Tularemia Vaccine Development Contract: Technical Report

Tularemia Vaccine Development Contract: Technical Report

Period: 12/01/2008 to 12/31/2008

Due Date: 1/15/2009 and Prepared by: C. Rick Lyons, Barbara Griffith, Terry Wu, Karl

Klose, Bernard Arulanandam, Kathryn Sykes, Stephen Johnston, Mitch Magee, Dana

Pohlman, Bob Sherwood, Michelle Valderas, Trevor Brasel, Julie Wilder, Julie Hutt,

Justin Skoble

Contract No. HHSN266200500040-C

ADB Contract No. N01-AI-50040

Section I: Purpose and Scope of Effort

The Tularemia Vaccine Development Contract will lead to vaccine candidates, two animal models and cellular assays vital for testing vaccine efficacy.

Sections II and III: Progress and Planning Presented by

Milestone

Active milestones:

2, 4, 5, 7 , 8

,

9

,

11

(

UNM/ LBERI

)

, 12/ 13

(

UNM/ LBERI

)

, 14, 17, 18, 19,

21

(

UNM/ LBERI

)

, 27, 28, 29

(

UNM/ LBERI

)

, 35

( ASU/ UNM)

, 49, 50, 52, 53 , 55, 56, 57

Completed milestones:

1, 3, 25, 26 , 32, 33, 34

( UNM /ASU)

, 16, 39, 40, 43

(UTSA)

,

48, 51

Inactive milestones: 6, 10, 15, 20, 22, 23, 24, 30, 36, 37, 38, 54, 58, 59

Milestones terminated after initiation:

41, 42, 44, 46,

(MSCR will be written)

Milestones terminated before initiated:

43

(Cerus)

, 45, 47

(MSCR will not be written)

Milestone 2

Milestone description: Vaccinations performed on relevant personnel

Institution: UNM / LRRI

1. Date started: 11/01/2005

2. Date completed: In progress

3. Work performed and progress including data and preliminary conclusions a. UNM EOH has performed 28 annual health screenings since 8/26/08 for the LVS vaccinees originally vaccinated through November 2007. b. Three UNM and possibly 6 LBERI scientists will request vaccinations in 2009. c. USAMRIID canceled the 1/27/09 vaccination date.

4. Significant decisions made or pending a. Dr. Lyons received UNM IRB approval to allow blood draws on the vaccinated

LBERI and UNM scientists after their LVS vaccinations. The LVS vaccinated

LBERI and UNM scientists and staff have been offered the opportunity to volunteer to donate bloods for the development of immunoassays, approximately

2 months after receiving the LVS vaccination.

b. USAMRIID resumed offering the LVS vaccine as of October 7, 2008 but will not offer vaccinations to UNM and LBERI until FDA approval is given.

c. UNM (4) and LBERI (33) are vaccinated; UNM and LBERI will offer the LVS vaccinations to 9 more scientists to total up to 46. The CRDA with USAMRIID is valid for 2 years, ending June 2009.

5. Problems or concerns and strategies to address a. Nine scientists could be vaccinated in 2009 if USAMRIID receives FDA approval for the new Tularemia vaccination protocol.

Page 1 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

6. Deliverables completed

A total of 37 participants (33 LBERI and 4 UNM participants) have received the LVS vaccination since 9/11/07.

7. Quality of performance

Excellent

8. Percentage completed

72% of the scientific work is complete

9. Work plan for the next month a. Continue annual health screenings required by USAMRIID and being performed at UNM for the LBERI and UNM LVS vaccinees. b. UNM will be obtaining blood donations from LVS vaccinees for immunoassay development and reimbursing participants $40/ donation. c. UNM will work with 3 UNM and 6 LBERI scientists for the pre-vaccination health screenings required for vaccinations once USAMRIID has FDA approval to offer the LVS vaccinations again.

10. Anticipated travel

None

11. Upcoming Contract Authorization (COA) for subcontractors

None

Milestone 4

Milestone description: Confirmation of aerosol

in vivo

in NHP

Institution: LBERI



3. Work performed and progress including data and preliminary conclusions:

No work was performed during this reporting period.

4. Significant decisions made or pending

None

5. Problems or concerns and strategies to address

None


None


Good



9. Work plan for next month a. Continue working on the Milestone Completion Report. b. Continue reading the histopathology slides from Cohort 3 as they become available.


None


None anticipated

Page 2 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Milestone 5

Milestone description: Small species tested for sensitivity to LVS & generation of immunity against a pulmonary challenge of SCHU S4

Institution: UNM


2. Date completed: pending

3. Work performed and progress including data and preliminary conclusions a. Experiment Ftc75 (Notebook 115, pages 178-179) i. The purpose of this experiment is to compare the histopathology of

BALB/c mice, Fischer 344 rats, and Cynomolgus monkeys with pulmonary SCHU S4 infection ii. In preparing the manuscript describing the Fischer 344 rat model,

Julie Hutt noticed that rats infected intratracheally (i.t.) with SCHU S4 developed a different pulmonary disease than mice infected intranasally with NMFTA1 (biovar A) or by aerosol with strain 33

(biovar A); infected rats developed bronchopneumonia whereas infected mice developed vasculitis. She further indicated that the rat disease is similar to the NHP and human diseases that had been described in the literature. Since these interpretations were based on histological data generated in separate experiments using different bacteria strains, dose and methods of pulmonary infection, we performed a side-by-side comparison of mice, rats, and NHPs challenged with 1000 SCHU S4 by surgical i.t., non-surgical i.t. and bronchoscopy, respectively. iii. Tissues were collected on the following schedule

1. NHP -- 1, 4, and 7 days post challenge

2. Mice -- 1, 2, 3, and 4 days (infected mice did not survive to day 7)

3. Rats -- 1, 2, 3, 4 and 7 days. iv. The sternum and femur are being decalcified b. Experiment Ftc71.1 (Notebook 130 pages 18-21) i. The purpose of this experiment is to determine the effect of LVS vaccination dose on the resistance of vaccinated rats to i.t. SCHU S4 challenge ii. Fischer 344 rats (n = 6) were either left unvaccinated as a negative control or vaccinated s.c. with 10 3 , 10 5 , or 10 7 LVS iii. 47 days after LVS vaccination, the vaccinated rats and control rats were challenged i.t. with 10 4 SCHU. We are monitoring the infected rats for clinical signs of illness and survival. iv. We will report the results in the Feb 2009 tech report.


None


None

Page 3 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

6. Deliverables completed a. Mouse model completed b. Guinea pig model completed c. Rat model completed


NA


91%

9. Work plan for upcoming month a. Complete the histopathological analyses of tissues from mice, rats, and

NHPs infected with SCHU S4 b. Complete the experiment to determine whether the protection induced by

LVS vaccination is dose dependent. Vaccinate a second group of rats with

LVS to repeat this experiment. c. Complete milestone completion reports for the mouse, rat, and guinea pigs


None


None

Milestone 7

Milestone description: SCHU S4 ED50 in primates determined from selection of challenge dosing

Institution: LBERI


2. Date completed: In progress.

3. Work performed and progress including data and preliminary conclusions: a. Wave 2 lone survivor animal 28624 (presented dose of 2-3 cfu) was euthanized on December 2, 2008, 46 days post-challenge. There was no culturable F. tularensis in any tissues other than the TBLN which had 350 cfu/g. The lung and

TBLN were grossly contaminated with at least 3 colony types of bacteria (Figure

1.). Identification of these bacteria will be performed in the near future with a

Biolog Microlog 2 system. This may indicate that prolonged infection with F. tularensis has an immunosuppressive effect on the animal such that opportunistic bacteria may infect the lung tissue.

Page 4 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Figure 1. T0 lung plate from animal 28624. As indicated by the arrows, the lung and TBLN (not shown here) were contaminated with at least 3 different colony types. Electronic file located on

Z:\Agent and Study Specific Data and Miscellaneous Documents\STUDY SPECIFIC

DATA\FY08\FY08-074 (TUL-07)\ED50 Wave 3. b. Wave 3 challenges were performed in November 2008. The animals were presented with 237-444 CFU (target dose 250 CFU) and 621-1150 CFU (target dose 500 CFU). All animals were euthanized between Day 4 and Day 8 post challenge. Hematology was performed on study days 0, 2, 4, and 6.

Hematology data (Figures 2 thru 4) demonstrates an increase in white blood cells by Day 2 followed by a decrease before death or euthanasia; an increase in % neutrophils by Day 2 or Day 4 followed by a decrease before death or euthanasia; and a decrease in % lymphocytes by Day 2 or Day 4 followed by an increase before death or euthanasia. These findings are consistent with response to bacterial infection (increase in total white blood cells and increase in percentage of neutrophils) with host inflammatory reaction (decrease in lymphocytes).

Page 5 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Figure 2. Schu S4 Wave 3 Total White Blood Cells Counts. The data is reported for each individual animal starting at Day 0 through time of death or euthanasia. Normal hematology range was 6.9 to 19 X 10 3 per µL. Electronic file located on Z:\Agent and Study Specific Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY08\FY08-074 (TUL-07)\ED50 Wave

3.

Figure 3. Schu S4 Wave 3 Percentage of Neutrophils in the blood of infected animals. The data is reported for each individual animal starting at Day 0 through time of death or euthanasia.

