Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Contract No. HHSN266200500040-C
ADB Contract No. N01-AI-50040
Section I: Purpose and Scope of Effort
The Tularemia Vaccine Development Contract will lead to vaccine candidates, two
animal models and cellular assays vital for testing vaccine efficacy.
Sections II and III: Progress and Planning Presented by
Milestone
Active milestones: 2, 4, 5, 6, 7, 8, 9, 10, 11(UNM/LBERI), 12/13(UNM/LBERI), 14, 17,
18, 19, 21(UNM/LBERI), 29(UNM/LBERI), 35(ASU/UNM), 49, 50, 52, 53, 55, 56, 57
Completed milestones: 1, 3, 16, 25, 26, 27, 28, 32, 33, 34 (UNM/ASU), 39, 40, 43
(UTSA), 48, 51
Inactive milestones: 15, 20, 22, 23, 24, 30, 36, 37, 38, 54, 58, 59
Milestones terminated after initiation: 41, 42, 44, 46, (MSCR will be written)
Milestones terminated before initiated: 43 (Cerus), 45, 47 (MSCR will not be written)
Milestone 2
Milestone description: Vaccinations performed on relevant personnel
Institution: UNM/LBERI
1. Date started: 11/01/2005
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. UNM EOH has performed 29 annual health screenings since 8/26/08 for the LVS
vaccinees originally vaccinated through December 2007.
b. Three UNM and possibly 6 LBERI scientists will request vaccinations in 2009.
c. USAMRIID canceled the 1/27/09 vaccination date.
4. Significant decisions made or pending
a. Dr. Lyons received UNM IRB approval to allow blood draws on the vaccinated
LBERI and UNM scientists after their LVS vaccinations. The LVS vaccinated
LBERI and UNM scientists and staff have been offered the opportunity to
volunteer to donate bloods for the development of immunoassays, approximately
2 months after receiving the LVS vaccination.
b. USAMRIID resumed offering the LVS vaccine as of October 7, 2008 but will not
offer vaccinations to UNM and LBERI until FDA approval is given.
c. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI will offer the LVS
vaccinations to 9 more scientists to total up to 46. The CRDA with USAMRIID is
valid for 2 years, ending June 2009.
5. Problems or concerns and strategies to address
a. Nine scientists could be vaccinated in 2009 if USAMRIID receives FDA approval
for the new Tularemia vaccination protocol.
Page 1 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
b. USAMRIID may restart LVS vaccinations in March 2009 pending FDA approval
6. Deliverables completed
A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS
vaccination since 9/11/07.
7. Quality of performance
Excellent
8. Percentage completed
73% of the scientific work is complete
9. Work plan for the next month
a. Continue annual health screenings required by USAMRIID and being performed
at UNM for the LBERI and UNM LVS vaccinees.
b. UNM will be obtaining blood donations from LVS vaccinees for immunoassay
development and reimbursing participants $40/ donation.
c. UNM will work with 3 UNM and 6 LBERI scientists for the pre-vaccination health
screenings required for vaccinations once USAMRIID has FDA approval to offer
the LVS vaccinations again.
Milestone 4
Milestone description: Confirmation of aerosol in vivo in NHP
Institution: LBERI
1. Date started: 11/1/06
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions:
a. Histopathology analysis was completed for Pilot 2 and Pilot 3. The full pathology
reports and raw data are provided electronically along with the 2/15/09 Monthly
Technical Report as pdf files. Pilot 2 has appendices A, B, and C for raw data.
Pilot 3 has appendices A and B for raw data. Below are excerpts from the full
pathology reports.
b. Pilot 2:
For pilot 2, the clinical pathology data are consistent with a response to chronic
bacterial infections. Reductions in serum phosphorus and albumin are mild, and
are interpreted to be a consequence of the decreased food intake observed
clinically. The increased WBC count with increased neutrophils is consistent with
a response to bacterial infection, while the decreased lymphocyte count is
consistent with a stress response associated with chronic inflammatory disease.
Decreased hematocrit with normal red blood cell (RBC) size and hemoglobin
concentration is consistent with reduced RBC production in response to chronic
inflammatory disease (“anemia of chronic disease”). Not surprisingly, the animal
that survived the longest (A05262) had the greatest reduction in hematocrit. The
gross lesions are those which are expected after aerosol exposure to F.
tularensis; namely, bronchopneumonia with tracheobronchial lymphadenitis, and
variable gross evidence of bacteremic dissemination to other organs . The
histologic lesions of pyogranulomatous to necrotizing bronchopneumonia with
pleuritis and tracheobronchial lymphadenitis are also expected after aerosol
exposure to F. tularensis. The lack of tularemia-related lesions in the nasal
cavities of these two animals suggests that agent was primarily deposited in and
disseminated from the lower respiratory tract. The pleural fibrosis with adhesions
and alveolar septal fibrosis with type II pneumocyte hyperplasia observed in
A05262 are consistent with a disease course of longer duration in this animal,
compared to A05254. The presence of pyogranulomatous splenitis in A05254 is
Page 2 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
consistent with dissemination of F. tularensis to the spleen. The lack of splenic
lesions in A05262 suggests that if there was dissemination to the spleen, it was
to a lesser extent than for A05254. Neither animal demonstrates histologic
evidence of dissemination of F. tularensis to the liver. The lesions of atrophy and
vacuolization in A05242 are attributed to the metabolic sequela of anorexia
associated with F. tularensis exposure. The minimal foci of neutrophilic and
histiocytic hepatitis in A05254 are often found in control animals, and are
interpreted to be background lesions. The presence of pyogranulomatous
mesenteric lymphadenitis in A05262 may indicate that this animal swallowed
aerosolized F. tularensis, with subsequent gastrointestinal uptake and
dissemination to the mesenteric lymph nodes. Alternatively, F. tularensis may
have gained access to the mesenteric lymph nodes after bacteremic
dissemination from the lower respiratory tract. Without other peripheral lymph
nodes to evaluate, it is not possible to distinguish between these two possibilities.
The impact of gastrointestinal and nasal nematodes and associated inflammatory
lesions on the tularemia disease course cannot be definitively determined.
Preexisting inflammatory lesions have been shown to influence the disease
course for other bacterial infections, in some cases increasing host susceptibility
and in other cases decreasing host susceptibility. Other lesions are considered to
be background lesions of no significance to study.
c.
For Pilot 3 the histologic lesions of pyogranulomatous to necrotizing
bronchopneumonia are smaller and more uniform in size than those observed in
pilots 1 and 2, but more widespread in distribution. This is presumed to reflect the
higher doses of F. tularensis deposited in the lungs, and subsequent earlier
death of these two animals. The splenic lesions in both animals are consistent
with bacteremic dissemination to the spleen. The nasal cavity lesions in A04645
are compatible with a mucosal response to F. tularensis. The reason for nasal
cavity lesions in this animal, but not A04643, is uncertain. Death is presumed to
be due to the systemic sequela of pulmonary F. tularensis.
d. Pathology reports were prepared.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
98% of the scientific work is complete
9. Work plan for next month
a. Continue working on the Milestone Completion Report
Milestone 5
Milestone description: Small species tested for sensitivity to LVS & generation of
immunity against a pulmonary challenge of SCHU S4
Institution: UNM
Page 3 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
1. Date started: 12/12/2005
2. Date completed: pending
3. Work performed and progress including data and preliminary
conclusions
a. Experiment Ftc71.1 (Notebook 130 pages 18-21)
i. The purpose of this experiment was to determine the effect of LVS
vaccination dose on the resistance of vaccinated rats to i.t. SCHU S4
challenge
ii. Fischer 344 rats (n = 6) were either left unvaccinated as a negative
control or vaccinated s.c. with 103, 105, or 107 LVS
iii. 47 days after LVS vaccination, the vaccinated rats and control rats
were challenged i.t. with 3.3 x 103 SCHU.
iv. As expected, all unvaccinated rats died within 6 days of infection
(Fig. 1). Only 1 of 6 rats vaccinated with 103 LVS died and no rat
vaccinated with 105 or 107 LVS died. Since rats vaccinated with 103
LVS seemed to lose a bit more weight than those vaccinated with
105 or 107 LVS, this dose may be close to the minimum number
required for protection, i.e. vaccination with a LVS dose lower than
103 may not be protective
103 LVS
10
0
0
-10
-10
Gain
Loss
% Starting Wt
Unvaccinated
10
-20

-20
0
2
4
6
8
0
105 LVS
10
15
107 LVS
10
10
0
0
-10
-10
Gain
Loss
% Starting Wt
5
Days post i.t. SCHU Challenge
Days post i.t. SCHU Challenge
-20
-20
0
5
10
Days post i.t. SCHU Challenge
15
0
5
10
15
Days post i.t. SCHU Challenge
Figure 1. Titration of LVS vaccination dose. Fischer 344 rats (n = 6) were
vaccinated s.c. with the indicated dose of LVS. 42 days after vaccination, the
rats were challenged i.t. with 3300 SCHU S4
Page 4 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
a. Mouse model completed
b. Guinea pig model completed
c. Rat model completed
7. Quality of performance
NA
8. Percentage completed
93%
9. Work plan for upcoming month
a. Repeat LVS vaccination dose titration with a dose of 101, 103 and 105 LVS
b. Complete the histopathological analyses of tissues from mice, rats, and NHPs
infected with SCHU S4
c. Complete milestone completion reports for the mouse, rat, and guinea pigs
Milestone 6
Milestone description: Final small species selection determined
Institution: UNM (UNM/ASU/Cerus/LBERI/UTSA determine by consensus)
1. Date started: 1/1/2009
2. Date completed: 1/23/2009
3. Work performed and progress including data and preliminary conclusions
LBERI and UNM met as a group on selection of animal models
4. Significant decisions made or pending
Chose rat as the small animal model, as it is more similar to known data on humans than
other tested small animal models.
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Excellent
8. Percentage completed
100 %
9. Work plan for upcoming month
Write MSCR for MS6
Milestone 7
Milestone description: SCHU S4 ED50 in primates determined from selection of
challenge dosing
Institution: LBERI
1. Date started: 2/25/08
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions:
Page 5 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
4. Significant decisions made or pending
No work was performed during this reporting period.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good.
8. Percentage completed
90% of the scientific work is complete.
9. Work plan for next month
a.Respiratory rates and temperatures previously reported will be modified as per the
format provided by Kristin Debord.
b.Histopathology will continue to be analyzed.
Milestone 8
Milestone description: LVS vaccination protection of aerosol Schu4 validated in
primates
Institution: LBERI
1. Date started: 8/15/2008
2. Date completed: In progress.
3. Work performed and progress including data and preliminary conclusions
a. Vaccinated 6 NHPs with LVS on 1/8/09 (3 by scarification and 3 by
subcutaneous route). These 6 NHP were vaccinated by two routes to compare
the immune response elicted by each route and in the future, the relative ability
of the two vaccination routes to protect against a SCHU S4 challenge.
i. A lyophilized vial of DVC Lot 16 LVS was resuspended in PBS such
that 6 x107 organisms would be contained in a 50 μl (scarification) or 100
μl (subcutaneous) inoculum
ii. For scarification, an area of the upper back was shaved, a 50 μl drop
of inoculum was placed on the area and a bifurcated needle was used to
puncture the skin underneath the inoculum. 10 – 15 punctures were
given and blood was observed at the inoculum site indicating
scarification had been successful.
iii. For the subcutaneous inoculation, the inoculum was diluted 2-fold in
PBS and 100 μl on inoculum was injected with a needle underneath the
back skin of a separate cohort of NHPs
iv. The subcutaneous delivered dose was 3.1 x 104 CFU even though
the target dose was 6 x 107 CFU; this dose was determined by plating
the inoculum on BCGA
v. Difference in target vs. observed dose is in part due to the difference
in titer generally observed by our team as opposed to what was told to
UNM by DVC when the Lot 16 LVS lyophilized vials were sent to UNM
in 12/2005. (DVC originally said each vial contained 1.3 – 1.4 x 109
organisms; UNM personnel determined the amount to be 5 x 107/vial)
vi. LBERI delivered 3.1 x 104 organisms in 60 μl suggesting that LBERI’s
vials from DVC had a stock concentration of 7.3 x 105/vial; this is 2 logs
lower than UNM finds and 3.5 logs lower than DVC reports
Page 6 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
vii. In 10/08, LBERI calculated that we delivered 2.6 x 105 organisms in
60 μl suggesting that the vial used contained 1.2 x 107 organisms; all 5
animals mounted an IgG anti-LVS titer that suggested they were
vaccinated and elicited a humoral immune response.
viii. IgG anti-LVS titers in the 6 NHPs vaccinated on 1/8/09 also suggest
they were vaccinated (assay run on 2/3 – 4/09 and will be reported on in
full in next month’s technical call and report)
ix. LBERI is unsure as to what to do to about this variability as LBERI is
following the protocol published in the USAAMDA IND 157 protocol when
LBERI resuspends the lyophilized vial directly in PBS in order to deliver 6
x 107/dose assuming that the concentration on the vial is accurate
x. Data to date suggest that inoculation of NHPs with 3.1 x 104 – 1.5 x
107 LVS induce a humoral and cellular immune response that cannot be
distinguished based on LVS dose nor route of inoculation (s.c. vs. i.d. vs.
scarification); direct comparisons that can be made will be presented in
next month’s technical call and report when all the data from the latest
NHP vaccinees has been fully analyzed
b. Screened 7 newly arrived non-LVS vaccinated NHPs and chose 3 to serve as
controls for the upcoming SCHU S4 challenge (see Figures 1and 2)
i. NHPs chosen were A03152, A06626 and A05895
ii. These NHPs were chosen due to their relatively low responses to a high
dose of heat-killed and formalin fixed LVS (LVS hk Hi and LVS ff HI,
each used at 1 x 105/ml) in the IFNγ ELISPOT assay (Figure 1) and in
the proliferation assay (Figure 2)
iii. A07046 was not chosen despite its low responsiveness to LVS antigens
due to its relatively high titer of IgG anti-LVS (Figure 3)
Page 7 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
IFN Spots (Mean +/- S.D.)
