -3’
nadM-EcoR1: 5’- cggaattcttatagtttcttaccacattcctctaataaaatc -3”
These oligos will yield the mutant profile of ≈1900 bp for the complete correct NadM mutant
and the wild type profile with be ≈1000 bp (Figure 2). UTSA used some name abbreviations
to make the figure easier to read: N7-6,5-3D4B is designated N5-3D4B; N7-6,5-3D4B1 is
designated as N5-3D4B1; N7-6,5-3D4C1 is designated N5-3D4C1. Figure 2 shows only a few
of the screened genomic isolations performed during this month.
Page 38 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 2.
1 Kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14
2.0
1.0
Legend:
1. 1 Kb ladder
2. KKT1
3. N5-3D4B
4. N5-3D4C1
5. N5-3D4C2
6. N5-3D4C3
7. N5-3D4C4
8. N5-3D4C5
9. N5-3D4C6
10. N5-3D4C7
11. N5-3D4C8
12. N5-3D4D1
13. N5-3D4D2
14. N5-3D4D3
15. N5-3D4B1
16. N5-3D4B2
17. N5-3D4B3
18. N5-3D4B4
19. N5-3D4B5
20. N5-3D4B6
21. N5-3D4B7
22. N5-3D4B8
2.1
0.7
1 2 3 15 16 17 18 19 20 21 22
Figure 2 represents the PCR profiles of various cycled NadM Schu S4 mutant candidates using the forward
and reverse NadM oligos. The correct Schu S4 NadM mutant should yield only one pcr product of ≈1900 bp.
The wild type profile (lane2) will show ≈1000 bp pcr product. Lane 3 is a previously passaged clone which was
run as control to check banding profiles. The remaining lanes represent isolated Schu S4 NadM clones that were
on cycle 9 or 10. There may be one complete NadM Schu S4 mutant N5-3D4B4 in lane 18 which shows the
1900bp without the 1000bp wild type product). The comparison with the respective parent (lane 3) show that a
few other lanes may have a stronger mutant product band than previously seen and UTSA may continue with
passaging some of these (perhaps, N5-3D4C5 (ln 8), N5-3D4C6(ln 9), N5-3D4D1 (ln 12) and N5-3D4D3 (ln14)
from this test group). In addition, will need to continue with N7-6,N5-3D4B4 (ln 18) to generate another set of
single colonies from this parent bacteria to verify the clone’s stability. Data located in TVD UTSA Notebook 7,
page 99.
b. The clone N7-6,N5-3D4B4 was a slow growing clone . UTSA will expand this patched clone
and generate more single colonies from the parent clone and verify this profile. Therefore,
this coming month, UTSA will continue to passage this clone by streaking for single colonies
on a TSA+++ 60ug/ml kanamycin plates which will be grown and 30°C. Isolated clones from
this passage will be screen by PCR to search for the correct ≈1900 bp band without any wild
type band present (≈1000 bp). If the N5-3D4B4 clone can be passaged again then the clone
is stable and UTSA will have more confidence in this promising NadM clone. We need to be
sure that we have a single clone without any wild type present. This mutant seems to have
issues and the question is does the transposon remain in the chromosome. And if there is
still wild type in the mix this will out grow the desired clone so we need to find this single
clone by screening the resulting singles. Essentially if we have a clone every single colony
generated from the next passage should give the mutant’s PCR profile only. If we do not
have this then the mutant may not be stable enough to be able to use for our purposes.
c. The new intron II FTT0748 construct, pKEK1261 was used a cryotransformation experiment
and resulted in transformants. UTSA randomly selected 10 transformants and isolated
genomic DNA from these clones. Using forward and reverse oligos (*) directed to the
FTT0748, UTSA performed PCR on these genomic DNAs. In addition, UTSA used the
FTT0748 Nco I F (forward primer) with the universal EBS oligo which is directed to the intron
portion on the insertion which will verify that this intron is inserted at the correct location on
the SCHU S4 chromosome (Figures 3 and 4).
a. FTT0748 Nco I F: 5’-gcgcccatgggtgaagacaaaagaattcaagtaat-3’
b. FTT0748 Xho I R: 5’-gcgcctcgagttatttaatcccaatctcatctat-3’
Page 39 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Figure 3.