Normal % neutrophil range was 38 to 80.8. Electronic file located on Z:\Agent and Study Specific

Page 6 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY08\FY08-074 (TUL-07)\ED50

Wave 3.

Figure 4. Schu S4 Wave 3 Percentage of Lymphocytes in the blood of infected animals. The data is reported for each individual animal starting at Day 0 through time of death or euthanasia.

Normal % lymphocyte range was 27.9 to 80.8. Electronic file located on Z:\Agent and Study

Specific Data and Miscellaneous Documents\STUDY SPECIFIC DATA\FY08\FY08-074 (TUL-

07)\ED50 Wave 3. c. Based on the data collected from waves 1 thru 3 the calculated LD50 is 1.27

CFU as determined by Probit analysis.

4. Significant decisions made or pending a. The challenge dose that will be used in the Natural History Study (Milestone 11) and the LVS vaccinated challenges (Milestone 8) is 500 CFU.

5. Problems or concerns and strategies to address a. The lung and TBLN of animal 28624 was grossly contaminated with at least 3 colony types. Currently in the process of identifying these bacteria.


None


Good.


90% of the scientific work is complete.

9. Work plan for next month a. Identify 3 colony types from Wave 2 animal 28624’s lung and TBLN. b. Histopathology for all 3 waves is pending.


None


None anticipated

Page 7 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Milestone 8

Milestone description: LVS vaccination protection of aerosol Schu4 validated in primates

Institution: LBERI


2. Date completed: In progress.

3. Work performed and progress including data and preliminary conclusions a. Prepared the study protocol for the challenge study which will consist of 9 LVS vaccinated animals (3 newly vaccinated via scarification; 3 newly vaccinated via subcutaneous; 3 previously vaccinated in 10/06 via intradermal and subcutaneous) and 3 naïve animals.

4. Significant decisions made or pending a. Based on data fro m Milestone 7 “SCHU S4 ED50 in Primates Determined from

Selection of Challenge Dosing ” the animals will be challenged with 500 CFU.


None


None


Good



9. Work plan for upcoming month a. Pre-screen newly arrived NHPs to assess ability to respond to LVS antigens.

Non-responders will be placed on study as non-vaccinated controls. b. Vaccinate 6 animals with LVS (3 via scarification and 3 via subcutaneous).

These animals have been previously screened and are known to have low IgG anti-LVS titers. c. Perform physical exams on the animals to be placed on study. d. PBMCs will be prepared from 3 NHPs previously vaccinated with LVS in October

2006. This will serve as a pre-challenge baseline evaluation (LVS- and Schu S4specific proliferation and IFNγ secretion will be measured). e. A00868 was previously vaccinated with LVS by subcutaneous route in October

2006. He has behavioral problems that prohibit his entry into the ABSL3 for a

SCHU S4 challenge. This animal will receive LVS via bronchoscopy on 1/8/08.

PBMCs will be collected prior to the bronchoscopy and 12 days post challenge.


None


None anticipated

Milestone 9

Milestone description: Aerosol SOP developed for GLP transition

Institution: LBERI



Page 8 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

3. Work performed and progress including data and preliminary conclusions a. Outlined the plan to prepare and finalize the aerosol SOP which includes a qualification of the standard growth curve and aerosol. The aerosol qualification will be performed on 3 different days by 3 different operators. Approximately 6 sprays will be performed on each day. Based on data collected to date, the qualified range will be within 250 to 1000 CFU. b. Compiling and organizing pre-qualification data.


None


None


None


Good



9. Work plan for upcoming month a. Complete qualification plan for the aerosol and perform the aerosol qualification. b. Based on the results of the qualification modify the draft aerosol SOP. c. Begin work on the Milestone Completion report.


None


None anticipated

Milestone 11

Milestone description: In vivo GLP model efficacy SOPS developed in one small species and primate and efficacy testing of vaccine candidates

Institution: UNM /LBERI



3. Work performed and progress including data and preliminary conclusions

No new work done this month


None


None


None


Good


25%

Page 9 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Work plan for upcoming month 9.

We will start drafting GLP-like SOPs for the Fischer 344 rat model


None


None

Milestone 11

Milestone description: In vivo GLP NHP model efficacy SOP and efficacy testing of vaccine candidates

Institution: LBERI /UNM



3. Work performed and progress including data and preliminary conclusions a. The IACUC protocol for the Natural History Study was prepared and submitted for review. b. The ES&H work review for the Natural History Study was prepared and submitted for review.

4. Significant decisions made or pending a. Based on data from Milestone 7 “SCHU S4 ED50 in Primates Determined from

Selection of Challenge Dosing ” the animals will be challenged with 500 CFU.


None


None


Good



9. Work plan for upcoming month a. The IACUC protocol will be reviewed. b. The ES&H work review will be reviewed. c. Animals will be ordered.


None


None anticipated

Milestone 12/13

Milestone description: Assays for detecting relevant immune responses in animals & humans developed and compared to those in other species.




Page 10 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

3. Work performed and progress including data and preliminary conclusions a. Continued to test the freeze/thaw protocols (Cerus and CTL) for PBMCs in order to find a protocol that results in PBMCs whose response mimics the response of the original fresh PBMCs in the proliferation and IFNγ ELISPOT assay. Over the past month, work was initiated to look at the response of thawed PBMCs from the NHPs which were vaccinated with LVS in October 2008. Day 7 post-LVS vaccination is shown in Figure 5.

350000

300000

250000

200000

Media

LVS hk Hi

LVS ff Hi

SCHUS4 hk Hi

SCHUS4 ff Hi

*

*

150000

100000

50000

0

Figure 5. Response of PBMCs to LVS as measured by proliferation on Day 7 post-LVS vaccination. The * indicates significantly different (p < 0.05) than media by one-way ANOVA.

“None” is the fresh cells that have not been frozen.

Data Storage: Raw Data \\Saturn\Group\Wilder Lab\TVDC\PBMC assay statview\PBMC assay

01062009.svd

; TVDC (5) bound notebook (9247), pp. 23 – 31; 79 – 84.

Preliminary Data Interpretation: Data indicate that neither protocol spares the responsiveness of

PBMCs to LVS. Note, however, that the peak proliferation does not occur until Day 28 post-LVS and thus the proliferation at day 7 in response to LVS ff Hi and SCHU S4 ff Hi may be nonspecific and therefore undesirable in any case. b. Continued to test O-mutant antigens. Based on data reported in the November

2008 report there appeared to be differences in the response to these mutant

Page 11 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble antigens. Protein content of each antigen preparation was tested by BCA to determine if equivalent doses were being delivered to the wells. The analysis showed that most of the antigen preparations were not equivalent and previous results were re-evaluated (Figures 6 thru 7; Table 1).

Antigen Protein

Concentration

(µg/ml)

FF LVS WT 135.98

FF LVS

Mutant

29.46

HK LVS WT 1119.83

HK LVS 1223.57

Mutant

FF Schu S4

WT

149.23

3.41 FF Schu S4

Mutant

HK Schu S4

WT

HK Schu S4

Mutant

1330.84

859.21

Final

Concentration in Assays

(µg/ml)

0.19

0.008

1.9

0.022

0.005

0.0003

0.04

0.072

Fold difference from WT

24

86

17

0.56

Table 1. Protein Concentration of Antigen Preparations as Determined by BCA analysis.

Data Storage: Raw Data \\Saturn\Group\Wilder Lab\Protein Assay; TVDC (5) bound notebook

(9247), pp. 70 - 72.

Page 12 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

160

140

120

100

Media

LVS ff Hi

SCHUS4 ff Hi

LVS ff Mutant Hi

SCHUS4 ff Mutant Hi

80

60

40

20

0

28461 A05403 A06199

Figure 6. IFNγ production in responses to O-mutants in non-LVS vaccinated NHPs. All stimuli were used at 1 x 10 5 /ml and cells were cultured at 1.33 x 10 6 /ml.


01062009.svd

; TVDC (5) bound notebook (9247), pp. 7 - 18.

Data Interpretation: Responses to O-mutants may be decreased only because the antigen concentration is decreased based on the BCA assay .

Page 13 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

400 *

350

300

Media

SCHUS4 hk Hi

SCHUS4 hk Mutant Hi

*

*

250

200

150

100

50

0

*

*

*

*

Figure 7. IFNγ production in response to Schu S4 HK O-mutants. All stimuli were used at 1 x

10 5 /ml and cells were cultured at 1.33 x 10 6 /ml. The * indicates significant difference (p < .05) from the other two stimuli in the group by one-way ANOVA.


01062009.svd

; TVDC (5) bound notebook (9247), pp. 23 – 67.

Preliminary Data Interpretation: Response to HK Schu S4 mutant is varied but often increased and may be due to the 1.75x increase in antigen concentration.


None


Due to the different protein concentrations in the WT and O-mutant antigen preparations, all the stimuli (WT and mutant) need to re-titrated and optimized in both assays.


None


Good



Page 14 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

9. Work plan for upcoming month a. Continue to analyze the results of freeze/thaw protocols. b. Re-titrate the WT and mutant antigens based on protein content.