500
400
300
*
Media
LVS hk Hi
LVS ff Hi
SCHUS4 hk Hi
SCHUS4 ff Hi
*
* * A. Experiment TUL 61;
1/5/09
*
*
200
100
*
*
0
IFN Spots (Mean +/- S.D.)
A03152
500
Media
LVS hk Hi
400
LVS ff Hi
SCHUS4 hk Hi
300
200
A04840
A05895
B. Experiment TUL 63;
1/19/09
*
SCHUS4 ff Hi
*
*
* *
*
*
100
0
A06626
A06688
A07046
A07058
Figure 1: Seven non-LVS vaccinated NHPs (named on the X-axis of Panels A and B) were
tested for their responsiveness to LVS and SCHU S4 antigens. All cells were plated at 1.33 x
106/ml and 200,000/well. Both heat-killed (hk) and formalin-fixed (ff) antigens were used at a
dose of 1 x 105/ml (Hi). * indicates significantly different (p <.05) than Media stimulation of
PBMCs from the same NHP as determined by one-way ANOVA.
Page 8 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Relative Light Units (Mean +/- S.D.)
500000
Relative Light Units (Mean +/- S.D.)
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
500000
400000
A. Experiment TUL 61;
1/5/09
Media
LVS hk Hi
LVS ff Hi
SCHUS4 hk Hi
300000
SCHUS4 ff Hi
200000
100000
*
* * * *
0
A03152
A04840
A05895
B. Experiment *
400000 TUL 63; 1/19/09
300000
Media
LVS hk Hi
LVS ff Hi
SCHUS4 hk Hi
SCHUS4 ff Hi
*
200000
*
100000
*
*
*
0
A06626
A06688
A07046
A07058
Figure 2. Seven non-LVS vaccinated NHPs (named on the X-axis of Panels A and B) were
tested for their responsiveness to LVS and SCHU S4 antigens. All cells were plated at 1 x
106/ml and 200,000/well. Both heat-killed (hk) and formalin-fixed (ff) antigens were used at a
dose of 1 x 105/ml (Hi). * indicates significantly different (p <.05) than Media stimulation of
PBMCs from the same NHP as determined by one-way ANOVA.
Page 9 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
IgG anti-LVS
OD405
0.500
A03152
0.400
A04840
0.300
A05895
A06626
0.200
A06688
0.100
A07046
0.000
100
A07058
1000
10000
100000
1000000
Dilution Factor
Figure 3: IgG anti-LVS response detected in plasma from seven non-LVS vaccinated NHPs.
Serial 5-fold dilutions were made in assay buffer (5% non-fat milk) and plated in duplicate
(100 μl/well) on ELISA plates coated with LVS hk (2.5 x 106/ml). Bound antibody was
detected after overnight incubation and several washes with goat anti-monkey-HRP and
ABTS substrate. All plasma was diluted 4-fold before use in this assay due to the nature of
the PBMC preparation protocol which calls for a dilution of whole blood 1:3 before spinning
on Lymphoprep. Plasma is collected after this step.
Data Interpretation: The screening of seven non-LVS vaccinated NHPs
revealed that most of them had low responses to LVS antigens in the
IFNγ ELISPOT and proliferation assays. However, some had either
relatively high responses to LVS or SCHU S4 ff (formalin-fixed) Hi (1 x
105/ml), such as A06688, or high background responses (A04840) in the
IFNγ ELISPOT assay. We therefore chose not to use these two NHPs in
this experiment until they can be re-tested. A07046 will be excluded
from use as a naïve control in the upcoming experiment due to its readily
detectable IgG anti-LVS reactivity in the absence of LVS vaccination
(titer determined to be >500,000 when considered to be the reciprocal of
the highest dilution producing an OD405 higher than background (0.067 in
this assay run). Other titers ranged from 800 (A07058) to 20,000
(A05895, A03152, A06688 and A06626). It is clear when comparing the
performance of A05895 and the other three plasma samples that were
determined to have a titer of 20,000, that titer, as we are currently
describing it, is not an accurate description of IgG anti-LVS levels.
Therefore, we plan to make a positive control plasma by combining
plasma samples from several LVS-vaccinated monkeys. This positive
control sera will be tested for its ability to serve as a reference standard
curve in future assays. If it performs well in the assay (high OD 405 at low
dilution, several intermediate dilutions plot to the linear portion of the
curve, and measures near 0.1 or below at high dilutions) it will be
aliquoted, frozen, assigned an arbitrary designation of 1 x 106 U/ml and
an aliquot will be used as a standard curve each time the assay is run.
Page 10 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay
statview\PBMC assay 02022009.svd; TVDC (6) bound notebook (9616),
pp. 4 – 12, 26 - 33.
c.
3 NHPs previously vaccinated with LVS in 10/06 (2 by intradermal route, A00908
and A00937, and 1 by subcutaneous route, A00659) were tested for residual
responsiveness to LVS and SCHU S4 antigens before their challenge exposure
to SCHU S4 by aerosol (see Figure 4) scheduled in February 2009.
Media
LVS hk Hi
LVS ff Hi
IFN Spots (Mean +/- S.D.)
500
400
SCHUS4 hk Hi
*
300
*
200
100
*
SCHUS4 ff Hi
*
*
*
* *
NT
0
A00659
A00908
A00937
Figure 4: PBMCs from three NHPs previously vaccinated with LVS in October 2006, were
tested for their responsiveness to LVS and SCHU S4 hk (heat-killed) and ff (formalin-fixed) Hi
(1 x 105/ml) antigens in the IFNγ ELISPOT assay. Too few PBMCs were purified from
A00937 in order to test the SCHU S4 antigens. All cells were plated at 1.33 x 10 6/ml and
200,000/well. * indicates significantly different (p <.05) than Media stimulation of PBMCs
from the same NHP as determined by one-way ANOVA.
Data Interpretation: PBMCs from both A00659 and A00937 contained
significantly more cells that were capable of IFNγ secretion upon
stimulation with hk and ff LVS. However, PBMCs from A00908 did not
respond to hk LVS suggesting that its immunity to LVS had waned (peak
responsiveness to hk LVS was 97 on day 532 post-LVS vaccination but
was never tested prior to day 203). No increase in response was
detected to hk SCHU S4 antigen in either NHP tested. These data show
the baseline response of these NHPs before SCHU S4 aerosol
challenge. This baseline response was important to establish so that we
can compare the effect of the SCHU S4 challenge on the immune
response and know for certain that is was due to the aerosol challenge
and not any residual responiveness remaining from the LVS vaccination.
Should the NHPs survive until day 21 post-SCHU S4 challenge (3/6/09),
their PBMCs will be re-tested in this assay to determine whether the
SCHU S4 aerosol elicited an elevated immune response to either LVS or
SCHU S4 antigens. No baseline response to SCHU S4 antigens was
assessed in A00937 due to insufficient PBMCs purified.
Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay
statview\PBMC assay 02022009.svd; TVDC (6) bound notebook (9616),
TUL 65, 38 – 41.
Page 11 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
d. One NHP, A00868, was vaccinated with LVS via the subcutaneous route on
10/29/06
i. This animal developed behavioral problems that precluded his transfer to
the ABSL3 for exposure to SCHU S4
ii. As an alternative, A00868 was exposed to LVS (100,000 CFU) by
bronchoscopy on 1/8/09
iii. On both 1/5/09 (pre-LVS boost, day 768 post-LVS vaccination) and
1/20/09 (day 12 post-LVS boost, day 783 post-LVS vaccination), PBMCs
were purified from A00868 and tested for their responsiveness to LVS
and SCHU S4 antigens in the IFNγ ELISPOT (Figure 5)
IFN Spots (Mean +/- S.D.)
500
Post-LVS
Bronch
Pre-LVS Bronch
400
Media
LVS hk Hi
LVS ff Hi
SCHUS4 hk Hi
SCHUS4 ff Hi
*
*
300
*
*
200
*
100
0
Day 768
Day 783
Day Post-LVS Vaccination
Figure 5: PBMCs from A00868 were purified and tested in the IFNγ ELISPOT assay on the
days post-LVS vaccination indicated on the X-axis. Day 768 represents the PBMCs prepared
3 days prior to a bronchoscopy with LVS. Day 783 represents the day of necropsy, 12 days
post-LVS bronchoscopy. All cells were plated at 1.33 x 106/ml and 200,000 cells/well. All
antigens were used at 1 x 105/ml.
Data Interpretation: A00868 had only a small boost in responsiveness to hk LVS
antigen post-LVS bronchoscopy. The magnitude of the boost may be masked by
the relatively high background response in unstimulated (media) cells. The RBC
content of the PBMCs was high on both day 768 and day 783 even after an RBC
lysis step and a slow spin (800 rpm, 20 minutes with no brake) to remove
platelets (4.4 and 18.2% respectively). A remark was made on the hard copy of
the ELISPOT plate results that the high background looked to be due to very
small pale spots in the wells, unlike real IFN which are larger and darker spots
but rather likely due to platelet or RBC contamination.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
a. We suspect that the protein content of the antigens is not equivalent in each of our
preparations (LVS hk and ff; SCHU S4 hk and ff)
i. This conclusion was reached after testing the antigens in a BCA (Bicinchoninic
acid) assay
Page 12 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
ii. We have learned that this assay may not accurately measure the protein
content of whole bacteria as it is designed to measure proteins in solution
iii. In the coming weeks, we will grow LVS and SCHU S4, make serial dilutions
and plate one aliquot for colony forming units and measure the protein content of
a replicate aliquot of lysed bacteria. In this way we will construct a standard
curve which relates CFU to protein content against which we can compare our
fixed and heat-killed antigen preparations after measuring their protein content.
iv. Therefore, until these measurements can be made, we cannot be sure that
using equivalent presumed antigen concentrations (i.e. 1 x 105/ml) deliver the
same amount of antigen/well. This makes comparisons between antigen
preparations difficult and likely inaccurate. For instance, we cannot assume that
LVS ff Hi stimulates better than LVS hk Hi in that we do not know that we are not
delivering much higher doses of the former antigen than the latter.
b. We are delivering highly variable amounts of LVS each time we inoculate straight
from a lyophilized LVS DVC Lot 16 vial
i. One solution would be to grow up the LVS each time and base the dose on an
OD600, however, this is not the method that USAMRIID uses in the human
vaccination protocol
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
25% of the scientific work is complete.
9. Work plan for upcoming month
a. On 2/2/09, prepare PBMCs from the 6 NHPs that were vaccinated with LVS on
1/8/09 to test their responsiveness to LVS and SCHU S4 antigens
b. On 2/2/09, collect plasma from the 6 newly vaccinated NHPs and test its
reactivity in the IgG anti-LVS ELISA
c. On 2/12 and 2/13/09, expose the following NHPs to 500 CFU SCHU S4 via
aerosol
Animal ID
A03152
A05895
A06626
28643
28671
A04994
28627
28587
A06587
A00937
A00908
A00659
Vaccine Group
CONTROL
08Jan Scarification
08Jan Subcutaneous
Oct 2006 Intradermal
Oct 2006 Subcutaneous
Page 13 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
d. Monitor the clinical symptoms (twice daily throughout the study), clinical
chemistry and hematology (Days 0 – 6) and bacteriology on select organs upon
necropsy of any NHPs that succumb to SCHU S4 aerosol,
Milestone 9
Milestone description: Aerosol SOP developed for GLP transition
Institution: LBERI
1. Date started: 8/13/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. Pre-qualification data were compiled and organized resulting in the following
defined acceptable SCHU S4 bioaerosol performance criteria:
Table 1. Exposure System Tests and Performance Criteria for the Francisella tularensis SCHU S4
Target Atmosphere
Test
Target Value
Acceptable Performance
Criteria
Acceptable
Values
Generator suspension
concentration
2.00 x 106 CFU/mL
(log10 = 6.30)
± 0.500 log10 between
estimated and actual
concentration
log10 =
5.80 to 6.80
Generator suspension
stability
n/a
± 0.800 log10 between preand post-test generator
concentration
As stated
Chamber concentration
143 CFU/L
68 to 327 CFU/L
Repeatability
 40% Relative Standard Deviation (RSD) on the chamber concentration
(log10 values) between the five daily runs per qualification day and between
all fifteen runs conducted for all three qualification days.
Collection efficiency of
impinger
 90% collection efficiency
Spray factor
log10 = -6.94
± 3 SD from the historical
mean per runa
Particle size
< 4 μm median diameter
T90
To be determined
T10
To be determined
log10 =
-8.09 to -5.79
These criteria were defined based on a target presented dose of 500 CFU in 3.5
liters inhaled and pre-qualification data including actual NHP exposures. They
also take into account variability expected during SCHU S4 bioaerosol
exposures.
The target spray factor value was obtained from 57 SCHU S4 bioaerosol runs
conducted previously (Figure 1).
Page 14 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Scatter Dot Plot of Francisella tularensis SCHU S4 (Working Stocks Passaged from Seed
Stock Lot 24AUG07) Bioaerosol Spray Factors using the Head-Only Exposure Chamber
log10 Spray Factor
-6.00
-6.50
-7.00
-7.50
-8.00
Individual Bioaerosol Runs
Number of values
57
Minimum
25% Percentile
Median
75% Percentile
Maximum
-7.92
-7.17
-6.86
-6.65
-6.24
5% Percentile
95% Percentile
-7.72
-6.42
Mean
Std. Deviation
Std. Error
-6.94
0.383
0.0507
Lower 95% CI of mean
Upper 95% CI of mean
D'Agostino & Pearson omnibus normality test
K2
P value
Passed normality test (alpha=0.05)?
P value summary
-7.04
-6.83
5.08
0.0791
Yes
ns
Figure 1. Cumulative SCHU S4 spray factor data from which a mean log10 value of -6.94 was
defined. These data encompass 57 previous bioaerosol runs conducted using SCHU S4 prepared
from fresh, 24h in-house prepared Chamberlain’s broth cultures inoculated with 400 L of suspension
normalized to an OD600 of 0.100 ± 0.01 and allowed to incubate at 37°C, 200 rpm, in the dark. These
data are located in the following folder: \\glp1\Study Data\QP 09-026.