1 Kb
1
2
3 4
5
6
7
8
9 10 11 12 13
1.7
0.7
Legend:
1. 1 Kb Ladder
2. KKT1
3. 748-C1
4. 748-C2
5. 748-C3
6. 748-C4
7. 748-C5
8. 748-C6
9. 748-C7
10. 748-C8
11. 748-C9
12. 748-C10
13. KEK1261 FT0748
Figure 4.
Legend:
1 Kb
1
1.5
1.0
2
3
4
5
6
7
8
9 10 11 12 13
1. 1 Kb Ladder
2. KKT1
3. 748-C1
4. 748-C2
5. 748-C3
6. 748-C4
7. 748-C5
8. 748-C6
9. 748-C7
10. 748-C8
11. 748-C9
12. 748-C10
13. KEK1261 FT0748
Figures 3 and 4 represent the PCR profiles of various FTT0748 Schu S4 mutant candidates using the
forward and reverse FTT0748 oligos in figure 3 and forward FTT0748 with universal EBS intron specific
oligo in figure 4. In figure 3, the correct Schu S4 FTT0748 mutant should yield only one pcr product of
≈1700 bp and wild type profile (lane2) will show ≈700 bp pcr product. In figure 4 we are looking for the
correct insertion of the FTT0748 intron into the SchuS4 chromosome. The expected size for this pcr product
is ≈800 bp which represents the intron portion of the FTT0748 intron II construct with a 5’ end of the
FTT0748 gene located on the Schu S4 chromosome. All the selected FTT0748 Schu S4 mutant candidates
have the intron II at the correct location. In figure 3 we see that out of 10 potential mutants five seem to be
complete FTT0748 mutants (lanes 5, 6, 8, 9 and 10). Data located in TVD UTSA Notebook 7, page 101 and
102.
d.
UTSA will continue with passaging of clones 7 and 8 to verify single clones and then will cure
the plasmid from the correct FTT0748 mutant. The curing of the plasmid involves passage of
the mutant onto non-select TSA+++ plates to generate single colonies and these clonies are
verified for loss of plasmid by patching on 60 ug/ml kanamycin TSA+++ plates and look for
sensitivity (no growth) on these plates.
Page 40 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
4.
Significant decisions made or pending
None
5. Problems or concerns and strategies to address
We need to confirm the NadM Schu S4 mutant by generating single clones via passaging and
confirm the stable and correct insertion of this intron. In addition, once the plasmid construct
pJC84 + T20 NadM is confirmed via sequencing, then UTSA will begin experiments with this
construct in hopes to generate this NadM mutant in SCHU S4 by this method.
UTSA notes that the NadM gene has been a challenge. UTSA has criteria for stopping the pursuit
of the NadM gene mutant in SCHU S4. UTSA will stop the pursuit of the NadM gene when UTSA
finds that the mating plasmid pJC84 does not solve the problems—this approach creates the
insertion at a different location in the gene and this may help. UTSA still needs to isolate the
NadM clone from the tulatron method; the PCR may have very low amounts of wild type product
that is not visible due to the limitations of ethidium bromide staining in figure 2, lane 18.
6. Deliverables completed
KKF5: igLC1 IgLC2 Schuh4: KKF10: iglD1 igLD2 Schuh4; and KKF13: VgrG1 VgrG2 Schuh4
mutants are completed Schuh4 strains to date.