10 . Anticipated travel

None


None anticipated

Milestone 12/13

Milestone description: Assays for detecting relevant immune responses in animals & humans developed and Compare assays in animal models (sensitivity)


1. Date started: 7/15/06 (MS12) and 12/06 (MS13)

2. Date completed: Pending


No new work done this period


None


None




Mouse proliferation assay, IFN



and IL-2 Elispot, antiFt antibody titration

Rat IFN



Elispot, antiFt antibody titration

Guinea pig antiFt antibody titration




NA


63%

9. Work plan for upcoming month

Start work on milestone completion report


None


None

Milestone 14

Milestone description: Assays in vaccinated humans validated (sensitivity)

Institution: UNM


2. Date completed: in progress


No new work done this period


Page 15 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

None


NA


NA


NA


5%

9. Work plan for upcoming month a. Test the Martha’s Vineyard PBMC samples for F. tularensis specific proliferation and IFN



production b. Titer the Martha’s Vineyard serum samples for anti-tuli antibodies


None


None

Milestone 17

Milestone description: In vitro assay for analysis of cellular and humoral elements of the immune response in vaccinated human and anim al’s response to

F. tularensis

established

Institution: UNM



3. Work performed and progress including data and preliminary conclusions a. Experiment Pdose-2 (L:\Lyonslab\Tularemia\Tularemia Contract

Folder\Experiments and Results\Gopi's experiments\Pdose 2) i. The purpose of this experiment was to determine whether the protective effects of immune rat serum can be titrated out. ii. In a previous experiment, Pdose1, we found that as little as 50

 l of immune rat serum protected rats against i.t. challenge of 130 SCHU

S4. Since we have not been able to titrate out the immune serummediated protection, it is possible that protective effect is an artifact of vaccination not associated with antibodies iii. In this experiment, groups of 6 rats were passively immunized with

0.25, 2.5, 25 and 250

 l immune or normal rat serum and 1 day later challenged with 360 SCHUS4. iv. As shown in Fig. 1, little or no protective effect was observed when

25

 l or less of immune serum was used. Thus, we have finally titrated out the protective effect. Moreover, these results together with those from Pdose1 suggest that limit of protection provided by

25-50

 l of immune serum is between 130 and 360 SCHU S4.

Page 16 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

100

75

50

25

0

250ul NRS

250ul IRS

25ul NRS

25ul IRS

100

75

50

25

0

0 7 14 21

Days Postchallenge

28 35 0 7 14 21

Days Postchallenge

28 35

Figure 1. The protective effect of immune serum can be titrated out. Rats (n = 6) were injected i.p. with the indicated volume of immune rat serum and challenged i.t. one day later i.p. with 360 SCHU S4.

 b. Experiment Phist-1 (L:\Lyonslab\Tularemia\Tularemia Contract

Folder\Experiments and Results\Gopi's experiments\phist-1) i. The purpose of this experiment was to compare the histopathology of tissues from passively immunized rats and s.c. LVS vaccinated rats after i.t. SCHU S4 challenge ii. Rats were either vaccinated s.c. with LVS one month before SCHU

S4 challenge or injected i.p. with 150

 l PBS (Naïve), normal rat serum (NRS) or immune rat serum (IRS) one day before SCHU S4 challenge. iii. On the indicated days post i.t. SCHU S4 challenge (Table 1), 3 rats from each group were euthanized to collect the lungs, lung draining lymph node, liver and spleen. iv. The tissues have been trimmed and will be sent out to be sectioned and stained

Table 1. Experimental design to determine the histopathology of passively immunized rats after i.t. SCHU S4 challenge

Group

No.

Treatment Time Points

(Days post challenge)

1

2

3

4

Naïve

NRS

IRS

Vaccinated

1, 3, 5, 7

1, 3, 5, 7

1, 3, 5, 7, 10, 14, 21

1, 3, 5, 7, 10, 14, 21


NA


NA


NA

2.5ul NRS

2.5ul IRS

0.25ul NRS

0.25ul IRS

Page 17 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


NA


23%

9. Work plan for upcoming month a. Continue histopathological analyses of tissues from actively and passively immunized rats after i.t. SCHU S4 challenge b. Purify IgG from immune and normal rat serum in order to demonstrate that the protection is mediated by antibodies and not other serum components c. Repeat experiment to examine SCHU S4 growth kinetics in actively and passively immunized rats. d. Determine whether CD4 and/or CD8 T cells are necessary for passive immunization e. Determine whether immune mouse serum (Experiment Pmouse1) and human convalescent sera from Martha’s vineyard protects rats against i.t.

SCHU S4 challenge


None


None

Milestone 18

Milestone description: Role of specific



T cells in protection

Institution: UNM




We have received the ascites fluid for depleting rats of CD4 T cells


NA


NA


NA


Needs improvement


5%

9. Work plan for upcoming month a. Confirm that the ascites fluid is effective for depleting CD4 T cells in vivo b. Optimize the treatment regimen for depleting CD4 T cells c. Determine the role of CD4 and CD8 T cells in LVS vaccinated rats. We will vaccinate the rats this month. Next month, we will deplete the vaccinated rats of CD4 and/or CD8 T cells before challenging them i.t. with SCHU S4


NA

Page 18 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


None

Milestone 19

Milestone description: Interaction between human alveolar macrophages and

F. tularensis

Institution: UNM




No new results to report for this period because no collection of human alveolar macrophage donor cells was scheduled in December.


NA


Many of the human alveolar macrophage samples we have received have been contaminated. We are going to add 100 units/ml polymyxin B, 100 units/ml penicillin

G, and amphotericin B to try to control the contamination problem


NA


Needs improvement


17%

9. Work plan for upcoming month a. Analyze cytokine production by human alveolar macrophages cultured in non-tissue culture treated tubes and on tissue culture treated plates. b. Determine the effect of recombinant IFN



on intracellular growth of SCHU S4 and LVS.


NA


None

Milestone 21

Milestone description: Correlates of protection: in vitro assay or other readout of effector function of Ft developed for multiple species.




3. Work performed and progress including data and preliminary conclusions a. No work was performed during this reporting period.

Page 19 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


None


None


None


Good




Repeat the ICCS assay and include a positive mitogen control (Con A). PBMCs from the newly LVS-vaccinated NHPs will be used in the assay.

10 . Anticipated travel

None


None anticipated

Milestone 21

Milestone description: T cell-induced macrophage killing of intracellular bacteria

Institution: UNM/ LBERI



3. Work performed and progress including data and preliminary conclusions a. Experiment KL2 (Notebook 133 pages 8-12) i. The purpose of this experiment was to determine whether bioluminescence can be used to reduce the time required to complete the macrophage killing assay. One of the most time consuming steps in the macrophage killing assay is quantifying the bacterial load in the macrophage-T cell culture because F. tularensis requires at least 4 to 5 days to produce visible colonies on cystine heart agar plates. Development of a bioluminescent detection for

F.tularensis infection and killing could reduce assay time by days. ii. The lux operon is commonly found in bioluminescent marine bacteria such as Vibrio fisheri. This operon encodes for a fatty acid reductase complex that catalyzes the conversion of long chain fatty acids into fatty aldehydes which are then used by the luciferase, also encoded in this operon, as a substrate to produce light. Since the synthesis of the fatty aldehyde is ATP- and NADPH- dependent, light emission is directly associated with bacterial viability. iii. Since light emission from the bacteria can be measured in the culture wells immediately after the culture period without plating on cystine heart agar plates, we can conceivably shorten the assay time by 4 to 5 days compared to the plating method. Thus, we asked Karl

Klose at UTSA to produce a lux-operon expressing LVS.

Page 20 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble iv. Karl used the lux operon from Photorhabdus luminescens v. To determine the minimum number of LVS/lux operon required for detectable light emission, we measured the light emission by increasing numbers of bacteria vi. As shown in Fig. 2, 2 x 10 6 LVS/lux operon was required to produce a detectable amount of light. vii. This may limit the usefulness of the lux operon as a reporter system for the macrophage assay because our past experience suggest that this is or close to the maximum number of bacteria that can be supported by the macrophage culture. Moreover, we have observed cytopathic effects on the macrophage culture at this point.

Nevertheless, we may be able to optimize this reporter system, for example by measuring light emission for a longer period of time or by using a higher expression promoter viii. The lux operon may be useful for tracking the bacteria in vivo because this level of bacterial burden is achieved very rapidly after infection of naïve rats.

KKF337

1.0

 10 6

1.0

 10 5

1.0

 10 4

1.0

 10 3

1.0

 10 2

1.0

 10 1

P

B

S

4

2x

10

5

2x

10

6

2x

10

7

2x

10

8

2x

10

9

2x

10

LVS (CFU/well)

Figure 2. Titration of LVS/lux operon to determine the limit of detection. 10-fold serial dilution of LVS/lux operon were made in 200

 l of PBS and luminescence was measured for 0.1 sec in a luminometer.


None


NA


NA

Page 21 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


Good


52 %

9. Work plan for upcoming month a. Continue to optimize culture and infection conditions for rat BMM b. Determine whether the rat cytotoxic activity in BMM can be activated with recombinant IFN γ c. Determine whether rat monocytes can be infected with SCHU S4 and activated by IFN

 d. Evaluate the usefulness of LVS/lux operon e. Repeat SCHU S4 infection of human monocytes f. Determine whether infected human monocytes can be activated to control intracellular bacterial growth with recombinant IFN



and immune T cells


None


None

Milestone 27

Milestone description: Optimization of T cell assays and endpoints in mice. UNM will use ASU’s protein fragments in lymph node proliferation assays to define vaccine candidates

Institution: UNM


2. Date completed: 12/31/08


We have completed this milestone.