Page 15 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
The target generator suspension concentration was calculated from the mean
spray factor and the target SCHU S4 aerosol concentration of 143 CFU/L (i.e.,
500 CFU presented in 3.5L inhaled) using the Equation 1:
Generator suspension (CFU/mL) = [(CFU/L)/spray factor]/1000
[EQ 1]
By definition, the spray factor (SF) is calculated using Equation 2:
SF = Aerosol concentration (CFU/L)/Generator suspension (CFU/L). [EQ 2]
Solving for the generator suspension in CFU/mL results in EQ 1.
The actual target concentration (2.00 x 106 CFU/mL) was increased slightly from
the calculated (9.05 x 105 CFU/mL) because of unforeseen variability and the
need to have a higher starting concentration to achieve the target presented
dose.
In order to achieve the target generator suspension concentration, a SCHU S4
growth curve was prepared (Figure 2) using actual concentration data from
previous bioaerosol runs.
Francisella tularensis SCHU S4 24-hour Growth Curve
CFU/mL (log10 scale)
9.8
9.6
9.4
y = 10(0.1193x + 9.188)
r 2 = 0.8095
9.2
9.0
0.000
1.000
2.000
3.000
4.000
OD600
July 2, 2008
July 9, 2008
July 24, 2008
July 25, 2008
November 10, 2008
November 10, 2008
November 10, 2008
September 23, 2008
September 24, 2008
October 17, 2008
November 18, 2008
January 14, 2009
January 14, 2009
January 14, 2009
Norm OD600
3.390
3.470
3.510
3.480
1.000
0.704
0.534
1.900
3.050
0.777
0.965
0.597
0.477
0.552
CFU/mL
4.00e+009
4.55e+009
3.20e+009
3.85e+009
2.17e+009
1.20e+009
1.63e+009
2.80e+009
4.00e+009
1.30e+009
2.64e+009
1.63e+009
2.47e+009
1.63e+009
Semilog line -- X is linear, Y is log
Best-fit values
Yintercept
Slope
Std. Error
Yintercept
Slope
95% Confidence Intervals
Yintercept
Slope
Goodness of Fit
Degrees of Freedom
R²
Absolute Sum of Squares
Sy.x
Number of points
Analyzed
9.188
0.1193
0.05133
0.01783
9.076 to 9.300
0.08050 to 0.1582
12
0.8095
3.110e+018
5.091e+008
14
Figure 2. SCHU S4 24h growth curve for generator suspension preparation.
Page 16 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Qualification runs were defined as 25 minutes based on previous NHP exposure
data (Figure 3): These data are located in the following folder: \\glp1\Study Data\QP
09-026.
Scatter Dot Plot of Francisella tularensis SCHU S4
(Working Stocks Passaged from Seed Stock Lot 24AUG07)
Cynomolgus Macaque Bioaerosol Exposure Times
using the Head-Only Exposure Chamber
Exposure Time (min)
30
25
20
15
10
5
0
Individual Bioaerosol Runs
Number of values
Sample Time
30
Minimum
Maximum
6.730
24.48
Mean
Std. Deviation
Std. Error
12.77
5.000
0.9128
Figure 3 A bioaerosol time of 25 min was chosen based on the maximum NHP
exposure period previously experienced. This assumes a “worst case scenario”
for future animal challenges. These data are located in the following folder:
\\glp1\Study Data\QP 09-026.
b. A draft SCHU S4 bioaerosol Qualification Plan was submitted for LBERI QA
review.
c. Two days of mock-qualification bioaerosols were performed in order to evaluate
the achievability of the criteria defined in the draft Qualification Plan.
a. 21JAN09
i. All criteria were within the passing criteria except for the aerosol
concentration for which the following values were calculated:
1. 36 CFU/L (Fail)
2. 75 CFU/L (Pass)
3. 111 CFU/L (Pass)
Page 17 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
4. 142 CFU/L (Pass)
5. 351 CFU/L (Fail)
Spray 1 was below the lower limit (i.e., had an animal been
present, the presented dose could have been low enough to result
in an undesired disease progression). Spray 5 was too high,
though a desirable respiratory disease would have likely occurred.
b. 28JAN09
i. All criteria were within the passing criteria except for the aerosol
concentration for which the following values were calculated:
1. 362 CFU/L (Fail)
2. 207 CFU/L (Pass)
3. 144 CFU/L (Pass)
4. 208 CFU/L (Pass)
5. 568 CFU/L (Fail)
Sprays 1 and 5 were higher than desired, though a desirable
respiratory disease would have likely occurred.
4. Significant decisions made or pending
The bioaerosol Qualification Plan will be revised to broaden the acceptable SCHU S4
aerosol concentration range. Additionally, terminology and acceptance criteria will be
reviewed and paralleled with currently accepted practices (e.g., bioassay validation
standards).
5. Problems or concerns and strategies to address
It has proven difficult to consistently achieve a small and tight aerosol concentration
range. We will strategize to remedy this. We are more concerned with the low dose end
than the high dose.
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
40% of the scientific work is complete.
9. Work plan for upcoming month
a. Conduct an additional day of mock-qualification runs with
b. Revise and complete qualification plan for the aerosol and send out for TVDC
review
c. Conduct an additional day of mock-qualification runs with the revised
Qualification Plan. Focus will be on achieving a more broadly defined SCHU S4
aerosol concentration.
Milestone 10
Milestone description: Efficacy testing of vaccine candidates (LBERI) and
Characterization of selected small animal model (UNM)
Institution: LBERI /UNM
1. Date started: 1/1/2009
2. Date completed: pending
3. Work performed and progress including data and preliminary conclusions
a. The IACUC (FY07-083) was amended to allow for testing of the USAAMDA vaccine
candidate by scarification; the amendment was approved on 1/30/09
Page 18 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
b. The experiment will compare vaccination with the DVC Lot 16 LVS and the
USAAMDA IND 157 vaccine (8 NHPs, 4 male, 4 female/group); 4 NHPs will serve as a
control
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
1%
9. Work plan for upcoming month
a. NHP will be ordered for the experiment
Milestone 11 Milestone description: In vivo GLP model efficacy SOPS developed in one small
species and primate and efficacy testing of vaccine candidates
Institution: UNM/LBERI
1. Date started: 1/16/2008
2. Date completed: pending
3. Work performed and progress including data and preliminary
conclusions
a) We are developing a qualifying plan for s.c. LVS vaccination and i.t. SCHU S4
challenge in the Fischer 344 rat model, following the draft qualifying plan for
aerosol generation provided by Trevor Brasel at LBERI.
b) We are training a technician to perform i.p. injection (for injection of ascites to
deplete CD4 and CD8 T) and perform FACS analysis to confirm T cell depletion
in vivo
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
27%
9. Work plan for upcoming month
Continue draft of qualifying plan
Page 19 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 11
Milestone description: In vivo GLP NHP model efficacy SOP and efficacy testing of
vaccine candidates
Institution: LBERI/UNM
1. Date started: 1/16/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. The IACUC and ES&H protocol for the Natural History Study was approved.
b. NHPs were ordered and dedicated to the study.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
6% of the scientific work is complete.
9. Work plan for upcoming month
a. We will begin screening the NHPs by testing IgG anti-LVS titers and the
response of PBMCs in the IFNγ ELISPOT and proliferation assays.
Milestone 12/13
Milestone description: Assays for detecting relevant immune responses in animals &
humans developed and Compare assays in animal models (sensitivity)
Institution: UNM/LBERI
1. Date started: 7/15/06 (MS12) and 12/06 (MS13)
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions
a. Experiment Ftc79.1 (Notebook 128, pages 18-22;
L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Ftc experiments\Ftc79 MV ELISA\Ftc79.1)
i. The purpose of this experiment was develop an ELISA to measure
the titer of anti-Ft antibodies in LVS vaccinated individuals
ii. Curves plotting serum dilution vs. absorbance were generated using
2-fold serial dilutions of sera from an unvaccinated person and a
LVS-vaccinated person ~10 months after vaccination (Fig. 2).
These curves clearly distinguish a vaccinated person from an
unvaccinated person.
iii. Julie Wilder suggested that serum from this vaccinated person or
sera from a pool of vaccinated people may be assigned an arbitrary
titer and used as a standard for all other serum samples.
Page 20 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
5
Naive
Vaccinated
Absorbance
4
3
2
1
0
-1
10 2
10 3
10 4
10 5
10 6
Serum Dilution
Figure 2. Anti-LVS antibody titer in vaccinated human serum. Serum
collected approximately 10 months after LVS vaccination was serially diluted
2-fold and tittered in a 96 well plate coated with heat killed LVS as antigen.
The starting serum dilution is 1:250.
b. Experiment Ftc79.2 (Notebook 128, pages 27-29;
L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Ftc experiments\Ftc79 MV ELISA\Ftc79.2)
i. The purpose of this experiment was to determine the optimal LVS
coating concentration for tittering anti-Ft antibodies in vaccinated
individuals by ELISA.
ii. Various dilutions of LVS-immune human serum were tested in wells
coated with the indicated concentrations of heat-killed LVS
iii. These results indicated that the optimal coating concentration for
heat-killed LVS is 1 x 106 cfu/ml (Fig. 3)
Serum Dilution
2000
4000
8000
16000
32000
64000
128000
256000
Absorbance
3
2
1
0
10 4
10 5
10 6
10 7
Conc. of Heat killed LVS (cfu/ml)
Figure 3. Optimizing LVS coating concentration for ELISA to measure antiLVS antibodies in human serum. A 96 well ELISA plate was coated with 2fold serially diluted heat-killed LVS, ranging from 2 x 107 to 9.8 x 103 cfu/ml
and tested against the indicated dilution of serum from a LVS vaccinated
subject.
4. Significant decisions made or pending
ELISA plates will be coated with 1x106 CFU/ml for human anti LVS antibody titers
Page 21 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
5. Problems or concerns and strategies to address
None
6. Deliverables completed
Mouse proliferation assay, IFN and IL-2 Elispot, anti-Ft antibody titration
Rat IFN Elispot, anti-Ft antibody titration
Guinea pig anti-Ft antibody titration 
7. Quality of performance
Good
8. Percentage completed
70%
9. Work plan for upcoming month
a. Titer immune human serum on plates coated with 106/ml HK LVS antigens
b. Establish standard curve correlating the total protein concentration to cfu of LVS
and SCHU S4 grown in Chamberlains broth. We will use the BCA protein assay
kit – reducing agent compatible from Pierce
c. Develop ELISpot assay for vaccinated individuals
d. Micro-agglutination titer for vaccinated individuals when Freyja provides protocol
Milestone 12/13
Milestone description: Assays for detecting relevant immune responses in animals &
humans developed and compared to those in other species.
Institution: LBERI/UNM
1. Date started: 2/23/2006
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
a. Continued to test the freeze/thaw protocols (Cerus and CTL) for PBMCs in order to
find a protocol that results in PBMCs whose response mimics the response of the original
fresh PBMCs in the proliferation and IFNγ ELISPOT assay.
b. We have been limited in testing the ability of the two freeze/thaw protocols due to the
fact that we have primarily been testing PBMCs from non-LVS vaccinated NHPs. This
has limited us in that the response of these PBMCs has not been particularly high.
c. We have recently begun thawing PBMCs from the NHPs that were vaccinated with
LVS in October 2008.
d. The results of the most recent thaws are presented in Figure 6A and B.
Page 22 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
*
*
300
*
Day 28, SCHUS4 ff Hi
Day 28, SCHUS4 hk Hi
Day 28, LVS ff Hi
Day 28, LVS hk Hi
Day 28, Media
*
Day 21, Cerus
Day 15, None
Day 15, CTL
*
Day 15, Cerus
*
*
*
100
0
*
*
Day 28, None
*
Day 21, SCHUS4 ff Hi
*
300
200
Day 21, SCHUS4 hk Hi
Day 21, LVS hk Hi
*
*
Day 28, CTL
400
B
Day 28, Cerus
500
Media
LVS hk Hi
LVS ff Hi
SCHUS4 hk Hi
SCHUS4 ff Hi
Day 21, None
600
*
*
Day 21, Media
Day 15, Media
700
**
Day 15, SCHUS4 ff Hi
*
* *
*
*
Day 15, SCHUS4 hk Hi
*
Day 15, LVS ff Hi
200
100
*
*
400
0
IFN Spots (Mean +/- S.D.)
A
Day 21, LVS ff Hi
500
Cerus
CTL
None
Day 21, CTL
600
Day 15, LVS hk Hi
IFN Spots (Mean +/- S.D.)
700
Figure 6. Response of PBMCs to LVS and SCHU S4 antigens as measured by IFNγ production
on various days post-LVS vaccination. The mean of two NHPs vaccinated with LVS by the
scarification route are shown. “None” represents the fresh cells that have not been frozen. Other
cells have been frozen using the Cerus or CTL protocols as indicated. The * indicates
significantly different (p < 0.05) than fresh cells responding to the same antigen by one-way
ANOVA. The same data is displayed in Panel A and Panel B.
Data Interpretation: The data in Figure 6 suggest that the two freeze/thaw protocols are fairly
equivalent in reproducing the pattern of responsiveness in fresh cells. Comparing from PBMCs
from day 28 post LVS-vaccination, the Cerus protocol produced responses that were closer in
magnitude to the fresh cells than did the CTL protocol. Therefore, we will move forward using
Page 23 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
only the Cerus protocol, which we had previously chosen as the superior protocol when
comparing PBMCs in the proliferation assay.
Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay
02062009.svd; TVDC (5) bound notebook (9247), pp. 32 -46, 54 – 62, 85 – 92; TVDC (6) bound
notebook (9616), pp. 1 – 3, 13 – 18.
4. Significant decisions made or pending
LBERI has chosen the Cerus protocol as the freeze/thaw protocol to use for the rest of
the contract.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
88% of the scientific work is complete.