7. Quality of performance
Good
8. Percentage completed
94%
9. Work plan for upcoming month
a. Will continue with the screening of the NadM mutant which will require cycling of various clones
to facilitate the effective insertion of the NadM intron into the SchuS4 chromosome.
b. Will continue with second strategy for generating NadM Schu S4 mutant via the pJC84 mating
vector from Dr. Celli lab at the Rocky mountain labs. Once pJC84 + NadM T20 is confirmed will
begin transformation experiment with SchuS4. This strategy is moving the mutant NadM gene
from F novicida to SCHU S4.
c. Will continue with the FTT0748 Schu S4 mutant. Will check for cryotransformants and will
screen cryotransformants by PCR using FTT0748 gene specific oligos, and in addition, using
oligos specific to the intron II region of this mutant.
Milestone 52
Milestone description: Create RecA mutants in F. tularensis subsp. tularensis(Schu S4)
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 Creation of FTT1579 and FTT0523 gene mutants in Schu S4. FTT1579 functions as a Type III
restriction enzyme, and FTT0523 is the hypothetical protein that is similar to Q89Z57 Type I
restriction enzyme EcoAI specificity protein. Both of FTT1579 and FTT0523 genes limit the entrance
of plasmid DNA into the Schu S4 strain. The goal is to break down the restriction barriers (FTT1579
and FTT0523) of Schu S4. The method allows us to retarget these two restriction enzymes and
inactivate certain gene(s) to facilitate introduction of foreign plasmid DNA into Schu S4 strain.
3.1.1 In last monthly report, it was reported that the new construct (pKEK1140 carrying 350bp
PCR for 849/850 or 1254/1255 insertion site) was identified with digestion using restriction
enzyme BglII. The digestion pattern indicated the existence of the insertion in the plasmid. Both of
the new constructs pKEK1140/350bp PCR (849/850) #1 and pKEK1140/350bp PCR (1254/1255)
#4 were sent for sequencing with the primer “groElp Down BglII XhoI” to further confirm the
Page 41 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
insertion of 350bp PCR in the parent plasmid pKEK1140. The sequencing data confirmed that
both new constructs were in the target tulatron vectors. The tulatron vector pKEK1140/350bp
PCR (849/850) #1 was designated as pKEK1226, and pKEK1140/350bp PCR (1254/1255) #4 as
pKEK1227. Data recorded on UTSA TVDC notebook #6, page80-81 for sequencing.
3.1.2 To test for correct Targetron activity, and because access to the BL-3 laboratory was limited
due to high occupancy, we initially transformed pKEK1226 into wild type F. novicida strain U112
for insertion mutagenesis of FTN1487 in U112. We will subsequently transform into Schuh4. Wild
type U112 was recovered on TSA++ agar medium from the frozen stock. 0.5ml overnight cultured
U112 (in TSB++ liquid medium) was added into 4.5ml TSB++ liquid medium and incubated at
37C for 3-4 hours with shaking. Then 4-hour cultured U112 cells were washed with 0.5M
Sucrose at 6000rpm for 5 minutes for 3 times. The final pellet was resuspended in 200ul 0.5M
Sucrose. 3ul of pKEK1226 was added to 200ul washed U112, and the cells/DNA mixture was
incubated at room temperature for 10 minutes. The transformation was performed by
electroporation. Then the electroporated cells were cultured in 1ml TSB++ liquid medium at 30°C
for 1 hour with shaking and plated onto TSA++ agar medium with 60ug/ml Kanamycin and
incubated at 30°C for 3-5 days.
3.1.3 The colony PCR was performed for the potential transformants from TSA++/Kanamycin
selection plate. The primers for colony PCR were “FTN1487 For” and “FTN1487 Rev” which were
FTN1487 gene primers flanking the insertion site. GoTaq DNA polymerase was purchased from
Promega. The figure of the colony PCR is shown below.
Figure1: The gel picture of the colony PCR.
Figure1 legend, results and data location: Lane7 and 20 were wild type U112 which had the PCR products at the
size of about 1.0kb. Lane2-6, 8-12, 15-19 and 21-25 were from colonies 1-20. Each colony produced the same size
band as wt U112 and shows no evidence of the expected 2.0kb band from the mutant. The mutant strain with the
intron insertion in FTN1487 of U112 was supposed to generate the PCR product of about 2.0kb. This figure doesn’t
show the insertion in FTN1487 gene in any colony screened. Data recorded on UTSA TVDC notebook #6, page82
for Figure1.