None


None




NA


Good


100%


Complete milestone completion report


NA


NA

Page 22 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Milestone 28

Milestone description: Generation of polypeptide libraries (Optimize IVT proteinfragment production, Develop IVT protocol for high-throughput production, Validate immunogenicity of protein-fragments, Full scale production of protein-fragment library,

Purification of protein-fragment library, Array protein-fragment into overlapping pools,

Ship to UNM)

Milestone description: Build SCHU4 proteome



Build ORF expression library corresponding to proteome (complete)



Generate complete protein-fragment library (active)



Array protein-fragments into measurable pools for T cell stimulation

(inactive)

Institution:

ASU-Sykes

1. Date started: 03-01-2007



B. Build ORF expression library corresponding to proteome

All 2,229 linear expression elements were successfully assembled last month

C. Generate polypeptide library

1. The remaining 1,007 FTU proteins were translated and Proteins bound on bead are purified and sufficient for T-cell assay.

2. We have successfully synthesized 2,229 FTU proteins in vitro.

The library is complete.

3. Data locations:

1. Egel of DNA templates: R:\GeneVac\FTU\Contract\Proteome\FTU IVT

Data\FTU gels\FTU HTP IVT DNA gels\HTP Egel AMP

2. DNA LEE quantification: R:\GeneVac\FTU\Contract\Proteome\FTU

IVT Data\FTU Amplified LEE DNA quantification\FTU HTP DNA quantification\FTU proteomic library

3. Autoradiographs of QC plates:

R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU gels\FTU HTP

IVT 35S gels\F tularensis proteomic library

4. Protein concentration determination:R:\GeneVac\FTU\Contract\Proteome\FTU IVT Data\FTU proteomic library\TCA CPM to ug

D. Array polypeptide library

1. One of the half-sets of IVT reactions were arrayed into pools comprised of 7 polypeptides each.

Data location: R:\GeneVac\FTU\Contract\Proteome\Tien's data\pooling plate arrangement

2. These pools were shipped overnight to UNM on dry ice 1/5/09 and

Page 23 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble arrived on 1/6/09 at UNM.

3. The remaining half set of IVT reactions is stored at ASU for future experiments

4. Significant decisions made or pending.

None


None


IVT library of FTU polypeptides completed and delivered to Terry Wu/Rick Lyons on

1/6/09


Excellent


100%


Interact with Terry with regard to his T cell assays of the polypeptide library.


None


None

Milestone 29

Milestone description: Analysis of T cells from lymph nodes & T cell epitopes

Institution: UNM/ LBERI



3. Work performed and progress including data and preliminary conclusions a. Maintenance of 2 subcutaneously LVS-vaccinated NHPs (date of vaccination was 10/16/08) was transferred from Milestone 8 to Milestone 29 . b. The IACUC protocol was amended to allow for LVS bronchoscopy for the future

LVS boost for these 2 NHPs.


None


None


None


Good



9. Work plan for upcoming month a. LVS bronchoscopy will be scheduled by Julie Hutt for late January or early

February and will be coordinated with Terry Wu at UNM.

Page 24 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

10

.

Anticipated travel

None

11 . Upcoming Contract Authorization (COA) for subcontractors

None anticipated

Milestone 29

Milestone description: Analysis of T cells from NHP lymph nodes and T cell epitopes




3. Work performed and progress including data and preliminary conclusions a. Two NHP were vaccinated s.c. with LVS in October 2008 b. We received the pooled polypeptide library from ASU on 1/6/09 c. We ordered materials and reagents needed for perform the IFN



ELIspot assay d. We are coordinating with Dr. Julie Hutt to boost the 2 LVS vaccinated NHP one at a time with 10 5 LVS and then collecting the TBLN and spleen 10 days later for the IFN



ELIspot and ELISA. UNM hopes to schedule the boost in late January 2009.


None


None




NA


Good


3%

9. Work plan for upcoming month a. Boost the LVS vaccinated NHP before harvesting the organs b. Test peptides from ASU with lymph node cells and spleens from LVS vaccinated NHP. Detect immune responses by ELISpot assay


NA


NA

Milestone 35 - UNM

Milestone description: Array hybridization with mouse RNA from virulent SCHU S4 infection and RT PCR confirmation of candidates

Institution: UNM/ ASU-Johnston


Page 25 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble



No new work performed since ASU made no request for RNA samples


None


None


None


Good


25%


None


None


None

Milestone 35

Milestone description:

Array hybridizations with mouse RNAs from virulent

Schu 4 infection & RT PCR confirmation of candidates.

Institution: UNM/

ASU-Johnston






Previous Results: We identified the problem with inconsistent LAPT amplifications which was due to problems with the template switch primer. The primer was resynthesized and testing with reconsititution samples revealed that the amplifications were reproducible.



We performed the LAPT process for the recently received time course experiment in rats and the second mouse time course samples. In both LAPT amplifications we obtained expected yields of total RNA (Table 1). The samples tested were from uninfected animals (time 0) and at 1, 3, 5, 7, and 24 hours post infection with virulent

SCHU S4 bacteria. The overall yields ranged from 42 to 114 micrograms which is consistent with previous amplifications. When we have had problems with the LAPT process the yields are less than 10 micrograms. These results confirm that the LAPT amplification problems have been resolved.

Page 26 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Total

 g yield from LAPT

Hour Post Challenge Mouse Time Course 2 Rat Time Course

3

5

0

1

106

90

112

112

61

75

113

61

7 42 55

24 114 61

Table 1. RNA yield from LAPT processing of mouse time course 2 and the rat time course samples.

Notebook/File locations … ASU: Notebook 804, LAPT 30 page 193



Ten microgram aliquots of each of the RNA samples were processed for Fairplay fluorescent labeling and all samples labeled well with greater than 20 picomoles per microliter of final label mix. The minimum acceptable labeling is 10 picomoles. To date only the Rat Time course samples have been processed for hybridization and data analysis. Despite good labeling efficiency the slides that were analyzed had low overall intensity values. The median sample fluorescent values were around 350 compared to over 3,000 to other comparable samples previously run. The slides used for the hybridization were printed in July 2008. While we have previously performed hybridizations with slides greater than 6 months old and obtained reliable data, we believe that the low fluorescent values in this experiment are a result from the age of the slides. Nonetheless, we performed some initial data analyses on this data set to evaluate the trends in normalized signal intensities (shown in Figure 1).

Two pattern-mapped responses are shown and 100 genes identified that mapped the pattern. The green pattern map was selected for low signal intensity at time 0

(uninfected) and then increasing over time to higher signal intensity at 24 hours. The orange pattern map reflects low signal intensity at time 0 (uninfected) with high signal intensity at 1 hour and then decreasing over time to low levels at 24 hours. With the caveat that these signal intensities were in general low, we compared this data set to the previous first mouse time course to compare the 100 genes increasing over time and decreasing over time. The overlap was minimal with only 14 genes mapping between experiments for increasing over time and only 7 for the decreasing over time pattern.

Page 27 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Figure 1. Normalized signal intensity of rat time course LAPT amplified RNA.

Notebook/File locations … R:\GeneVac\FTU\Contract\Microarray\Milestones\35\LAPT-29LPCM

(082008 UNM samples)\123008lp\LAPT29 – time course Rat.ppt




Will reprint the Ft probes on a new set of microarray slides.




Hybridization signals on the LAPT-amplified RNA was low on the latest microarrays.

We hypothesize that the signal problems were due to the age of the slides resulting in probe degradation. We will perform a new print run with verification hybridization efficiency with non-amplified SCHU S4 RNA


None


Good


69%




Perform a new print run for microarray substrates and verify hybridization efficiency with unamplified SCHU S4 RNA.



Since we have remaining labeled samples we will only need to simply perform the hybridizations of the labeled LAPT samples with the new slides.



We will perform a dilution series with the 24 hour sample, containing over 80K bacteria for empirical determination of the detection limits in the qPCR using the

MutS and iglC genes.

Page 28 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


None


None

Milestone 49

Milestone description: Construct single mutants in

F. tularensis

subsp.

tularensis

(SCHU S4) (iglC, pdpD, iglD, iglA, iglB)

49.1: Construct

iglC F. tularensis

subsp.

tularensis

(SCHU S4)

49.2

:

Construct

pdpD F. tularensis

subsp.

tularensis

(SCHU S4), Construct

iglD F. tularensis

subsp.

tularensis

(SCHU S4)

49.3

:

Construct

iglA F. tularensis

subsp.

tularensis

(SCHU S4), Construct

iglB F. tularensis

subsp.

tularensis

(SCHU S4)

Institution: UTSA

1. Date started: April 1, 2006



In order to generate mutants in SCHU S4 we need to develop tools to generate successful deletions. Therefore, our focus is two fold, one is cloning experiments to get our target deletions into vectors that we can use in creating these deletions and experiments with SCHU S4 itself using constructs that we believe will allow us to make deletions into SCHU S4.

I. Cloning: a. The NadM pl asmid’s sequencing results indicated that this construct is correct therefore, we assigned KEK1230 to identify this NadM construct. Frozen stocks were prepared and these were stored at – 80 C. Data located in TVD UTSA Notebook 7, page

59, 60.