9. Work plan for upcoming month
a. Determine the protein content of LVS and relate it to CFU/ml. This correlation
will aid us in determining the correlative CFU/ml of our LVS hk, ff and O-mutant
antigens when we test their protein content. This strategy is discussed in detail
in MS 8 above.
b. Prepare a positive and negative control plasma reference for use in future IgG
anti-LVS assays. This strategy is outlined above in the Data Interpretation
discussion under Figure 3.
Milestone 14
Milestone description: Assays in vaccinated humans validated (sensitivity)
Institution: UNM/LBERI
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
No new work done this period
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
NA
8. Percentage completed
5%
9. Work plan for upcoming month
None
Page 24 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 17
Milestone description: In vitro assay for analysis of cellular and humoral elements of
the immune response in vaccinated human and animal’s response to F. tularensis
established
Institution: UNM
1. Date started: 2/29/2008
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
a. Experiment Ptran12B (L:\Lyonslab\Tularemia\Tularemia Contract
Folder\Experiments and Results\Gopi's experiments\Ptran\Ptran-12B)
i. The purpose of this experiment is to determine the kinetics of
bacterial growth and dissemination in LVS-vaccinated and passively
immunized rats challenged i.t. with SCHU S4. This is a repeat of
Experiment Ptran12, which showed that passive immunization
limited bacterial growth in the lungs, spleens and liver and, after a
delay, led to SCHU S4 clearance with a similar slope as LVS
vaccination
ii. This experiment is currently in progress and the results up to day 3
indicate that the differences between passively immunized rats, LVS
vaccinated rats and negative control rats can be observed as early
as day 3 post infection (Fig 4).
iii. We will provide data for days 5, 7, 10, 14 and 21 post infection in the
next technical report.
Lung
7
6
5
4
3
2
1
2
3
Days Post-challenge
4
9
8
7
6
5
4
3
2
1
0
CFU (log10)
CFU (log10)
CFU (log10)
8
0
Spleen
Liver
9
0
1
2
3
Days Post-challenge
4
9
8
7
6
5
4
3
2
1
0
Naive (0.25ml PBS)
NRS (0.25ml)
Vaccinated
IRS (0.25ml)
0
1
2
3
4
Days Post-challenge
Figure 4. Kinetics of SCHU S4 proliferation and dissemination in LVS-vaccinated or passively
immunized Fischer 344 rats. Fischer 344 rats (n =6) were either passively immunized with 0.25 ml
immune rat serum 1 day before challenge or vaccinated with LVS 1 month before challenge and
challenged i.t. with 1000 SCHU S4. On the indicated days after vaccination, entire lungs, liver and
spleen were homogenized and plated onto cystine heart agar quantify the bacterial load. Each point
represents the average of 6 animals ± SD
b. Experiment Phist-1 (L:\Lyonslab\Tularemia\Tularemia Contract
Folder\Experiments and Results\Gopi's experiments\phist-1)
i. The purpose of this experiment was to compare the histopathology
of tissues from passively immunized rats and s.c. LVS vaccinated
Page 25 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
rats after i.t. SCHU S4 challenge. Histological difference between
these rats may provide insight into the mechanisms of protection
ii. Rats were either vaccinated s.c. with LVS one month before SCHU
S4 challenge or injected i.p. with 150 l PBS (Naïve), normal rat
serum (NRS) or immune rat serum (IRS) one day before SCHU S4
challenge.
iii. On the indicated days post i.t. SCHU S4 challenge (Table 1), 3 rats
from each group were euthanized to collect the lungs, lung draining
lymph node, liver and spleen.
iv. The tissues have been trimmed and sent out to be sectioned and
stained
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
good
8. Percentage completed
25%
9. Work plan for upcoming month
a. Complete the repeat experiment to examine SCHU S4 growth kinetics in actively
and passively immunized rats
b. Purify IgG from immune and normal rat serum in order to demonstrate that the
protection is mediated by antibodies and not other serum components
c. Histopathological analyses of tissues from actively and passively immunized rats
after i.t. SCHU S4 challenge
d. Determine whether CD4 and/or CD8 T cells are necessary for passive
immunization
e. Determine whether immune mouse serum (Experiment Pmouse1) and human
convalescent sera from Martha’s Vineyard protects rats against i.t. SCHU S4
challenge
Milestone 18
Milestone description: Role of specific  T cells in protection
Institution: UNM/LBERI
1. Date started: 7/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions
No new work done this period
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
Page 26 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
NA
7. Quality of performance
NA
8. Percentage completed
5%
9. Work plan for upcoming month
No work planned
Milestone 19
Milestone description: Interaction between human alveolar macrophages and F.
tularensis
Institution: UNM/LBERI
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions
a. Experiment FT-AH-3 (Notebook 136, pages 26-33;
L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Andrew's experiments\FT-AH-3)
i. The purpose of this experiment was to determine the kinetics of
SCHU S4 growth in human alveolar macrophages (AM). The results
will contribute to our understanding of the host response to
pulmonary SCHU S4 infection since AMs are most likely the first host
cell to encounter SCHU S4 following pulmonary inoculation and may
play a major role in determining the disease outcome
ii. 106 AMs were cultured in 14mL polypropylene Falcon culture tube
instead of tissue culture plates to reduce cell loss during washes and
culture.
iii. AMs were infected with SCHU S4 at MOI = 10 and bacterial burden
in the cultures were determined on days 0, 1, and 3
iv. The results were difficult to interpret because of the low cell recovery
and the large difference in the bacterial load between the two
replicates at 24 h (Fig. 5)
v. Moreover, the low bacterial load at 72 h is inconsistent with the cell
viability and recovery and previous results.
Page 27 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
CFU
100
% input
75
50
Viability
25
Recovery
Total CFU/well (log 10)
Macrophage recovery & viability
10 4
10 3
10 2
10 1
0
0
24
48
Time post-infection
72
0
24
48
72
Hours post-infection
Figure 5. Kinetics of SCHU S4 growth in human alveolar macrophages. 10 6 alveolar
macrophages per tube were infected with SCHU S4 at MOI = 10. At the indicated
time points, the macrophage viability and recovery and bacterial load were
determined. Each point is the mean of two replicated ± SD
a. Experiment FT-AH-5 (L:\Lyonslab\Tularemia\Tularemia Contract
Folder\Experiments and Results\Andrew's experiments\FT-AH-5)
i. The purpose of this experiment was to determine the effect of
cytokines TNF and IFN on the growth of SCHU S4 in human
alveolar macrophages (AM)
ii. 106 AMs were cultured in 14mL polypropylene Falcon culture tube
instead of tissue culture plates to reduce cell loss during washes and
culture.
iii. AMs were infected with SCHU S4 at MOI = 10 and treated with 100
units/ml TNF, IFN or both. Bacterial burden in the cultures were
determined on days 0, 2, and 3
iv. The cell recovery decreased dramatically as the bacterial burden
increased over time (Fig 6). Large numbers of free extracellular
organisms (FT?) visible on hemocytometer. Surprisingly, cytokines
did not have any impact on bacterial load.
v. As in previous experiments, the limited number of AMs does not
allow for enough replicates and time points.
Page 28 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Macrophage Recovery
control
+IFNg
+TNFa
+IFNg +TNFa
75
50
25
CFU (Log10)
%input recovered
100
CFU
10 7
10 6
control
+IFNg
+TNFa
+IFNg +TNFa
10 5
10 4
0
0
24
48
72
0
Time post-infection (hours)
20
40
60
Time post-infection (hours)
Figure 6. Effect of IFN and TNF on SCHU S4 growth in human alveolar macrophages.
Human alveolar macrophages were infected with SCHU S4 at MOI = 10. Infected
macrophages were incubated with 100 u/ml IFN, TNF or both and, at the indicated time
points, infected macrophages were lysed to determine the total bacterial load was.
4. Significant decisions made or pending
NA
5. Problems or concerns and strategies to address
Limited AMs for the conditions to be tested. We will determine whether number of
human alveolar macrophage cells per well can be reduced for each assay so that the
number of replicate wells can be increased to improve reproducibility.
6. Deliverables completed
NA
7. Quality of performance
Needs improvement
8. Percentage completed
19%
9. Work plan for upcoming month
a. Search published literature and review previous studies in the lab with human
AMs for more consistent and reproducible techniques, e.g. comparing culture in
tubes and on plates.
b. Reduce the number of AMs per well required for assay to increase the number of
replicates.
Milestone 21
Milestone description: T cell-induced macrophage killing of intracellular bacteria
Institution: UNM/LBERI
1. Date started: 12/15/06
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions
Page 29 of 59
80
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
a. Experiment PFT6(ABD Primate binder 2&3, electronic data L:\Lyonslab\
Personal Folders\Amanda\NHP phenotyping data analysis\PFT6 phenotype
data)
i.
This experiment utilized animal A00868, a cynomolgus macaque
vaccinated by subcutaneous inoculation with 2.7x106 cfu LVS in 11/06
and boosted by bronchoscope instillation of 1x105 cfu LVS on 1/8/2009.
Lungs, tracheobronchial lymph nodes (TBLN) and spleen were collected
on day 12 after boosting. The purpose of this experiment was to
determine the frequency of multifunctional cells (CD4+ stimulated by HKLVS to secrete TNF, IL-2, or IFN simultaneously) in these tissues, as
confirmation of previous experiments and to test a potential positive
control for cell stimulation, PMA+Ionomycin. An increased frequency of
multifunctional cells responsive to a specific antigen has been
established as a correlate of protection in other intracellular pathogen
infection models in the published literature and is being explored as a
potential correlate of protection for a tularemia vaccine.
ii.
Fresh lung, TBLN, and spleen single cell suspensions from LVS
vaccinated/LVS boosted NHP, frozen lung, TBLN, and spleen from an
untreated (naïve) NHP, as well as frozen spleen cells from a NHP 28
days after pulmonary LVS infection (delivered via bronchoscope
instillation) were used in multifunctional T cell assays to detect
intracellular cytokine production. Cells were treated with media only, antiCD28 only, anti-CD28+2x107 cfu/ml HK-LVS or PMA (50ng/ml) +
Ionomycin (500ng/ml) for a total of 6 hours (last 4 hours in the presence
of BrefeldinA). Cells were then fixed and stained with antibodies against
CD4, TNFα, IL-2, and IFNγ.
iii.
Lung assay: (Figure 7)
a. Treatment of frozen untreated NHP (Naïve) cells with HK-LVS
did not stimulate an increase in the frequency of multifunctional
cells whereas treatment with PMA/ionomycin did, confirming
both the specificity of the assay and the potential of lung cells
from untreated NHPs to secrete all three cytokines when
stimulated with a general mitogen (PMA/ionomycin).
b. Conversely, stimulation with HK-LVS, but not PMA/Ionomycin,
induced a high frequency of lung cells from LVS vaccinated/LVS
boosted (d12) animal to secrete all 3 cytokines. These results
confirm observations from a previous experiment that HK-LVS is
able to specifically stimulate in vitro lung cells from LVS
vaccinated/LVS boosted NHPs.
iv.
TBLN assay
Treatment with PMA/ionomycin, but not HK-LVS, induced
increased frequencies of multifunctional cells in TBLN isolated
from both untreated and LVS vaccinated LVS/boosted NHP
(data not shown).
Page 30 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
2.5
2.0
1.5
1.0
0.5
d12 PMA/Ion
d12 CD28/LVS
d12 CD28
d12 media
naive media
naive CD28/LVS
naive PMA/Ion
0.0
CD4/Irr Ab
%CD4+/TNF/IL-2/IFN cells
Lungs +++
Figure 7.Frequency of multifunctional cells in lung single cell suspensions from an untreated NHP
(blue bars) or an LVS vaccinated NHP 12 days after an LVS boost (green bars) following various
treatments in vitro. Cell were treated with media alone (media), anti-CD28 (CD28), antiCD28+HK-LVS (CD28/LVS), or PMA+ionomycin (PMA/Ion). Anti-CD28 was included to provide
the necessary secondary signal for efficient T cell stimulation.
Spleen assay
a. Splenocytes (Figure 8) from an untreated NHP (Naïve) and NHP
receiving a pulmonary infection with LVS (d28) were responsive
to PMA/Ionomycin treatment but not HK-LVS, confirming both
the specificity of the assay and the potential of each cell
population to respond to mitogenic stimulation.
b. Splenocytes from LVS vaccinated/LVS boosted NHP (d12)
responded to stimulation with both HK-LVS and PMA/Ionomycin,
indicating antigen specific responses can be detected in this
organ as well.
Spleen +++
7.5
5.0
2.5
0.2
0.1
d28 PMA/Ion
d28 CD28/LVS
d28 CD28
d28 media
d12 PMA/Ion
d12 CD28/LVS
d12 CD28
d12 media
naive PMA/Ion
naive CD28/LVS
naive media
0.0
CD4/Irr Ab
%CD4+/TNF/IL-2/IFN cells
v.
Figure 8. Frequency of multifunctional cells in splenocytes collected from an untreated
(blue bars), an LVS vaccinated NHP 12 days after an LVS boost (green bars), or an NHP
28 days after a primary pulmonary LVS infection (red bars) following various in vitro
Page 31 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
treatments. Cell were treated with media alone (media), anti-CD28 (CD28), antiCD28+HK-LVS (CD28/LVS), or PMA+ionomycin (PMA/Ion). Anti-CD28 was included to
provide the necessary secondary signal for efficient T cell stimulation.
a. Experiment FT-AH-4 (Notebook 136, pages 34-36;
L:\Lyonslab\Tularemia\Tularemia Contract Folder\Experiments and
Results\Andrew's experiments\FT-AH-4)
i. The purpose of this experiment was to determine whether human
PBMC and monocytes can support the growth of SCHU S4 in vitro
and to measure the bacteriostatic/bacteriocidal potential of the
PBMC and monocyte cells before we develop a human macrophage
killing assay using PBMC or monocytes
ii. 2.5x 106 cells/well plated in 48-well plate were infected with SCHU
S4 at MOI = 1. The infected cells, except Ly+Mo, were incubated
with 100U/mL (> 25x ED50) recombinant human IFN
iii. At specified timepoints, cell recovery and viability were measured
using hemocytometer and trypan blue , respectively, and bacterial
burden was determined
iv. The results showed that PBMC, monocytes and the mixture of
lymphocytes and monocytes all supported robust SCHU S4 growth
(Fig 9). This suggests that we may be able to use PBMC or
monocytes as the effector for the macrophage killing assay and
shorten the assay time by ~ 1 week compared to using monocyte
derived macrophages as the effector.
v. Recombinant IFN reduced the number of SCHU S4 recovered, but
the reduction was no more than 1 log, as observed previously with
murine bone marrow macrophages infected with SCHU S4 (Fig. 10).