3.1.4 40 more colonies were screened using the same colony PCR as above, and the same
results were obtained. None of the colonies provided us with the positive result.
4. Significant decisions made or pending
None
Page 42 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
5.
Problems or concerns and strategies to address
UTSA will troubleshoot the lack of FTN1487 gene insertions into U112
6. Deliverables completed
pKEK1226 (pKEK1140 carrying 350bp PCR for 849/850 insertion site in FTN1487 or FTT1579 gene)
pKEK1227 (pKEK1140 carrying 350bp PCR for 1254/1255 insertion site in FTN1487 or FTT1579
gene)
7. Quality of performance
Good
8. Percentage completed.
About 61% of scientific work completed.
9. Work plan for upcoming month
i. Screen more colonies from the transformation plates using the colony PCR applied on Step3.1.3.
ii. Screen the colonies #1-20 mentioned on Step3.1.3 using the colony PCR with the insertion specific
primer and FTN1487 gene specific primer.
iii Separate wild type U112 with FTN1487 mutant U112 to obtain the pure mutant strain.
Milestone 53A
Milestone description Phenotyping and vaccine efficacy demonstration of recA, other subsp.
tularensis mutants.
53.1: phenotyping and immunologic characterization of Ft subsp. tularensis recA and recAiglC
strains, as well as strains generated in milestone #54.
53.2: phenotyping and immunologic characterization of Ft subsp. tularensis recA plus best
attenuating mutation(s) strains (generated in milestone #52), as well as strains generated in
milestone #54.
Institution: UTSA
1. Date started: 04/01/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
UTSA measured the intramacrophage growth of KKT11 (a Schu S4 recA mutant), KKT5 (a Schu
S4 iglC mutant) and KKT23 (a Schu S4 recAiglC mutant) (Note book # 9, page 32-4). Murine
macrophage cell line (J774) was seeded in a 96-well plate (2x105/well) overnight and then
infected with 10 MOI of various Schu S4 mutants.. Numbers of viable bacteria in macrophages
were measured at 3 hr and 24 hr post-infection. As shown in figure 1, KKT11 (recA) and the wild
type Schu S4 replicated rapidly inside macrophages within a day. However, minimal growth of
KKT5 (iglC) and KKT23 (recAiglC) was observed during the same incubation time, indicating a
high degree of attenuation. These results are in agreement with prior (April, 2009) reported LD 50
data showing that all mice succumbed to 75 CFU of KKT11 ( recA) intranasal (i.n.) challenge,
while all mice survived the KKF23 (recAiglC) challenge (up to 3X106 CFU).
Page 43 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Log1 0 C FU / w el
l
7
6
3h
24h
5
4
3
2
1
Sc hu S4
rec A
iglC
rec AiglC
Fig. 1. Intramacrophage growth of Schu S4 recA, iglC and recAiglC mutants. Murine
macrophage cell line (J774) were infected with mutants or their parental strain (Schu S4) using
an inoculum of 10 MOI. Numbers of viable bacteria in macrophages were measured at 3 hr and
24 hrs post-infection.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
10% of scientific work completed on milestone 53A.
9. Work plan for upcoming month
a. Analyze the antibody profiles of mice immunized with the F. tularensis recAiglC mutant (KKT23)
at day 28 after vaccination.
b. Evaluate the protective efficacy of i.n. KKF23 vaccination against pulmonary Schu S4 challenge.
Challenge occurs four weeks after i.n. vaccinations.
Page 44 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Milestone 53B
Milestone description: Examining the protective efficacy of LVS and two attenuated SCHU S4
mutant strains via oral vs. intradermal inoculations in the rat model;
50.1: replication of LVS, Schuh4, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 in rat macrophages .