II. Experiments to generate mutants in Schu4: a. The newly verified plasmid KEK1230 (1230), the NadM tulatron plasmid, was used in a cryotransformation experiment with KKT1 Schu S4 β lac2 mutant. This KKT1 strain was plated on TSA +++ plates to grow overnight at 37°C. After 15 to 18 hours this grown strain was scrapped from the plate with a sterile inoculating loop and suspended in 0.2M

Rubidium chloride to an O.D. 600 of 35 and 60 ul of this cell suspension was aliquoted into three microcentrifuge tubes, respectively. One of these tubes was used as a negative control where no plasmid was added to these cells. The other two tubes were use for experiment where 2.5 ug of KEK1230 plasmid was added and mixed well.

Followed the standard cryotransformation protocol (TVD UTSA Notebook 5, page 4).

Data located in TVD UTSA Notebook 7, page 61. b. There were various TSA +++ 60ug/ml kanamycin plates prepared from the cryotransformation experiment which were placed a 30°C and followed for growth for five days. The negative controls being the KKT1 cells with no plasmid added were also followed and there was no cell growth on this TSA+++ kanamycin after five days.

However, the viability control, where these cells were placed on a non-select plate (i.e.

TSA+++) did show a lawn of cells; which indicates the cells survived the cryotransformation manipulations. The experimental plates (3) where the KKT1 + 1230 was plated did show growth.

Page 29 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble c. Patched 40 individual clones from the original KKT1+1230 cryotransformation plates onto T SA+++ 60 ug/ml kanamycin plates and placed at 30°C overnight. A few (22) of these clones were then used to isolate small amount of genomic DNA to use to screen for the present of the NadM intron (1230). These genomic isolates were then subsequently used as the template with NadM specific oligos in a PCR experiment

(Figure 1). The oligos used were as follows: nadMNcoI: 5’- cgcgcgccatgggcatgtatgatatttcagtttttataggaagatttcag -3’ nadMEcoR1: 5’- cggaattcttatagtttcttaccacattcctctaataaaatc -3”

Figure 1.

1 Kb

2.0

0.5

1 2 3 15 16 17 18 19 20 21 22 23 24 14

¤ ¤ ¤ ¤ ¤

Legend

1. 1 Kb Ladder 13. N8

2. KEK1230 14. Uncut KKT1

3. KKT1 15. N9

4. N1-1 16. N10

5. N1-2 17. N11

6. N1 18. N12

7. N2 19. N13

8. N3 20. N14

9. N4 21. N15

10. N5 22. N16

11. N6 23. N17

12. N7 24. N18

¤ ¤ ¤ ¤ ¤ ¤

1.5

0.5

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Figure 1 represents a PCR using various potential SchuS4 (KKT1) NadM mutants generated from a cryotransformation. The oligos used in this PCR were nadM-NcoI and nadM-EcoR1 which target the 5’ and 3’ ends of the NadM gene, respectively. The correct NadM mutant should yield a ≈1900 bp product only. The KKT1 is used as the wild-type control yielding

≈1100 bp fragment with this oligo set (lane 3). Lanes 4-24 are the potential S4 NadM mutants none of which yielded only the mutant band. However, there is an indication of the correct band present (it is very weak) but the wild-type band is also seen. This indicates a mixed population where only some bacteria have the NadM intron inserted in the chromosome. The clone marked with ¤ on the photo are selected clones that were subsequently used in another PCR experiment using an internal NadM oligo with an outside

NadM. Data located in TVD UTSA Notebook 7, page 64. d. Clones N1-2, N1, N2, N3, N4, N7, N8, N9, N10, N11, N15, and N17 genomic isolates were used for further screening to insure that those clones yielding a ≈1900 bp band in the previous screen do in fact have the NadM intron inserted at the correct location in the chromosome. Therefore, an oligo set which includes a primer which will anneal to the

Page 30 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble internal portion of the intron will be used; in this case the EBS Universal oligo described in an earlier report and this is paired with the forward NadM directed primer, nadM-Nco I

(Figure 2).

Figure 2.

1 Kb

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Legend

1. 1 Kb Ladder 8. N7

2. 1230

3. KKT1

4. N1

5. N1-2

6. N3

7. N4

9. N8

10. N9

11. N10

12.

N11

13. N15

14. N17

2.0

1.0

0.5

Figure 2 represents mostly S4 NadM potential mutants where the genomic isolates were used as template with oligos which are directed to the NadM intron (EBS Universal) and another directed to 5’-end of the NadM gene (nadM-NcoI). The correct band should be ≈900 bp size and the KKT1 (lane 3) and the plasmid 1230 (lane 2) will not yield a product. Lanes

4 thru 14 are potential S4 NadM mutants which do have the NadM intron inserted at the correct location in the chromosome. Data located in TVD UTSA Notebook 7, page 65. e. Since the eleven chosen original clones from figure 2 indicated an NadM intron insertions we will take a few to passage to try and generate a complete S4 NadM mutant (i.e. a population where only th e ≈1900 bp PCR product is found when the forward and reverse NadM primers are used, and less wild type band will be detectable). We will begin by streaking for single colonies on a TSA+++ 60ug/ml kanamycin plates which will be grown and 30°C. Isolated clones from this passage will be screen by PCR to search for the correct ≈1900 bp band. Typically, the passaging of these clones will initially still yield some wild type band (≈1100 bp); the best candidates to further in passaging will be those were the two bands will become more even in intensity.


None


None

6.

Deliverables completed a. KKF5: igLC1 IgLC2 Schuh4; KKF10: IgLD1 igLD2 Schuh4; and KKF13: VgrG1 VgrG2

Schuh4 mutants are the completed Schuh4 strains. (The plasmid NadM (pKEK1230) is a tool used to make a Schuh4 strain, not a deliverable.)


Good


84%

Page 31 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

9. Work plan for upcoming month a. Need to run the Southern blot to verify expected VgrG intron location on the genome.

(Although sequence analysis showed the VgrG mutant is correct.) b. Will continue with the screening of the NadM mutant which will require cycling of various clones to facilitate the effective insertion of the NadM intron into the SchuS4 chromosome.


None


None

Milestone 50

Milestone description: Phenotyping and confirmation of single gene mutants;

50.1: phenotyping and immunologic characterization of Ft subsp.

novicida uvrA or uvrB

;

LVS

uvrA or uvrB

, and Ft subsp.

tularensis

(SCHU S4)

iglC

strains,

50.2: phenotyping and immunologic characterization of

Ft

subsp.

tularensis

(SCHU S4)

pdpD, iglD

strains, Ft subsp.

novicida uvrA or uvrB

plus

pdpD/iglA/iglB/iglC/iglD

double mutant strains,

50.3: phenotyping and immunologic characterization of Ft subsp.

tularensis

(SCHU S4)

iglA, iglB

strains

Institution: UTSA


2. Date completed: provide date when milestone is completed


50A-a: (1) Intramacrophage growth of KKT13, a SCHU S4 vgrG mutant (Note book #

9, page 15-16). Murine macrophage cell line (J774) were seeded in a 96-well plate

(2x10 5 /200 μl/well) overnight and infected with the vgrG mutant (designated KKT13) or its parental strain (SCHU S4) using an infection dose of 10 or 100 MOI. Numbers of viable bacteria in macrophages were measured at 3 hr and 24 hr post-infection. As expected, the wild type SCHU S4 replicated rapidly inside macrophages within a day using MOI of 10 or 100. However, minimal growth of KKT13 was observed (either

10or 100 MOI) during the same incubation time, indicating high degree of attenuation.

Page 32 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

6

5

4

8

7

3h

24h

3

2

1

10 MOI 100 MOI

SCHU S4

10 MOI 100 MOI

KKT13

Fig. 1. Intramacrophage growth of SCHU S4 vgrG mutant (KKT13). Murine macrophage cell line (J774) were infected with KKT13 or its parental strain

(SCHU S4) using an inoculum of 10 or 100 MOI. Numbers of viable bacteria in macrophages were measured at 3hr and 24 hrs post-infection.

50A-b Evaluate the protective efficacy of oral KKT13 vaccination against SCHU S4 intranasal challenge. (Note book #9, page 17-18). C57BL/6 mice were given orally a single dose of KKT13 (10 3 CFU), rested for 30 days, and challenged intranasally with either 30 or 150 CFU of SCHU S4. All KKT13- and PBS/mock- vaccinated mice succumbed to SCHU S4 challenge by day 7. Oral immunization with KKT13 under this immunization regiment did not protect mice from lethal SCHU S4 challenge.

Page 33 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

100

80

60

40

Mock 30 CFU

Mock 150 CFU

KKT13 30 CFU

KKT13 150 CFU

20

0

0 1 2 3 4

Days after challenge

5 6 7

Fig. 2. Protective efficacy of KKT13 ( vgrG mutant of SCHU S4) immunization against F. tularensis infection. C57BL/6 mice (10 per group) were orally immunized with 10 3 CFU of KKT13 or PBS as a mock control and i.n.

challenged with lethal dose of F. tularensis SCHU S4 strain (30 or

150 CFU). Mice were monitored for survival.


None


None


None


Good


90% of scientific work completed on milestone 50A (original plans)


50A.

(1) Measure humoral responses after KKT13 ( vgrG mutant of SCHU S4) oral immunization.