If the bacteriostatic potential of PBMC or monocytes cannot be
increased further, we may choose to abandon this approach
because it would be difficult to distinguish between vaccinated and
unvaccinated humans
Page 32 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Figure 9. Ability of PBMC and monocytes to support SCHU S4 growth. 2.5 x 10 6
human PBMC, monocytes, or a mixture of monocytes and naïve lymphocytes
were infected with SCHU S4 at MOI = 1. Bacterial burden was determined daily
Figure 10 IFN-induced inhibition of SCHU S4 in PBMC and monocytes. 2.5 x 106
human PBMC and monocytes were infected with SCHU S4 at MOI = 1 and treated with
100 U/ml recombinant human IFN. Bacterial burden was determined daily
4. Significant decisions made or pending
Decide whether PBMC or monocytes can be used for the macrophage killing assay
5. Problems or concerns and strategies to address
NA
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
53 %
9. Work plan for upcoming month
a. Measure the maximum potential of human PBMC/monocyte to be activated to
inhibit F. tularensis growth by testing parameters including preactivation with
IFNγ, lower MOI, and cytokine combination
b. Addition of vaccinated human T cells to PBMC/monocytes, if they are useful
c. Develop rat PBMC/monocyte assay similar to humans
d. Evaluate the usefulness of LVS/lux operon in RAW 264 murine macrophage-like
cell line
Page 33 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 21
Milestone description: Correlates of protection: in vitro assay or other readout of
effector function of Ft developed for multiple species.
.
Institution: LBERI
1. Date started: 4/8/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary
conclusions
a. No work was performed during this reporting period.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
2% of the scientific work is complete
9. Work plan for upcoming month
Repeat the ICCS assay and include a positive mitogen control (Con A). PBMCs from
the NHPs vaccinated in October 2008 will be used in the assay.
Milestone 29
Milestone description: Analysis of T cells from NHP lymph nodes and T cell epitopes
Institution: UNM/LBERI
1. Date started: 10/1/08
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions
a.
b.
c.
d.
Two NHP were vaccinated s.c. with LVS in October 2008
We received the pooled polypeptide Ft library from ASU on 1/6/09
We ordered materials and reagents needed for perform the IFN ELIspot assay
We have scheduled to boost the vaccinated NHP on Feb 11 and to collect the
lymph nodes and splenocytes for IFN ELISpot on Feb 22
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
NA
7. Quality of performance
Good
8. Percentage completed
Page 34 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
3%
9. Work plan for upcoming month
a. Boost the LVS vaccinated NHP before harvesting the organs
b. Test peptides from ASU with lymph node cells and spleens from LVS vaccinated
NHP. Detect immune responses by ELISpot assay
Milestone 29
Milestone description: Analysis of T cells from lymph nodes & T cell epitopes
.
Institution: LBERI/UNM
1. Date started: 8/7/2008
2. Date completed: In progress
3. Work performed and progress including data and preliminary
conclusions
a. LVS bronchoscopy of A05403 is scheduled for 2/11/09. A05403 was vaccinated
via the LVS route on October 16, 2008 and is being boosted on 2/11/09
b. Necropsy of A05403 will occur on 2/23/09 (day 12 post-LVS boost)
c. Lymph nodes will be transferred to UNM on 2/23/09 for use in the ASU
polypeptide Ft library cellular screening assay.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
2% of the scientific work is complete
9. Work plan for upcoming month
a. Necropsy of A05403 will occur on 2/23/09 (day 12 post-LVS boost)
b. Lymph nodes and spleen cells will be transferred to UNM on 2/23/09 for use in
the peptide screening assay.
c. LBERI will process PBMCs and spleen on the day of necropsy and test these
cells in the ifn PBMCs and spleen on the day of necropsy and test these cells in
the IFNγ ELISPOT and proliferation assays; PBMCs will also be tested from a
pre-bronchoscopy blood draw scheduled for 2/9/09
Milestone 35
Milestone description: Array hybridization with mouse RNA from virulent SCHU S4
infection and RT PCR confirmation of candidates
Institution: UNM/ASU Johnston
Page 35 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
1. Date started: 8/1/2006
2. Date completed: pending
3. Work performed and progress including data and preliminary
conclusions
No new work performed since ASU made no request for RNA samples
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
25%
9. Work plan for upcoming month
None
Milestone 35
Milestone description: Array hybridizations with mouse RNAs from virulent
Schu 4 infection & RT PCR confirmation of candidates.
Institution: UNM/ ASU-Johnston
1. Date started: 08-01-2006
2. Date completed: Pending
3. Work performed and progress including data and preliminary
conclusions

Previous Results: We noticed a drop in signal intensities (an average of 300 vs.
greater than 1,000 on previous runs) on the most recent print run of arrays. We
questioned whether the low average intensity signals resulted from the age of the
slides (greater than 6 months at the time). We tested whether a new print run would
resolve the problem. A fresh print run was performed in January but similar run with
low-level signals were obtained as had been detected with the 6 month old printed
microarray slides.
Page 36 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Figure 1. Raw signal intensities of the rat- time course showing overall reduced signal
intensity peaking between 200 and 300 relative fluorescent units.
Notebook/File locations ASU: Notebook 966, Slide QC page 1-8;
R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT 31 (NM tc III second run
lp)\012609lp\rat_time_course.ppt

To further investigate the low overall intensity signals we performed a dose-response
experiment in which increasing amounts of labeled, unamplified SCHU S4 total RNA
was applied to the January 2009 print run. The amounts varied by 200 pM intervals
from 200 to 1000 picomoles. The previously optimized amount was determined to be
200 pM of labeled RNA. The idea was that there was somehow less available
labeled probe for the hybridizations. The results provided in Table 1 show that
hybridizing additional labeled target did not overcome the microarray slide intensity
problems. There was almost a two-fold increase in average fluorescent intensities
detected between 200 to 400 pM of labeled RNA hybridized. Increasing the amount
of label to 1000 pM did not increase the average gene intensities beyond the 300
relative fluorescent levels. Thus, increasing the amount of target hybridized did not
achieve the 1000 fluoresent intensity previously achieved 6 months ago. The 300
fluoresecent intensity results were similar to the past three runs.
Page 37 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Average gene intensities
200
139
pM Labeled SCHU S4 RNA
400
600
800
232
335
264
1000
306
Table 1. Average gene intensities of a dose-response curve of increasing amounts of
labeled unamplified SCHU S4 RNA.
Notebook/File locations … ASU: Notebook 966, Slide QC page 12-14

We hypothesized that there might be an annealing event happening in the stock
master plates and that this could be resolved by heat-treating the oligos to 95 C to
disrupt any annealing before spotting. We took the master printing stock plates and
heat treated them in an oven before processing them for a new, 3rd printing run. The
two printing runs January (not heat treated) and February (heat treated) were
hybridized with the aliquots from the same labeled RNA prepared for the data shown
in Table 1. The results shown in Figure 2 were dramatically different than the
previous runs in that the January run (not heat treated) had an average signal
intensity of 1,792 which is comparable to historical runs. The heat-treated arrays had
an average of 860 relative fluorescent units slightly less than the non-heat treated,
but much better than the previous results around 300. A careful review of the
hybridization protocol revealed that the hybridization water bath had been changed
from 60 to 65 C. The last run for both the heat-treated and nonheat-treated print runs
were returned to 60 C for the overnight hybridization. The key effect is that the
increased temperature (65C) was too high to allow efficient hybridization between
labeled product and probe resulting in overall signal intensity reduction .
Page 38 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Figure 2. Raw signal intensities of the same RNA target hybridization run for the data in
table 1 on slides prepared with oligos that were heat-treated and not-heat treated.
Notebook/File locations ASU: Notebook 966, Slide QC page 19-23;
R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT 31 (NM tc III second run
lp)\Slide QC\31_SlideQC.ppt
4. Significant decisions made or pending
Ensure that the written protocols are followed for all steps.
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
74%
9. Work plan for upcoming month



Begin full-scale processing of the LAPT samples ready for labeling and
hybridization.
Begin data analysis and processing for pattern analyses.
Continue qPCR analysis of defined bacterial number samples.
Page 39 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 49
Milestone description: Construct single mutants in F. tularensis subsp. tularensis
(SCHU S4) (iglC, pdpD, iglD, iglA, iglB)
49.1: Construct iglC F. tularensis subsp. tularensis (SCHU S4)
49.2: Construct pdpD F. tularensis subsp. tularensis (SCHU S4), Construct iglD F.
tularensis subsp. tularensis (SCHU S4)
49.3: Construct iglA F. tularensis subsp. tularensis (SCHU S4), Construct iglB F.
tularensis subsp. tularensis (SCHU S4)
Institution: UTSA
1. Date started: April 1, 2006
2. Date completed: in progress
3. Work performed and progress including data and preliminary conclusions
In order to generate mutants in SCHU S4 we need to develop tools to generate
successful deletions. Therefore, our focus is two fold, one is cloning experiments to get
our target deletions into vectors that we can use in creating these deletions and
experiments with SCHU S4 itself using constructs that we believe will allow us to make
deletions into SCHU S4.
I.
Cloning:
a. Based on preliminary results of the NadM Schu S4 mutant screens one found that the
second and third cycle clones still maintained the wild type genotype as the dominant
PCR profile. The NadM deletion is a single gene mutation and this continued profile
after cycle three is surprising but may be due to this being a metabolic gene mutation.
NadM is an enzyme which helps to make NAD (ADP-Ribosyltransferase) protein which
is important for many metabolic changes which include activation of adenylate cyclase,
regulation of protein synthesis and ion transport across cell membranes.
NadM
consists of two domains which have specific roles in the production of NAD; the Nterminus and the C-terminus. The N-terminus is responsible for catalyses and the
adenylation of nicotimeamide mononucleotide (NMN) to NAD; and the C-terminus is
involved in the recycling of NAD and products of its degradation. We are making the
deletion at the C-terminus of the protein which would disrupt the ability of this protein to
recycle NAD and maintain the ability of the cell to produce NAD and allow the cell to
survive. Although without the ability to recycle NAD the cell may not be as healthy but
they should be able to survive.
b. Therefore to better our chances, we decided to try another strategy for generating this
metabolic mutant by using a mating plasmid used successfully by Dr. Celli’s lab to
create mutants in Schu S4, pJC84. To save time we decided to first clone our desired
NadM sequence into pGem-T (3003 bp) cloning vector (by Promega). This pGem T
plasmid allows direct cloning of PCR product into this vector by utilizing the A
(Adenosine) overhangs that are typically generated during polymerase chain reactions.
In addition, this strategy will utilize a transposon [T20 (ISFn2/FRT)-1401 bp] insertion
that was used by a group at Washington University to generate a library of Francisella
novicida mutants. The T20 (ISFn/FRT) transposon has a kanamycin cassette flanked
with FRT which is the flip recombinase recognition sites which allows removal of this
the Kanamycin gene sequence from the chromosome. Our laboratory has a NadM
mutant in F. novicida obtained from this group’s library identified as
tnfn1_pw060328p06q193 which contains the transposon insertion in NadM between
nucleotide (nt) 565 and nt 566. We isolated genomic DNA from this F.novicida NadM
mutant and we used this as the template to generate the NadM PCR product using on
Page 40 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
hand oligos which anneal approximately 1000 bp upstream and downstream of the
NadM gene.
NadM Sal I : 5’-atgtcgacgggtcattaaagcttgtatttagggagc-3’
NadM Sal I Stop: 5”=atgtcgactctggacattatttgcttttatctctggcaac-3’
The expected amplification product with these oligos and this NadM mutant genomic
template is 3634 bp (Figure 1). Data located in TVD UTSA Notebook 7, pages 70 and
71.
Figure1.
1 Kb
3.0
1.0
1
2
3
1 4 5
3.8
Legend:
1.
2.
3.
4.
5.
1 Kb Ladder
NadM T20 PCR
NadM T20 PCR
Gel isolate NadM T20
Uncut pJC84
1.0
Figure 1 represents the PCR amplified product by using the F.novicida NadM T20 mutant genomic
DNA with oligos approximately 1000 bp upstream and downstream of the NadM gene where the
expected product is 3634 bp; lanes 2 and 3 are 2 ul aliquots of two independent reactions using XL
KOD polymerase enzyme. Lane 4 is 2 ul of 35 ul gel isolated NadM T20 PCR product which will be
used in cloning experiment. Lane 5 is 2 ul of 300 ul of a midi plasmid isolation of pJC84 plasmid (3775
bp) which was prepared and will be needed later. Data located in TVD UTSA Notebook 7, pages 70 and
71.
The NadM T20 NadM PCR product generated in figure 1 was used in a ligation reaction
with the Promega’s pGem-T vector. Once the overnight 16°C incubation was complete
the ligation reaction was cleaned up via chloroform: phenol extraction with subsequent
ethanol precipitation. This ligation was used to transform DH5α cells and plated on LB
kanamycin (50 ug/ml) plates.
Very few colonies resulted from this transformation
however, the re-ligation negative control yielded no colonies on the kanamycin plates (as
expected). Therefore, five plasmid isolations were made from each of the colonies
generated from the potential NadM transformants and these were subsequently digested
with EcoRI and Sal I, respectively (Figure 2).
Page 41 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Figure 2.