50.2: protective efficacy of LVS, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 against Schuh4 intratracheal challenge (oral vs. intradermal
vaccinations in rats)
50.3: antigen specific cellular and humoral responses of rats following vaccination with LVS,
iglC Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
50.4: bacterial dissemination and lung pathology of rats following vaccination with LVS, iglC
Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
Institution: UTSA
1. Date started: 12/01/2008
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
53B-a: UTSA is determining intestinal and respiratory antibody profiles following LVS vaccination
of Fisher 344 rats. (Notebook # 10, pages 43, 50, 54) Groups of F344 rats (6 rats per group) were
vaccinated either orally or intradermally with 107 CFU of LVS in PBS or mock vaccinated orally
with PBS alone and rested for three weeks. Fresh fecal pellets (0.2g per rat) were collected and
placed in 1ml of PBS containing protease inhibitor. Fecal pellets were broken down and
subsequently centrifuged at 10,000 RPM for 7 minutes. Supernatants were collected for analysis
of LVS-specific IgA and IgM antibodies by ELISA. As shown in Fig. 1, neither vaccination route
induced significant antigen-specific antibodies compared to mock-vaccinated animals.
Rats were then sacrificed and bronchiolar lavage fluid was collected (4ml total per rat) for
analysis of LVS-specific antibodies by ELISA. As shown in Fig. 2, LVS vaccination by either route
induced antigen-specific total antibody, IgG2a, IgG2b, IgA and IgM. Neither vaccination route
induced any IgG1 antibody similar to serum antibody profile (April 2009 report.) These findings
show that both oral and intradermal LVS vaccination induce antigen-specific antibody production
within the respiratory compartment, but do not induce detectable antigen-specific antibodies
within the intestinal tract.
Page 45 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
Fig. 2. Intestinal antibody profile following LVS vaccination. Groups of F344 rats
were vaccinated with 107 CFU of LVS either orally or intradermally and rested for
21 days. Fecal samples were collected and analyzed for LVS-specific antibodies.
Fig. 3. Respiratory antibody profile following LVS vaccination. Groups of F344
rats were vaccinated either orally or intradermally and rested for 21 days.
Bronchilar lavage fluid was collected and analyzed for LVS specific antibodies
53B-b: Survival and weight loss of naïve Fisher 344 rats following intratracheal challenge
with F. novicida U112. Groups of F344 rats (4 rats per group) were challenged intratracheally
with either 102 or 105 CFU of U112 in PBS. Rats were monitored daily for morbidity and
mortality. As shown in Fig. 4a, all rats survived challenge with either dose for the duration of
the observation period (30 days). As shown in Fig 4b, rats which received 10 2 CFU U112
exhibited no weight loss and furthermore showed no outward signs of illness. Rats which
received 105 CFU of U112, however, had an initial drop of weight at 2 days after challenge
Page 46 of 47
Tularemia Vaccine Development Contract: Monthly Technical Report
Period: 5/01/2009 to 5/31/2009
Due Date: 6/15/2009
Prepared by: C. Rick Lyons, Terry Wu, Barbara Griffith, Karl Klose, Bernard Arulanandam, Stephen Johnston, Mitch
Magee, Kathryn Sykes, Bob Sherwood, Michelle Valderas, Dana Pohlman, Julie Wilder, Julie Hutt, and Trevor Brasel
and appeared ill as indicated by discoloration of coat and decreased activity level. This
weight loss remained at approximately 10% until one week after challenge, at which time the
rats regained both their weight and normal physical appearance by two weeks post
challenge. This data indicates that F344 rats are highly resistant to F. novicida U112
challenge (LD50 > 105 CFU) compared to mice (LD50 < 10 CFU).
Fig. 4. Survival and weight loss following F. novicida U112 challenge. Groups of
F344 rats were challenged intratrachealy with either 102 or 105 CFU of F.
novicida. Rats were monitored daily for survival and weight loss.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
21%
9. Work plan for upcoming month
53B. Survival of LVS vaccinated F344 rats following F. tularensis SCHU S4 challenge
Page 47 of 47