10. Anticipated Travel

None


None

Page 34 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Milestone 52

Milestone description: Create

RecA

mutants in F. tularensis subsp. tularensis(Schu

S4)

Institution: UTSA

1. Date started : 9/15/2007



3.1 Evaluation of Attenuation and Protective Efficiency of Transposon Mutants NR5330 and

NR7241

NR5330 (FTN0720) and NR7241 (FTN0757) are the F.novicida transposon mutants provided by the University of Washington. The gene FTN0720 functions as transcriptional regulator, and FTN0757 is known as the “membrane protein of unknown function”.

NR5330 was mu tated by insertion of the transposon “<Kan-2>” at 193bp in FTN0720, whereas NR7241 was created by insertion of the transposon “T20” at 1339bp in

FTN0757.

Our goal in this study is to evaluate the attenuation of those mutants in Balb/C mice and subsequently protective efficiency of the mutants against wild type F.novicida challenge. Then we can decide the valuation of making and studying the mutation in the same gene in Schu S4 background.

3.1.1 In the last monthly report, it was reported that the surviving mice vaccinated with the transposon mutants NR5330 and NR7241 were challenged with wild type U112 (242

CFU) intranasally to evaluate the protective efficiency of the mutant against wt U112.

33 days after being challenged with wt U112, all of the mice from both NR5330 and

NR7241 groups were fine and never looked sick, but the mice from PBS group died after 5 days post inoculation. The graph describing the mice survival rate is shown below. This data indicates that both mutants provide protective efficacy from WT

U112 intranasal challenge.

Graph1: Mice Survival Rate 33 days after challenge with wild type U112.

1 0 0

8 0

6 0

4 0

2 0

0

M i c e s urv i v al rate after c hal l enged wi th Wt U 112

Va c c i n a t e d NR5 3 3 0 I . N

Va c c i n a t e d NR 7 2 4 1 I . N

Va c c i n a t e d PBS I . N

1 2 3 4 5 6 1 2 1 8 2 4 3 3

Page 35 of 47

Da y s a fter c h a l l e ng e d wi th Wt U1 1 2 ( 2 4 2 CFU/m o u s e )


Period: 12/01/2008 to 12/31/2008




Justin Skoble

Graph1 legend, results and data location: From the data shown above, it was obvious that Balb/C mice were protected by the transposon mutant NR5330 or NR7241 against wild type U112 intranasal challenge. Data recorded on UTSA TVDC notebook #6, page59 for Graph1.

3.2 Creation of RecA and IglC double mutant in F. tularensis tularensis (SCHU S4).

This part of Milestone 52 is to create recA and IglC double mutant in F. tularensis tularensis. Inactivating the recA gene will stabilize the strain and prevent the strain from any additional genetic changes. We already have the IglC mutant of Schu S4, and the tulatron vector pKEK1186 for disturbing and inactivating the recA gene in Francisella tularensis.

3.2.1 Cryotransformation of the tulatron vector pKEK1186 (to inactivate the Rec A gene) into KKT5 (IglC mutant Schu S4). The parent strain KKT5 was recovered on TSA++ agar plate from the frozen stock and incubated at 37



C for 2-3 days. The day before the transformation, KKT5 was inoculated on the fresh TSA++ agar plate from the recovery plate above and incubated at 37



C for overnight. KKT5 was scraped off from overnight culture with the disposable loop, and resuspended in 500ul of 0.2M RbCl

(Rubidium Chloride). Then the cells/Rbcl suspension was centrifuged for 2 minutes at

12000 rpm. This wash procedure was repeated for 2 more times, and the final pellet was resuspended with 50ul 0.2M RbCl. 10ul pKEK1186 plasmid DNA and 25ul transformation buffer were added into 25ul of the cells/RbCl suspension and mixed gently. The mixture was incubated at room temperature for 10 minutes before it was frozen in liquid nitrogen for 5 minutes. Then the mixture was thawed at room temperature for 5 minutes, and added onto a sterile 0.2 micron filter sitting on a TSA++ plate. The transformed cells were incubated at 30



C for about 4 hours, and the cell mixture was resuspended in 500ul 0.2M RbCl and spread onto TSA++/Kanamycin

(50ug/ml) agar plate to select the transformants at 30



C incubation for about 4-6 days.

3.2.2 From this cryotransformation, about 12 transformants were obtained. How will these be verified for inactivation of the Rec A gene?

Data recorded on UTSA TVDC notebook #6, page58, 60.


None

5.

Problems or concerns and strategies to address

None


None


Good

8. Percentage completed .

About 46% of scientific work completed.




Screen the Rec A iglC SCHU S4 transformants using colony PCR.



Separate the Rec A iglC SCHU S4 mutants from the parent strain.



Sequence the PCR product from the Rec A iglC SCHU S4 mutant strain to verify the insertion in RecA of KKT5.

Page 36 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


None

11. Upcoming Contract Authorization (COA) subcontractors

None

Milestone 53B

Milestone description: Examining the protective efficacy of LVS and two attenuated

SCHU S4 mutant strains via oral vs. intradermal inoculations in the rat model;

53.1: replication of LVS, Schuh4, iglC Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49 in rat macrophages.

53.2: protective efficacy of LVS, iglC Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49 against Schuh4 intratracheal challenge (oral vs. intradermal vaccinations in rats)

53.3: antigen specific cellular and humoral responses of rats following vaccination with LVS, iglC

Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49

53.4: bacterial dissemination and lung pathology of rats following vaccination with LVS, iglC

Schuh4, and one additional attenuated Schuh4 mutant derived in milestone 49

Institution: UTSA


2. Date completed: provide date when milestone is completed


53B-a: (1) Isolation of bone marrow and generation of bone marrow derived macrophages. (Note book # 8, pages 148-149, and 152). Fisher 344 rats were sacrificed and femurs were collected under asceptic conditions. Bone marrow was flushed from femurs and cultured for seven days in conditioned media. Cells were then removed from the flask, stained with mouse anti-rat CDllb-FITC (rat macrophage antibody) and analyzed by flow cytometry to determine purity of macrophages. As seen in figure 1, the number of CDllb positive cells was 95% of the parent population.

This indicates that the culturing conditions are adequate to produce macrophages.

Page 37 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

A B

95%

Fig. 1. Purity of rat bone marrow derived macrophages. Bone marrow was isolated from the femurs of F344 rats and cultured for 7 days to produce macrophages. Cells were then either (A) left unstained or (B) stained with anti-CD11b-FITC antibody and analyzed by flow cytometry.

53B-b Evaluate the phagocytic activity of rat bone marrow derived macrophages compared to mouse bone marrow derived macrophages. (Notebook #10, pages 22-

23) Bone marrow was collected from both F344 rats and BALB/c mice and cultured under optimal conditions for 7 days. Cells were seeded in 6 well plates at a density of

7 X 10 5 cells per well and incubated over night to allow the cells to adhere. Cells were then incubated with fluorescently labeled (FITC) inert micro-beads (1

 m diameter) at either 10 MOI or 100 MOI for 2 hours to allow phagocytosis by macrophages.

Extracellular beads were washed off and cells were collected into 5ml tubes. Cells were then stained with an appropriate anti-CD11b-APC antibody to distinguish the macrophage populations. The cells were then analyzed by flow cytometry. There are several peaks along the FITC axis of the histogram plots which indicate the number of beads which are taken up by the macrophages. By gating on these separate peaks, we are able to determine the percentage of cells which uptake 1, 2 or 3 or more beads per cell. As indicated in figure 2. the rat derived macrophages have great phagocytic activity which is actually greater than that of the mouse derived macrophages.

Page 38 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

F344 Rat BMBM

Macrophages Alone

10 MOI Beads

BALB/c Mouse BMDM

100 MOI Beads

Macrophages Alone 10 MOI Beads 100 MOI Beads

# of Beads 10 MOI 100 MOI

Rat

1

2

3 or more

19.9%

6.1%

2.9%

11.6%

10.1%

65.4%

Mouse

1

2

3 or more

7.6%

2.4%

1.8%

8.6%

3.3%

21.1%

Fig. 2. Phagocytic activity of bone marrow derived macrophages. Bone marrow was isolated from F344 rats and BALB/c mice separately and cultured to produce macrophages. Cells were then incubated with fluorescently labeled micro-beads and analyzed by flow cytometry to assess phagocytic index of macrophages.


None


None

Page 39 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


None


Good


4%


53B.

(1) Perform phagocytosis assay of F. novicida and LVS with F344 rat bone marrow derived macrophages.

10. Anticipated Travel

None


None

Milestone 55

Milestone description: Compare Cellular Immunogenicity of

Francisella

and

Listeria

-

Based Vaccine Platforms. Measure cellular immunogenicity of live-attenuated vaccine platforms. Compare immunogenicity of KBMA tularemia vaccine platforms

Institution: Cerus/Anza


2. Date completed: P ending


Summary of objectives: We will construct and prepare live and Killed But Metabolically

Active (KBMA) Listeria monocytogenes (Lm) vaccines expressing Francisella tularensis

(Ft) antigens. To directly compare the cellular immunogenicity of Lm and Ft-based vaccines, each Lm vaccine candidate will express an antigen fused to a model ovalbumin epitope SIINFEKL (SL8) and these will be compared to Ft vaccines expressing pepO-SL8 fusions (provided by UTSA). We will measure the ability of each vaccine to stimulate a

CD8 T cell response in vitro using a B3Z assay. We will measure the cytokine responses elicited by vaccination with each platform in mice, compare the CD8 T cell response to

SL8 after prime and boost vaccinations in mice using intracellular cytokine staining (ICS) and ELISpot assays and measure the potency of the T cells elicited by use of an in vivo cytotoxicity assay.