Legend:
1 Kb
12.5
4.0
2.0
EcoRI
Sal I
1 2 3 4 5 6 2 3 4 5 6 7 8 1
1.
2.
3.
4.
5.
6.
7.
8.
1 Kb Ladder
pGemN1
pGemN2
pGemN3
pGemN4
pGemN5
pJC84 BamHI
Uncut pJC84
Figure 2 represents the results from two digestions made on the pGem + T20 NadM colonies
(pGemN1-pGemN5) generated from our transformation experiment. The EcoRI digestion should
not cut the plasmid or the T10 NadM insert so will show the uncut profile of the construct lanes 2
thru 6 in the EcoRI panel above. The Sal I will cut out the entire T20 NadM insert (3634 bp) since
this is the restriction endonuclease site created by the oligos used at the 5’ and 3’ ends,
respectively, of this PCR generated T10 NadM sequence (lanes 2 thru 6 in the Sal I panel). All
five colonies look correct based on the size profile of the bands where the plasmid will be at ≈3000
bp. Lane 7 is a BamHI digestion of the pJC84 mating plasmid which should linearize this plasmid
to yield a 3775 bp band; and lane 8 is the uncut profile of pJC84. Data located in TVD UTSA
Notebook 7, page 72.
We quantitated the first colony’s plasmid isolation (pGemN1) and sent this for
sequencing along with the NadM Sal I oligos mentioned above. (Will report sequence
results on next report). In the meantime, we decided to continue our cloning strategy
where we digested the pJC84 plasmid with the Sal I enzyme and then treated with
alkaline phosphatase which removes the 5’ end phosphate groups and reduces the
frequency of re-ligation of this plasmid. In addition, the pGemN1 was also used to
digest more of this DNA with Sal I to generate enough of this T10 NadM sequence
fragment to use in gel isolation purification to use in subsequent ligation experiment.
d. Furthermore, we decided to proceed with the cloning of the final mutant to construct
FTT0748 for milestone 49 by using our tulatron plasmid as described in a earlier
report. First an analysis of the FTT0748 was required by Sigma’s algorithm to
determine the best gene locations and oligo sequences to use to generate this
“FTT0748 intron”. Base on this analysis the following oligos were order for use in the
cloning strategy:
FTT0748-561/562S-IBS:
5’aaaactcgagataattatccttaaaagtcataaaagtgcgcccagatagggtg-3’
FTT0748-561/562S-EBS1d:
5’cagattgtacaaatgtggtgataacagataagtcataaaaggtaacttacctttctttgt-3’
FTT0748-561/562S-EBS2: 5’-tgaacgcaagtttctaatttcggttactttccgatagaggaaagtgtct3’
The bolded nucleotides are the restriction sites, Xho I and BsrGI, respectively, which
will be used in this cloning. Data located in TVD UTSA Notebook 7, page 74.
c.
Page 42 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
II.
Experiments to generate mutants in Schu4:
a. The last report indicated various potential NadM mutants which were selected for
further passaging to generate more islolated clones. The original clones N2, N7 and
N3 were used to passage. The next cycled colony from the original clone will be
labeled with a letter of a - # to help keep track of what cycle (passage) this original
clone has reached in this screen. For example, N2A is the original clone N2 at the
second passage; N3-4A is the N3 clone at the third passage. The single colonies
generated at each passage were selected randomly from plate and given a name as
indicated and also genomic isolations were made from some of each group and use in
a polymerase chain reaction using the earlier mentioned oligos:
nadM-NcoI: 5’- cgcgcgccatgggcatgtatgatatttcagtttttataggaagatttcag -3’
nadM-EcoR1: 5’- cggaattcttatagtttcttaccacattcctctaataaaatc -3”
These oligos will yield the mutant profile we want to see which is one band at ≈1900 bp
for the complete correct NadM mutant (Figure 3).
Figure 3.
1 Kb
1 2 3 4 14 15 16 17 18
2.0
0.7
Legend:
1. 1 Kb Ladder
2. 1230
3. KKT1
4. N7 orig
5. N3-4A
6. N3-4B
7. N3-4C
8. N3-4D
9. N3-4E
10. N3-4 F
11. N3-3
12. N3-4
13. N3 orig
14. N2 A
15. N2 E
16. N2 F
17. N7-6
18. N3 orig
3.0
0.9
1 2 3 4 5 6 7 8 9 10 11 12 13
Figure 3 represents a PCR using various cycled NadM mutants using oligos nadM-NcoI and nadMEcoR1 which target the 5’ and 3’ ends of the NadM gene, respectively. The correct NadM mutant
should yield a ≈1900 bp (“mutant band”) product only. The KKT1 is used as the wild-type control
yielding ≈1100 bp fragment with this oligo set (lane 3). Lanes 4, 13 and 18 are profiles for original
NadM clones used in the passaging. The mutant band is very light on some of these original
profiles but it is there. Comparatively, the various passaged NadM mutants seems to be yielding a
darker mutant band than their parents (original clones). Lanes 11, 12, 14-17 are second cycled
NadM clones and Lanes 5-10 are third cycle NadM clones. These cycled clone appear to be
yielding a stronger mutant band which may indicate potential success in generating a clone
containing only the mutant band with additional passaging. Data located in TVD UTSA Notebook
7, page 67.
d. The genomic templates of the NadM clones in figure 3 were used for further screening
to insure that those clones yielding a ≈1900 bp band do in fact still have the NadM
intron inserted at the correct location in the chromosome. Therefore, the oligo set
EBS Universal and the forward NadM directed primer, nadM-Nco I (described earlier)
were used to check for presence of this NadM intron in the chromosome (Data not
show because the resulting products were very light). However, we wanted to insure
that this product is in fact yielding the expected NadM sequence so we took one of the
clones (N3-4B) and prepared a new reaction to use to gel isolate the entire product
and send for sequencing (Figure 4).
Page 43 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Figure 4.
1 Kb
1
2
3
Legend:
3.0
1. 1 Kb Ladder
2. N3-4B PCR
3. Low Mass Ladder (2 ul)
1.0
Figure 4 represents the isolated PCR product resulting from N3-4B, third passaged clone’s genomic
DNA as template with the EBS Universal and nadM-Nco I oligo set. The expected size of this product
should be ≈900 bp. Lane 2 represents 2 ul sample of a 35 ul isolated PCR product suspension which
was subsequently sent for sequencing. Data located in TVD UTSA Notebook 7, page 68.
e.
The sequencing results of N3-4B clone indicated that this insertion is still in the
chromosome and at the correct location. Therefore, we will continue to passage
some select clones by streaking for single colonies on a TSA+++ 60ug/ml kanamycin
plates which will be grown and 30°C. Isolated clones from this passage will be
screen by PCR to search for the correct ≈1900 bp band without any wild type band
present (1100 bp).
4. Significant decisions made or pending
The Milestone 49 will be extended 6 months from original completion date to 8/31/09
5.
Problems or concerns and strategies to address
None
6. Deliverables completed
KKF5: igLC1 IgLC2 Schuh4: KKF10: iglD1 igLD2 Schuh4; and KKF13: VgrG1
VgrG2 Schuh4 mutants are completed Schuh4 strains to date.
7. Quality of performance
Good
8. Percentage completed
87%
9. Work plan for upcoming month
a. Will continue with the screening of the NadM mutant which will require cycling of
various clones to facilitate the effective insertion of the NadM intron into the SchuS4
chromosome.
b. Will continue with second strategy for generating NadM Schu S4 mutant via the pJC84
mating vector from Dr. Celli lab at the Rocky Mountain labs. Will report confirmation of
cloned NadM into the pGemT vector along with continued cloning results into pJC84.
c. Will begin cloning of the “FTT0748 intron” construct as oligos will be available for the
necessary gene intron amplification.
Page 44 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 50
Milestone description: Phenotyping and confirmation of single gene mutants;
50.1: phenotyping and immunologic characterization of Ft subsp. novicida uvrA or uvrB;
LVS uvrA or uvrB, and Ft subsp. tularensis (SCHU S4) iglC strains,
50.2: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4)
pdpD, iglD strains, Ft subsp. novicida uvrA or uvrB plus pdpD/iglA/iglB/iglC/iglD double
mutant strains,
50.3: phenotyping and immunologic characterization of Ft subsp. tularensis (SCHU S4)
iglA, iglB strains
Institution: UTSA
1. Date started: 05/01/2006
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
50A-a: (1) Measure humoral responses after KKT13 (vgrG mutant of SCHU S4) oral
immunization. (Note book # 9, page 19-21). C57BL/6 mice were orally immunized
with KKT13 (103 CFU) or PBS (mock control). Sera and fecal pellets were collected
at day 21 after immunization and assayed for anti-KKT13 specific antibody titers by
ELISA. Antigens, either UV-irradiated KKT13 (106/well) or HEL (Hen Egg Lysozyme,
1g/well, an unrelated antigen as control), were coated onto 96-well microplates and
reacted with fecal samples or serial dilutions of sera. Mice that received a single
immunization of KKT13 induced significant amount of antigen-specific total serum
antibody (Ig(H+L)) as shown in Fig. 1A. Further IgG isotyping analyses of the sera
indicated oral immunization of KKT13 resulted in producing both Th1- (IgG2a) and
Th2- (IgG1) type antibodies. Oral immunization also induced measurable anti-KKT13
specific secretory IgA in the prepared fecal pellet samples (Fig. 1B.). No KKT13specific antibody was detected in mice mock-vaccinated with PBS at day 21 after
immunization. All tested samples showed no reactivity to the unrelated HEL protein
(data not shown).
Page 45 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
A.
B.
3000
0.50
KKT13
KKT13
Mock (PBS)
0.40
2000
Titer
A405
0.30
0.20
1000
0.10
0
0.00
Ig(H+L) IgG1
IgG2a
IgA
IgM
IgA
IgM
Fig.1. Mucosal immune responses induced by KKT13 (vgrG of SCH S4) oral
immunization. Mice were immunized with 103 CFU of KKT13 or mock vaccinated
with PBS. Sera (A) and fecal pellets (B) were collected 3 weeks after
immunization, and assayed for anti-KKT13 specific antibody.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
93% of scientific work completed on milestone 50A (original plans)
9. Work plan for upcoming month
50A. (1) Evaluation of protective efficacy of intranasal KKF235 (iglB of U112)
vaccination against Francisella Type B (OR96-0246 strain) challenge.
Milestone 52
Milestone description: Create RecA mutants in F. tularensis subsp. Tularensis (Schu
S4)
Institution: UTSA
1. Date started: 9/15/2007
2. Date completed: In progress
3. Work performed and progress including data and preliminary conclusions
3.1 Creation of RecA and IglC double mutant in F. tularensis tularensis (SCHU S4).
This part of Milestone 52 is to create recA and IglC double mutant in F. tularensis tularensis.
Inactivating the recA gene will stabilize the strain and prevent the strain from any additional
Page 46 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
genetic changes. We already have the IglC mutant of Schu S4, and the tulatron vector
pKEK1186 for disturbing and inactivating the recA gene in Francisella tularensis.
3.1.1 In last monthly report, it was reported that cryotransformation of the tulatron vector
pKEK1186 into KKT5 (IglC mutant Schu S4) was performed and only 12 colonies were
observed afterwards. The exact same cryotransformation was done in order to obtain more
potential transformants. The parent strain KKT5 was grown on fresh TSA++ plate from the
frozen stock 1-2 days prior to the transformation, and all the culture medium were made
fresh. After 4-5 days of incubation at 30°C, lots of single colonies were obtained from
TSA++/Kanamycin (50ug/ml) agar medium. Then about 104 colonies were patched onto
the fresh TSA++/Kanamycin (50ug/ml) agar plates and incubated at 30C for 2-3 days.
3.1.2 Colony PCR for 10 colonies was performed using the recA gene primers “recA Schu4
for” and “recA Schu4 rev” to verify the insertion in recA gene of KKT5. PCR reaction was
set up as follows and the reagents for PCR were purchased from Promega Inc:
5XGreen GoTaq Buffer
dNTPs mix, 10mM each
recA Schu4 for (25pmol/ul)
recA Schu4 rev (25pmol/ul)
GoTaq DNA polymerase
DNA
DNAse, RNAse free water
4.0ul
0.4ul
1.0ul
1.0ul
0.1ul
1.0ul
12.5ul
At 95°C 2 min, 95°C 30 sec/55°C 30 sec/72°C 1 min 40 sec//30 cycles, 72°C 5 min
Figure1: Gel picture of colony PCR using the recA gene primers.
Figure1 legend, results and data location: Lane7 was KKF348 (recA mutant U112) as the positive control,
which had the insertion of intron in recA gene and the PCR product generated was about 1.5kb. Lane8 was
the parent strain KKT5 (IglC mutant Schu S4) as the negative control (about 630bp). Lane2-lane6 was
colony1-5 and lane9-lane13 was colony6-10. All of the colonies had the same size band as the positive
control (lane7), which meant that the mutated intron was inserted into recA gene, hence the PCR product
(about 1.5kb) was larger than the parent strain KKT5 (lane8, about 630bp). Colony5 (lane6) had another
band that was faint and about the same size as the parent strain (lane8), which indicated that this colony
had the parent strain mixed with the mutant strain. The colonies were screened using colony PCR (above)
and were the correct size, (except for colony 5 in lane 6)as the expected potential recA mutant KKT5.
Data recorded on UTSA TVDC notebook #6, page61 for Figure1.
Page 47 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
4. Significant decisions made or pending
None
5.
Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed.
About 49% of scientific work completed.
9. Work plan for upcoming month
i. Screen the same 10 colonies tested in Step3.1.2 of this report using colony PCR
with the primer inside the insertion to further confirm the gene disruption in RecA of
KKT5.
ii Sequence the PCR product from the mutant strain to verify the insertion in RecA of
KKT5.
iii Remove the tulatron vector from the mutant strain by incubation at 30°C.
Milestone 53B
Milestone description: Examining the protective efficacy of LVS and two attenuated
SCHU S4 mutant strains via oral vs. intradermal inoculations in the rat model;
50.1: replication of LVS, Schuh4, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 in rat macrophages .
50.2: protective efficacy of LVS, iglC Schuh4, and one additional attenuated Schuh4 mutant
derived in milestone 49 against Schuh4 intratracheal challenge (oral vs. intradermal vaccinations
in rats)
50.3: antigen specific cellular and humoral responses of rats following vaccination with LVS, iglC
Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
50.4: bacterial dissemination and lung pathology of rats following vaccination with LVS, iglC
Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49
Institution: UTSA
1. Date started: 12/01/2008
2. Date completed: provide date when milestone is completed
3. Work performed and progress including data and preliminary conclusions
53B-a: (1) Replication of F. novicida U112 and F. holarctica LVS within rat bone
marrow derived macrophages. (Note book # 10, pages 25-26). Bone marrow derived
macrophages were derived from F344 rats, seeded in 96-well culture plates at a
density of 2 X 105 cells per well and allowed to adhere over night. Cells were infected
with either F. novicida or LVS at 10 and 100 MOI for 2 hours. Cells were then pulsed
with Gentamicin for 1 hour to kill any remaining extracellular bacteria, after which
they were incubated at 37 degrees C. Cells were lysed at 3, 24, 48, or 72 hours and
serial dilutions of lysate were plated on TSA plates to enumerate intracellular
bacteria. As shown in Figure 1, there was an initial uptake of 102-103 CFU of F.
novicida at 3 hours followed by 1-2 logs of replication by 24 hours post-infection.
From 48 to 72 hours after infection, the numbers of viable F. novicida slowly
decreased. In contrast, very few LVS were taken up by the macrophages initially.
Additionally, those macrophages which were present inside of the macrophages were
Page 48 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
unable to replicate. This data indicates that while F. novicida is able to reside and
replicate with the rat macrophage, LVS is deficient in both getting in to, as well as
replicating within, the rat macrophage.
F. nov ic ida
LVS
10 MOI
10
6
10 5
10
5
10 4
10
4
10 3
10
3
10 2
10
2
10
1
CFU
10 6
10 1
3
24
48
72
100 MOI
3
24
48
72
Hours After Inoc ulation
Fig. 1. Intramacrophage growth of F. novicida and LVS in rat BMDM. Primary
bone marrow derived macrophages derived from Fisher 344 rats were infected
with F. novicida U112 or F. holarctica LVS at either 10 or 100 MOI. Cells were
lysed and viable bacteria were counted at 3, 24, 48 and 72 hours after infection.
After obtaining these results, it was noted that previous work by Dr Nano’s group
(1991, Infection and Immunity, 59 (9) 3291-3296) used an alternate rat strain, the
Lewis rat. We then decided to perform a repeat of the above experiment using bone
marrow derived macrophages from both the Fisher 344 and the Lewis strain side-byside in order to compare and contrast the two. This experiment was performed
exactly as above, except that cells were only infected at an MOI of 100. As shown in
Figure 2 (Notebook # 10, Pages 27-28), the replication profile for both strains was
highly comparable and followed the same trend as in figure 1 above. This data
indicates that both F. novicida and LVS behave similarly in bone marrow derived
macrophages from two different strains of white rats. This lack in the ability of LVS to
replicate within rat macrophages in vitro could explain the highly attenuated nature of
that strain in vivo and the large immunizing dose necessary for protection against
SCHU S4 challenge.
Page 49 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
F. nov ic ida
LVS
F344 Rat
10
6
10 5
10
5
10 4
10
4
10 3
10
3
10 2
10
2
10
1
CFU
10 6
10 1
3
24
48
72
Lewis Rat
3
24
48
72
Hours After Inoc ulation
Fig. 2. Intramacrophage growth of F. novicida and LVS in rat BMDM. Primary
bone marrow derived macrophages derived from Fisher 344 and Lewis rats were
infected with F. novicida U112 or F. holarctica LVS at 100 MOI. Cells were lysed
and viable bacteria were counted at 3, 24, 48 and 72 hours after infection.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address
None
6. Deliverables completed
None
7. Quality of performance
Good
8. Percentage completed
8%
9. Work plan for upcoming month
53B. (1) Perform phagocytosis assay of F. holarctica and F. tularensis SCHU S4 with
F344 rat bone marrow derived macrophages.
Milestone 55
Milestone description: Compare cellular Immunogenicity of Francisella and ListeriaBased vaccine platforms. Measure cellular immunogenicity of live-attenuated vaccine
platforms. Compare immunogenicity of KBMA tularemia vaccine platforms
Institution: Cerus/Anza
1. Date started: 4/1/2008
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will construct and prepare live and Killed But Metabolically
Active (KBMA) Listeria monocytogenes (Lm) vaccines expressing Francisella tularensis
Page 50 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
(Ft) antigens. To directly compare the cellular immunogenicity of Lm and Ft-based
vaccines, each Lm vaccine candidate will express an antigen fused to a model ovalbumin
epitope SIINFEKL (SL8) and these will be compared to Ft vaccines expressing pepO-SL8
fusions (provided by UTSA). We will measure the ability of each vaccine to stimulate a
CD8 T cell response in vitro using a B3Z assay. We will measure the cytokine responses
elicited by vaccination with each platform in mice, compare the CD8 T cell response to
SL8 after prime and boost vaccinations in mice using intracellular cytokine staining (ICS)
and ELISpot assays and measure the potency of the T cells elicited by use of an in vivo
cytotoxicity assay.
Summary of key achievements: We have demonstrated that IglC-SL8 fusion proteins are
expressed to a much higher level than KatG-SL8 in the cytosol of macrophages and
dendritic cells (DCs). Live-attenuated vaccines expressing either fusion protein were
able to secrete antigen within DCs and stimulate the B3Z T cell line that responds to the
SL8 peptide. The IglC-SL8 fusion protein induced a stronger immune response in mice
than KatG-SL8 by ICS and ELISpot analysis. Incorporation of a constitutively active prfA
allele (G155S) into the chromosome of the live-attenuated Lm-IglC-SL8 vaccine
increased immunogenicity by 2-fold. Inclusion of a much larger tag (containing an
additional 4 epitopes from vaccinia virus) decreased the immunogenicity of the Lm
vaccine. We also cloned bivalent vaccine strains (in both native prfA and prfAG155S
backgrounds) that express both KatG-SL8 and IglC-fused to a single strong vaccinia
virus epitope (B8R). The amount of intracellular antigen expression was measured using
a semi-quantitative Western blot and was found to be similar to each of the monovalent
strains but there appears to be a slight decrease in the amount of IglC secreted from the
bivalent strains. In the prfAG155S background the difference was less than 2-fold. The
bivalent vaccine strains also induced immune responses in C57BL/6 mice against the
epitope tags that were similar in magnitude to an equivalent dose of monovalent strains
expressing either KatG-SL8 or IglC-B8R; however the bivalent strain with the native prfA
background induced significantly lower B8R-specific responses. Overall, differences
seen between bivalent and monovalent strains appeared to be greater in the native prfA
than in the prfAG155S background. We also compared the primary immune response
after a single vaccination with Live and KBMA Lm-IglC-SL8 and found that KBMA Lm
induced T cell responses that were approximately one fifth the magnitude of liveattenuated. This reduction in potency of KBMA compared to live Lm immunogenicity is
consistent with our previous work with other antigens and it is likely that the potency of
the KBMA vaccine will be improved with a boost vaccination and by the use of the
prfAG155S allele. An initial comparison of Lm and Ft vaccines was performed and
suggested that LVS-pepO-SL8 did not induce a primary T-cell response against SL8 nor
did it boost a response induced by Lm-IglC-SL8.
1) Cloning and characterization of live attenuated bivalent Listeria monocytogenes
(Lm) tularemia vaccine strains. A new expression technology has been employed by
Anza. By using the carboxy-terminal region of ActA (including the transmembrane
domain) we have been able to target antigen expression to the surface of the bacteria
rather than have it secreted. This has two potential advantages: 1) any antigen preexpressed by the bacteria in culture remains associated with the bacteria rather than
being washed away when the vaccines are formulated for injection stocks; 2) the
proximity to the bacterial membrane may increase expression of hydrophobic antigens
that are poorly secreted. In order to determine whether this surface anchoring helps to
increase antigen expression or immunogenicity we have constructed a KatG-surface
anchored expression construct and have put it in the Lm11 and Lm677 background. We
have also cloned bivalent strains that co-express surface anchored-KatG and secreted
IglC to determine the impact this alternative targeting has on the secretion of IglC.
Page 51 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Intracellular antigen expression will be determined using the multiplex Western blot
described previously. A summary of vaccine candidates that have been constructed is
presented in table I below for reference; the new strains are highlighted in red.
Table I
Strain
Lm11
Genetic Background
actAinlB
Antigen Cassette
none
Status
Sequence verified
Notebook, page
Lm583
actAinlBuvrABprfAG155S
none
Sequence verified
Lm677
actAinlBuvrABprfAG155S
none
Sequence verified
BH137
actAinlB
ActAN100-Ova
Sequence verified
BH1222
actAinlB
ActAN100-IglC-SL8
Sequence verified
NB977, p52
BH2282
actAinlB
ActAN100-KatG-SL8
Sequence verified
NB736, p137
BH1228
actAinlBuvrAB
ActAN100-IglC-SL8
Sequence verified
NB977, p52
BH1398
actAinlBuvrAB
ActAN100-KatG-SL8
Sequence verified
NB977, p152
BH2094
actAinlBuvrABprfAG155S
ActAN100-IglC-SL8
Sequence verified
NB899, p11
BH2172
actAinlBuvrABprfAG155S
ActAN100-KatG-SL8
Sequence verified
NB899, p49
BH2098
actAinlB
ActAN100-IglC-VacQuad-SL8
Sequence verified
NB899, p13
BH2100
actAinlBuvrABprfAG155S
ActAN100-IglC-VacQuad-SL8
Sequence verified
NB899, p13
BH2180
actAinlB
ActAN100-IglC-B8R (@ comK)
Sequence verified
NB899, p51
BH2182
actAinlBuvrABprfAG155S
ActAN100-IglC-B8R (@ comK)
Sequence verified
NB899, p51
BH2316
actAinlB
ActAN100-IglC-B8R (@ comK)
ActAN100-KatG-SL8 (@tRNAarg)
NB899, p56
BH2292
actAinlBuvrABprfAG155S
ActAN100-IglC-B8R (@ comK)
ActAN100-KatG-SL8 (@tRNAarg)
Remade and verified
(BH2184 had point
mutation in KatG)
Sequence verified
BH2562
actAinlB
ActAN100-KatG-Anchored
Not sequenced
NB2008, p62
BH2568
actAinlBuvrABprfAG155S
ActAN100-KatG-Anchored
Not sequenced
NB2008, p62
BH2564
actAinlB
Not sequenced
NB2008, p62
BH2566
actAinlBuvrABprfAG155S
ActAN100-KatG-Anchored
ActAN100-IglC-B8R (@ comK)
ActAN100-KatG-Anchored
ActAN100-IglC-B8R (@ comK)
Not sequenced
NB2008, p62
NB736, p138
2) Lots of Live attenuated and KBMA vaccines produced. In order to facilitate
testing of the monovalent and bivalent strains of Lm at UNM and at Anza, we previously
produced 100mL scale lots of live attenuated BH2172, BH2182, BH2292, and BH2316
and 400mL scale lots of KBMA vaccines. A summary of the available lots is presented in
Table II.
Page 52 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Table II. Lm vaccine lots produced and available for distribution to TVDC team members.
Strain
Antigen cassette
type
Titer (CFU/mL)
Lot#
location
BH2172
Genetic
Background
Lm677
KatG-SL8
Live
CH-FR80-015
Lm677
IglC-B8R
Live
2.41 x 1010
1.96 x 1010
837-15-A
BH2182
837-15-B
CH-FR80-002
BH2292
Lm677
KatG-SL8/IglC-B8R
Live
CH-FR80-002
Lm11
KatG-SL8/IglC-B8R
Live
2.20 x 1010
1.74 x 1010
837-15-C
BH2316
837-15-D
CH-FR80-002
BH2100
Lm677
IglC-VacQuad
KBMA
963-104a
CH-FR80-002
BH2182
Lm677
IglC-B8R
KBMA
9.9 x 109 P/mL
0 cfu/mL
9.7 x 109 P/mL
2002-060A
CH-FR80-002
0 cfu/mL
9.6 x 109 P /mL
2002-060B
CH-FR80-002
2002-070
CH-FR80-042
BH2292
Lm677
KatG-SL8/IglC-B8R
KBMA
BH2172
Lm677
KatG-SL8
KBMA
0 cfu/mL
8.9 x 109 P /mL
0 cfu/mL
4. Significant decisions made or pending


Because the vaccinia virus quadrotope tag significantly decreased the
immunogenicity of the Lm-IglC vaccine, strains with this tag will not be used as
vaccine candidates, but may be used further immunogenicity studies.
Chocolate Agar plates from Hardy Diagnostics will be used for cfu titers of LVS
strains.
5. Problems or concerns and strategies to address


Due to company restructuring, the original PI Justin Skoble has left Anza
Therapeutics. Meredith Leong will be new contact person for Anza service
agreement.
Due to Anza’s move to a new Emeryville location in mid-February, research will
slow as the old lab and animal facility are packed and the new lab and animal
facility is established. There will be a 4-6 week lag in initiation of new animal
studies to account for animal quarantine procedures.
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
65%
9. Work plan for upcoming month



Intracellular antigen expression of surface-anchored KatG monovalent and
bivalent strains will be determined using the multiplex Western blot. Sequence
verification of new strains is also planned.
We will perform MTS assays on the KBMA lots to demonstrate metabolic activity
We will evaluate the immunogenicity of KBMA Lm strains after a prime and boost
vaccination and compare with live-attenuated Lm vaccines.