Summary of key achievements: We have demonstrated that iglC-SL8 fusion proteins are expressed to a much higher level than katG-SL8 in the cytosol of macrophages and dendritic cells (DCs). Live-attenuated vaccines expressing either fusion protein were able to secrete antigen within DCs and stimulate the B3Z T cell line that responds to the

SL8 peptide. The IglC-SL8 fusion protein induced a stronger immune response in mice than KatG-SL8 by ICS and ELISpot analysis. Incorporation of a constitutively active prfA allele (G155S) into the chromosome of the live-attenuated Lm-IglC-SL8 vaccine increased immunogenicity by 2-fold. Inclusion of a much larger tag (containing an additional 4 epitopes from vaccinia virus) decreased the immunogenicity of the Lm vaccine. We also cloned bivalent vaccine strains (in both native prfA and prfA G155S backgrounds) that express both KatG-SL8 and IglC-fused to a single strong vaccinia virus epitope (B8R). The amount of intracellular antigen expression was measured using a semi-quantitative Western blot and was found to be similar to each of the monovalent strains but there appears to be a slight decrease in the amount of IglC secreted from the bivalent strains. In the prfA G155S background the difference was less than 2-fold. The

Page 40 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble bivalent vaccine strains also induced immune responses in C57BL/6 mice against the epitope tags that were similar in magnitude to an equivalent dose of monovalent strains expressing either KatG-SL8 or Iglc-B8R; however the bivalent strain with the native prfA background induced significantly lower B8R-specific responses. Overall, differences seen between bivalent and monovalent strains appeared to be greater in the native prfA than in the prfA G155S background. We also compared the primary immune response after a single vaccination with Live and KBMA Lm-IglC-SL8 and found that KBMA Lm induced T cell responses that were approximately one fifth the magnitude of liveattenuated. This reduction in potency of KBMA compared to live Lm immunogenicity is consistent with our previous work with other antigens and it is likely that the potency of the KBMA vaccine will be improved with a boost vaccination and by the use of the prfAG155S allele. An initial comparison of Lm and Ft vaccines was performed and suggested that LVS-pepO-SL8 did not induce a primary T-cell response against SL8 nor did it boost a response induced by Lm-iglC-SL8.

1) Cloning and characterization of live attenuated bivalent Listeria monocytogenes

(Lm) tularemia vaccine strains.

A summary of vaccine candidates that have been constructed is presented in table I below for reference. All epitope-tagged expression cassettes have been sequenced verified.

Table I

Strain

LM11

LM583

LM677

BH137

Genetic Background

 actA



inlB

 actA



inlB

Antigen Cassette none

 actA

 inlB



uvrAB none

 actA

 inlB



uvrABprfAG155S none

ActAN100-Ova

BH1222  actA



inlB

BH2282  actA



inlB

BH1228

 actA

 inlB



uvrAB

BH1398

 actA

 inlB



uvrAB

ActAN100-IglC-SL8

ActAN100-KatG-SL8

ActAN100-IglC-SL8


Status

Sequence verified








Notebook, page

NB977, p52

NB736, p137

NB977,p52

NB977, p152

BH2094  actA

 inlB



uvrABprfAG155S ActAN100-IglC-SL8

BH2172  actA

 inlB



uvrABprfAG155S ActAN100-KatG-SL8



BH2098

 actA



inlB ActAN100-IglC-VacQuad-SL8 Sequence verified

BH2100

 actA

 inlB



uvrABprfAG155S ActAN100-IglC-VacQuad-SL8 Sequence verified

NB899, p11

NB899,p49

NB899,p13

NB899, p13

BH2180  actA



inlB ActAN100-IglC-B8R (@ comK) Sequence verified

BH2182  actA

 inlB



uvrABprfAG155S ActAN100-IglC-B8R (@ comK) Sequence verified

BH2316

 actA



inlB ActAN100-IglC-B8R (@ comK)


(@tRNA arg )

BH2292

 actA

 inlB



uvrABprfAG155S ActAN100-IglC-B8R (@ comK)


(@tRNA arg )

Remade and verified

(BH2184 had point mutation in KatG)


NB899, p51

NB899, p51

NB899, p56

NB736, p138

2) Optimization of Semiquantitative Western Blot.

Previously we described the development of a semiquantitative multiplex Western Blot analysis to evaluate the levels of intracellular antigen expression from Lm vaccine strains.

For this assay, DC2.4

mouse dendritic cells are infected in the presence of gentamycin to prevent extracellular bacterial growth. Infected cell monolayers are lysed with detergent and run on 4-12% gradient SDS-PAGE gels, and transferred to nitrocellulose. Expressed antigens are detected by Western blot using rabbit polyclonal anti-ActA antibodies and

Page 41 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble fluorescent secondary antibodies. The fluorescence intensity is quantified using a Li-Cor

Odyssey Infrared Imaging System. In order to quantify the amount of each fusion protein, the blots are also probed with a monoclonal antibody against p60 (a constitutively-expressed Lm protein involved in cell wall remodeling) and an anti-mouse secondary antibody with a different fluorophore. This anti-p60 signal is used to normalize to the number of bacteria in each well by dividing the intensity of ActA signal by the intensity of the p60 signal.

In order to confirm that p60 expression correlates with intracellular CFU and is an appropriate constitutively expressed protein against which to normalize antigen expression, we have performed a time course infection. In this assay monolayers of

DC2.4 cells were infected at a multiplicity of1.5 cfu per cell and harvested in triplicate at various time points at which individual wells were either plated for cfu or analyzed by multiplex Western blot analysis (figure 1). At 0 hours post infection P60 and IglC expression was below limit of detection. Between 2 hours and 9.5 hours post infection, intracellular CFU and p60 expression each increased approximately 10 fold with similar kinetics. IglC expression increased over time and when normalized to p60 had ratios that varied by only about 2 fold. These data demonstrate that p60 expression correlates with cfu and can be used as a way to normalize for cfu when evaluating levels of intracellular antigen expression in a multiplex western blot.

CFU

1.00E+08

1.00E+07

1.00E+06

1.00E+05

0.00

2.00

4.00

6.00

p60

8.00

10.00

Lane

HPI

CFU p60

4 5

2.5

1.47x10

6

6

0.05

8

5.0

1.14e

7

0.70

9 10 11

9.5

1.68x10

7

1.67

10

1 2

0

4.7x10

5

0

3 7

1

0.1

iglC 0 1.09

29.29

33.20

0.01

iglC/p60 0 21.80

41.79

19.88

0.00

2.00

4.00

6.00

Figure 1. DC2.4 cells were infected with BH2180 at an MOI=1.5. Lysates of infected cells were harvested in triplicate at indicated hours post infection (HPI), plated for intracellular CFU and examined for p60 (shown in green) and IglC (red) expression by multiplex western blot. Notebook #NB2006 pp. 91-97.

8.00

10.00

2) Lots of Live attenuated and KBMA vaccines produced. In order to facilitate testing of the monovalent and bivalent strains of Lm at UNM and at Anza, we previously produced 100mL scale lots of live attenuated BH2172, BH2182, BH2292, and BH2316. This month we have produced

400mL scale lots of KBMA vaccines and assayed for viable cfu (Table II). These lots were produced by growing the bacteria in Yeast extract medium to late log phase, the bacteria were concentrated 10 fold by centrifugation and S-59 psoralen was added to a final concentration of

Page 42 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

800nM. The Bacteria were then illuminated with 6J/cm 2 UVA light. The bacteria were washed twice in cryopreservation medium and frozen at-80 o C at an approximate concentration of 1x10 10 particles/mL. After the lots are frozen they are assayed for cfu by plating a minimum of 300uL undiluted and 1:10 diluted on BHI agar plates. The presence of cfu indicates incomplete inactivation. A number of the KBMA lots that were produced failed due to the presence of cfu after photochemical inactivation. These lots were discarded. In retrospective analysis, the formula used for the media preparation for these lots was incorrect (the concentration of yeast extract was too high). This would have made the media darker and potentially absorbed more

UV light which would explain the failure to completely inactivate the bacteria. All subsequent lots produced with the correct formulation of Yeast extract medium produced lots of KBMA vaccine that were completely inactivated. The next step required for the characterization of these vaccine lots is to measure the degree of metabolic activity retained using an MTS assay. In total we have now produced both live and KBMA lots of vaccine that express IglC, KatG or Both.