Page 53 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Milestone 56
Milestone description: Characterize the cellular immune response that correlates
with protection against an LVS Challenge and demonstrate that Cerus strains of
live and KBMA Lm-IglC and Lm-KatG protect against a SchuS4 challenge
Institution: Cerus/Anza
1. Date started: 6/1/2008
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will measure the T cell response to IglC induced by live and
KBMA Lm expressing IglC compared with those elicited by Ftn or LVS vaccination. We
will produce an IglC overlapping peptide library (15aa overlapping by 11aa) to identify
IglC epitopes that are recognized by mouse T cells. We will use the IglC peptide library
for ELISpot and ICS assays to measure the IglC-specific T cell responses induced after
vaccination with live and KBMA Lm-IglC and to compare responses induced by live and
KBMA Ftn and LVS vaccination. We will demonstrate that the mechanism of protection
induced by Lm vaccines is cellular, by depletion of T cell populations and passive transfer
studies. We will demonstrate that strains of live and KBMA Lm-IglC-SL8 and Lm-KatGSL8 protect against a SchuS4 challenge and we will produce lots of KBMA vaccine and
send to UNM for testing in animal models (mice and rats).
Summary of key achievements: We determined that Lm strains expressing IglC can
induce IglC-specific immune responses in five different strains of mice (Balb/c, C57BL/6,
FVB/NJ, C3H/HeJ, and SJL/J). Immune responses were primarily observed to peptides
in IglC pool2 (peptides 26-51). By performing ELISpot assays using individual peptides,
we were able to map the responses to specific regions of the IglC protein. Using ICS and
flow cytometry, we were able to determine which responses were mediated by CD4+ or
CD8+ positive T cells. IglC-specific CD4+ T cell responses were identified in Balb/c,
C3H/HeJ, and FVB/NJ mice. We mapped CD8+ T cell epitopes using 9 mers
overlapping by one amino acid, identifying IglC34-142 (LFIDSLTIA) in Balb/c mice and
IglC137-144 (33-19, IMIDLSNL) in C57BL/6. We demonstrated that Lm vaccines
expressing IglC can provide 100% protective immunity against a 10 LD50 LVS challenge
and Lm expressing KatG provided 40% protection (confirming data generated by the
Horwitz lab at UCLA). A single vaccination with KBMA-IglC induced an IglC response
that was barely distinguishable from background.
1) High stringency challenge to determine whether Lm-IglC, Lm-KatG, or LmIglC/KatG can protect against 100x LD50 LVS challenge. We previously reported that
after 2 vaccinations with Lm-IglC or LM-IglC/KatG strains 100% of mice were protected
against a 10 x IV LD50 challenge. In the current study (P006-08-001) 10 Balb/c mice per
group were vaccinated with Lm-IglC (BH2172), Lm-KatG (2182) and LM-IglC/KatG
bivalent strain (BH2292). The empty Lm platform strain (Lm677) and vehicle alone
(HBSS) were used as negative controls, and 0.1 IV LD50 LVS was used as a positive
control. One month after the boost vaccination, the animals received a 100x IV LD 50 dose
of LVS and survival was monitored (Figure 1). Unfortunately, all the animals succumbed
to this high-dose challenge including the LVS vaccinated positive control group. This
suggests that this challenge dose is too high and lower doses will be used in the future.
Page 54 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Percent survival
Survival after 100x LVS challenge
HBSS
LVS
Lm677
BH2172
BH2182
BH2292
100
90
80
70
60
50
40
30
20
10
0
0
2
4
6
8
10
Time (days post-challenge)
Figure 1. Survival after 100x IV LD50 challenge. 10 Balb/c mice per group were vaccinated IV two times
separated by 1 month. 1 month after the boost vaccination all animals were challenged with 100x IV LD 50
LVS. NB2000, p46-48, 50, 51.
2) Vaccinations for on-going studies.
For study P006-08-003, we have boost vaccinated animals with Lm-IglC strain BH2182
or LVS by the IV route. T cell populations will be depleted and the animals will receive a
lethal 10x IV LD50 LVS challenge dose. The challenge dose will be administered at the
end of February.
For study P009-004, we have vaccinated C57BL/6 mice with either live-attenuated or
KBMA BH2182. Here we will compare the immune responses induced by a single or
homologous prime-boost vaccinations of live and KBMA.
For study P009-006, we have vaccinated Balb/c mice with either live-attenuated or KBMA
BH2182. In this study we will compare the efficacy of a single or two vaccinations of live
and KBMA to protect mice in an LVS challenge model.
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address


MTA has been signed by Anza and distributed to other parties for execution.
100x IV LD50 LVS challenge cannot be used to evaluate vaccine candidates as
LVS itself does not protect against this high of a challenge. Lower stringency
challenge will be used instead.
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
45%
9. Work plan for upcoming month

Primed and boosted Balb/c mice will receive IP injections of antibodies to deplete
T cell populations: -CD4, -CD8, both, or irrelevant antibody prior to lethal LVS
challenge.
Page 55 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel


Continue vaccinations of mice with live and KBMA Lm-IglC to compare immune
responses induced and to determine whether KBMA can protect against a lethal
LVS challenge.
Once MTA is fully executed by UNM/Cerus/LBERI/UCLA, live and KBMA Lm lots
will be sent to UNM for evaluation in SchuS4 challenge model.
Milestone 57
Milestone description: Optimization of KBMA Lm Vaccination Route and Regimen.
Institution: Cerus/Anza
1. Date started: 6/1/2008
2. Date completed: Pending
3. Work performed and progress including data and preliminary conclusions
Summary of objectives: We will compare various routes of administration including IV, IM,
IN, ID and oral. For oral, IN, and ID administration in mice, we will first mutate the inlA
gene of Lm to allow for binding of murine E-cadherin in order to mimic the human
interaction (as described in Wollert et al., Cell, 2007). We will compare the potency of the
M
inlA gain of function mutants to our traditional platform strain. Routes will be ranked by
ability to induce a cellular immune response using ELISpot, ICS, and in vivo cytotoxicity.
We will optimize dosing regimen of most potent and tolerable route. Lm expressing IglC
and/or KatG will be used to evaluate immunogenicity. Optimized route and regimen will
be confirmed by SchuS4 protection studies at UNM.
Summary of Key achievements: We have constructed vaccine candidates that contain
M
the inlA gain of function mutations (Table III). The sequence of the wild-type EGDe inlA
gene (from the Lm strain used in the Wollert manuscript) was synthesized and the inlA
WT
gene in our platform strain was replaced (inlA ) in our live-attenuated and KBMA
platform strains as there are a number of differences in the sequence between the native
sequences between these strains. Two point mutations, S192N and Y369S, were
M
incorporated into the EGDe inlA sequence (inlA ) and inserted into the chromosome of
our live-attenuated and KBMA platform strains. Into these 4 strains the ActAN100-iglCSL8 expression cassette was inserted using the integration vector pINT. Cellular
invasion assays were performed: invasion of CaCo2 cells was dependent on inlA, as a 
M
inlA strain was unable to invade, but we were not able to demonstrate that the inlA gain
wt
of function allele increased invasion compared to inlA (as published by Wollert et.al).
Oral and IV routes of administration were compared: In spleens, SL8 and IglC responses
were 2-3 times lower after oral immunization than with IV administration, but mucosal
responses from intra-epithelial lymphocytes (IELs) were similar after immunization by
M
either route. Mice that were vaccinated orally with the inlA strain had marginally higher
splenic T cell responses and IEL responses that were 3-4 times higher than the isogenic
wt
strain expressing inlA . This preliminary result suggests that there may be a slight
M
increase in immunogenicity when the inlA vaccine strain is administered orally.
Page 56 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
Table III: Strains constructed for murine route of administration studies
Strain
Genetic Background
Antigen Cassette
Status
Notebook,
page
CRS-100
actAinlB
none
Sequence verified
WT
none
Sequence verified
WT
ActAN100-IglC-SL8
Sequence verified
none
Sequence verified
ActAN100-IglC-SL8
Sequence verified
none
Sequence verified
NB899, p. 44
NB899, p. 48
NB899, p.49
NB899, p. 52
NB899, p. 44
NB899, p.48
ActAN100-iglC-SL8
Sequence verified
NB899, p. 44
M
none
Sequence verified
M
ActAN100-iglC-SL8
Sequence verified
NB899, p.48
NB899, p.44
BH2130
actAinlBinlA
BH2164
actAinlBinlA
BH2170
actAinlBinlA
M
BH2194
M
BH2132
actAinlBinlA
actAinlB
BH2166
uvrABprfAG155SinlA
actAinlB
WT
WT
uvrABprfAG155SinlA
BH2134
BH2168
actAinlBuvrABprfAG155SinlA
actAinlBuvrABprfAG155SinlA
1) Route of administration primary immunogenicity study P009-005. In this study,
groups of 5 C57BL/6 mice were vaccinated with Lm-IglC (strain BH2182) by various
6
6
routes of administration. The doses used for each route were: 2x10 cfu IV, 2x10 or
7
8
8
9
1x10 cfu IM, 1x10 cfu SC, 1x10 cfu ID and 1x10 cfu for oral. It was observed that the
animals vaccinated via the ID route had necrosis and scarring at the site of injection
seven days post-vaccination. This may be due to the constitutive expression of certain
virulence determinants in this strain (e.g. LLO) given that similar doses of non-prfA*
strains have been administered to mice ID without any obvious injection site reactions.
Seven days after the vaccination, the animals were euthanized and IglC-specific T cells
were measured in the spleen using the IglC 11-mer peptide pool2, the immunodominant
IglC peptide IglC137-144 (33-19, IMIDLSNL), and LLO190-201 the immunodominant epitope
for listeriolysin O in C57BL/6 mice (Figure 2). As expected, IV vaccination induced the
largest IglC response. Administration via SC, IM, ID and oral routes induced low but
7
measurable IglC responses. Of the alternate (non-IV) routes investigated, 1x10 cfu IM
induced the greatest response. Interestingly, when the LLO responses were quantified,
6
IM vaccination induced responses that were comparable to IV even at 2x10 cfu. This
suggests that IM vaccinations can induce immune responses comparable to those
induced by IV vaccination when high affinity epitopes like LLO-190 are used. These
data, together with data generated with other Lm vaccine strains at Anza suggest that IM
may be the best non-IV route of administration for future studies. The next step that will
be taken to compare the potency of IM and IV vaccinations will be to perform a prime and
boost vaccination and measure the magnitude of the IglC response.
Page 57 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
33-19 responses
600
400
200
Figure 2. ELISpot analysis of primary immune responses induced after alternate routes of administration.
C57BL/6 mice were vaccinated IV, IM, SC, ID and orally with doses indicated. One week after a single
vaccination animals were euthanized and spleens were harvested. IFN- immune responses were
measured by ELISpot using IglC peptide pool 2, the IglC137-144, 33-19 individual peptide, or the LLO190-201
peptide. NB2000, p53-57.
2) High stringency challenge to determine whether Lm-IglC administered by various
routes can protect against 100x LD50 LVS challenge. In order to evaluate which route of
administration is the most effective at conferring protection, 10 Balb/c mice per group were
vaccinated with a 1 month prime-boost regimen with the live attenuated Lm-IglC strain
6
8
9
BH2182. Mice were vaccinated with 2x10 cfu IV or IM, 1x10 cfu SC or ID, and 1x10 orally.
These animals were challenged with 100x IV LD50 dose of LVS and monitored for survival
(Figure 3). As reported above, all animals challenged with high-dose LVS died. Interestingly,
the group vaccinated with 0.1 IV LD50 LVS died 1-2 days sooner than all other groups
including the HBSS negative control group. Vaccination with the same dose of LVS had
previously led to protection against a 10x LD 50. This suggests that 100x LD50 is too high of a
challenge dose and, in future studies, a lower challenge dose will be administered.
Percent survival
Survival after 100x LVS challenge
HBSS
LVS
Lm677
BH2182 iv
BH2182 im
BH2182 sc
BH2182 id
BH2182 oral
100
90
80
70
60
50
40
30
20
10
0
0
2
4
6
8
(1
e9
)
(1
e8
)
or
al
id
(1
e8
)
sc
(1
e7
)
im
(2
e6
)
0
im
IFN- SFC/2e5 splenocytes
unstim
LLO 190
(2
e6
)
(1
e9
)
(1
e8
)
or
al
id
(1
e8
)
e7
)
sc
(2
(1
im
iv
(1
e9
)
al
(1
e8
)
e6
)
0
800
iv
25
or
id
(1
e8
)
e7
)
sc
(1
im
im
(2
e6
)
0
33-19
(2
e6
)
50
unstim
im
IFN- SFC/2e5 splenocytes
350
100
iv
LLO 190 responses
350
unstim 300
iglC p2
200
100
50
(2
e6
)
IFN- SFC/2e5 splenocytes
iglC p2 responses
400
10
Time (days post-challenge)
Figure 3. Survival after 100x IV LD50 challenge. 10 Balb/c mice per group were vaccinated by
indicated routes with Lm-IglC strain BH2182, LVS, or vehicle alone (HBSS) two times separated by 1
month. 1 month after the boost vaccination all animals were challenged with 100x IV LD 50 LVS.
NB2000, p46-48, 50, 51.
Page 58 of 59
Tularemia Vaccine Development Contract: Technical Report
Period: 1/01/2009 to 1/31/2009
Due Date: 2/15/2009 and Prepared by: Rick Lyons, Barbara Griffith, Amanda Dubois, Terry Wu, Mitch
Magee, Kathryn Sykes, Stephen Johnston, Karl Klose, Bernard Arulanandam, Meredith Leong, Dana
Pohlman, Bob Sherwood, Julie Wilder, Julie Hutt, Michelle Valderas, and Trevor Brasel
4. Significant decisions made or pending
None
5. Problems or concerns and strategies to address


The Anza methodology for anesthesia prior to IN administration needs to be
modified.
For future LVS challenge studies 10x IV LD50 will be used as a challenge dose.
6. Deliverables completed
None
7. Quality of performance
Excellent
8. Percentage completed
25%
9. Work plan for upcoming month

It is unlikely that significant route of administration studies will be initiated in February
due to the relocation of the animal facility and loss of personnel.
Page 59 of 59