Table II. Lm vaccine lots produced

Strain

Genetic

Background

BH2172 Lm677

BH2182 LM677

BH2292 Lm677

BH2316 LM11

BH1228 LM583

BH1398 LM583

BH2100 LM677

BH2172 LM677

BH2094 LM677

BH2182 LM677

BH2292 Lm677

Antigen cassette type

KatG-SL8

IglC-B8R

Live

Live

KatG-SL8/IglC-B8R Live

KatG-SL8/IglC-B8R Live

IglC-SL8 KBMA

KatG-SL8

IglC-VacQuad katG-SL8

IglC-SL8

IglC-B8R

KBMA

KBMA

KBMA

KBMA

KBMA

KatG-SL8/IglC-B8R KBMA

Titer (CFU/mL)

2.41 x 10 10

1.96 x 10 10

2.20 x 10 10

1.74 x 10

10

9.4 x 10 9 P/mL

760 cfu/mL

9.7 x 10 9 P/mL

>10000 cfu/mL

9.9 x 10

9

P/mL

0 cfu/mL

1.0 x 10 10 P/mL

3.3 cfu/mL

1 x 10 10 P/mL

3.3 cfu/mL

9.7 x 10 9 P/mL

0 cfu/mL

9.6 x 10 9 P /mL

0 cfu/mL

8.9 x 10 9 P /mL

0 cfu/mL

Lot#

837-15-A

837-15-B

837-15-C

837-15-D

963-095a

963-095b

963-104a

963-104b location

CH-FR80-015

CH-FR80-002

CH-FR80-002

CH-FR80-002

FAILED

FAILED

CH-FR80-002

FAILED

2001-026b FAILED

2002-060A CH-FR80-002

2002-060B CH-FR80-002

BH2172 Lm677 KatG-SL8 KBMA 2002-070 CH-FR80-042




Because the vaccinia virus quadrotope tag significantly decreased the immunogenicity of the Lm-IglC vaccine, strains with this tag will not be used as vaccine candidates, but may be used further immunogenicity studies.



Chocolate Agar plates from Hardy Diagnostics will be used for cfu titers of LVS strains.


None


None


Excellent

Page 43 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble


55%




We will perform MTS assays on the KBMA lots to demonstrate metabolic activity



We will evaluate the immunogenicity of KBMA Lm strains after a prime and boost vaccination and compare with live-attenuated Lm vaccines.



We will repeat dose-response study using prfAG 155S platform


None


None

Milestone 56

Milestone description: Characterize the Cellular Immune Response that Correlates with Protection Against an LVS Challenge and demonstrate that Cerus Strains of

Live and KBMA Lm-IglC and Lm-KatG Protect Against a SchuS4 Challenge



2. Date completed: P ending


Summary of objectives: We will measure the T-cell response to IglC induced by live and

KBMA Lm expressing IglC compared with those elicited by Ftn or LVS vaccination. We will produce an IglC overlapping peptide library (15aa overlapping by 11aa) to identify

IglC epitopes that are recognized by mouse T cells. We will use the IglC peptide library for ELISpot and ICS assays to measure the IglC-specific T cell responses induced after vaccination with live and KBMA Lm-IglC and to compare responses induced by live and

KBMA Ftn and LVS vaccination. We will demonstrate that the mechanism of protection induced by Lm vaccines is cellular, by depletion of T cell populations and passive transfer studies. We will demonstrate that strains of live and KBMA Lm-IglC-SL8 and Lm-KatG-

SL8 protect against a SchuS4 challenge and we will produce lots of KBMA vaccine and send to UNM for testing in animal models (mice and rats).

Summary of key achievements: We determined that Lm strains expressing IglC can induce IglC-specific immune responses in five different strains of mice (Balb/c, C57BL/6,

FVB/NJ, C3H/HeJ, and SJL/J). Immune responses were primarily observed to peptides in IglC pool2 (peptides 26-51). By performing ELISpot assays using individual peptides, we were able to map the responses to specific regions of the IglC protein. Using ICS and flow cytometry, we were able to determine which responses were mediated by CD4+ or

CD8+ positive T cells. IglC-specific CD4+ T cell responses were identified in Balb/c,

C3H/HeJ, and FVB/NJ mice. We mapped CD8+ T cell epitopes using 9 mers overlapping by one amino acid, identifying IglC

34-142

(LFIDSLTIA) in Balb/c mice and

IglC

137-144

(IMIDLSNL) in C57BL/6. We demonstrated that Lm vaccines expressing IglC can provide 100% protective immunity against a 10 LD

50

LVS challenge and Lm expressing KatG provided 40% protection (confirming data generated by the Horwitz lab at UCLA). A single vaccination with KBMA-IglC induced an IglC response that was barely distinguishable from background.

This month we initiated a number of long-term prime-boost studies that will include LVS challenge. For study p006-08-001, Balb/c mice were vaccinated with Lm-IglC and LmkatG monovalent and bivalent strains (BH2172, BH2182, BH2292) in November, and

Page 44 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble were boosted in December; these vaccinated mice will receive a lethal challenge dose of

LVS in mid January. For study P006-08-003, we vaccinated animals with Lm-IglC strain

BH2182 or LVS by the IV route. We will boost vaccinate one month after the prime vaccination, and one month after the boost vaccination T cell populations will be depleted and the animals will receive a lethal LVS challenge dose. The challenge dose will be administered in mid February.


None


UNM, Anza, UCLA and LBERI have negotiated MTA language to allow sharing of information and reagents from UCLA, but this need to be approved by NIAID. Without this MTA we cannot share our LM vaccine strains expressing UCLA antigens with UNM for Schu4 Challenge studies. A final draft MTA is under review at NIAID as of 12/10/08.


None


Excellent


35%




Mice vaccinated with live Lm vaccine candidates will receive a stringent LVS challenge dose to determine whether IglC, KatG, or both protect against lethal

LVS infection.



Balb/c mice will be boosted with Lm-IglC, then prior to lethal LVS challenge antibodies will be injected to deplete T cell populations:



-CD4,



-CD8, both, or irrelevant Ig.



Mice will be vaccinated with Live and KBMA Lm-IglC to determine whether

KBMA can protect against a lethal LVS challenge.



Once MTA is approved by NIAID and signed by UNM/Cerus/Anza/LBERI/UCLA, live and KBMA Lm lots will be sent to UNM for evaluation in SchuS4 challenge model.


None


None

Milestone 57

Milestone description: Optimization of KBMA

Lm

Vaccination Route and Regimen.


1. Date started: 6/1/ 2008

2. Date completed:

P ending


Summary of objectives: We will compare various routes of administration including IV, IM,

IN, ID and oral. For oral, IN, and ID administration in mice, we will first mutate the inlA gene of Lm to allow for binding of murine E-cadherin in order to mimic the human interaction (as described in Wollert et al., Cell, 2007). We will compare the potency of the inlA M gain of function mutants to our traditional platform strain. Routes will be ranked by ability to induce a cellular immune response using ELISpot, ICS, and in vivo cytotoxicity.

We will optimize dosing regimen of most potent and tolerable route. Lm expressing IglC

Page 45 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble and/or KatG will be used to evaluate immunogenicity. Optimized route and regimen will be confirmed by SchuS4 protection studies at UNM.

Summary of Key achievements: We have constructed vaccine candidates that contain the inlA M gain of function mutations (Table III). The sequence of the wild-type EGDe inlA gene

(from the Lm strain used in the Wollert manuscript) was synthesized and the inlA gene in our platform strain was replaced ( inlA WT ) in our live-attenuated and KBMA platform strains as there are a number of differences in the sequence between the native sequences between these strains. Two point mutations, S192N and Y369S, were incorporated into the

EGDe inlA sequence ( inlA M ) and inserted into the chromosome of our live-attenuated and

KBMA platform strains. Into these 4 strains the ActAN100-iglC-SL8 expression cassette was inserted using the integration vector pINT. Cellular invasion assays were performed: invasion of CaCo2 cells was dependent on inlA, as a

 inlA strain was unable to invade, but we were not able to demonstrate that the inlA M gain of function allele increased invasion compared to inlA wt (as published by Wollert et.al). Oral and IV routes of administration were compared: In spleens, SL8 and IglC responses were 2-3 times lower after oral immunization than with IV administration, but mucosal responses from intra-epithelial lymphocytes (IELs) were similar after immunization by either route. Mice that were vaccinated orally with the inlA M strain had marginally higher splenic T cell responses and

IEL responses that were 3-4 times higher than the isogenic strain expressing inlA wt . This preliminary result suggests that there may be a slight increase in immunogenicity when the inlA M vaccine strain is administered orally.

Table III

Strain Genetic Background Antigen Cassette Status Notebook, page

CRS-100

 actA

 inlB

BH2130

 actA

 inlBinlA WT none none

Sequence verified

Sequence verified

NB899, p. 44

NB899, p. 48

BH2164

 actA

 inlBinlA WT ActAN100-IglC-SL8 Sequence verified NB899, p.49

BH2170

 actA

 inlBinlA M none Sequence verified NB899, p. 52

BH2194

 actA

 inlBinlA M ActAN100-IglC-SL8 Sequence verified NB899, p. 44

BH2132

 actA

 inlB

 uvrABprfA G155S inlA WT none Sequence verified NB899, p.48

BH2166

 actA

 inlB

 uvrABprfA G155S inlA WT ActAN100-iglC-SL8 Sequence verified NB899, p. 44

BH2134

 actA

 inlB

 uvrABprfA G155S inlA M none Sequence verified NB899, p.48

BH2168

 actA

 inlB

 uvrABprfA G155S inlA M ActAN100-iglC-SL8 Sequence verified NB899, p.44

Page 46 of 47


Period: 12/01/2008 to 12/31/2008




Justin Skoble

In order to evaluate which route of administration is the most effective at conferring protection, we have initiated a prime-boost vaccination regimen with the live attenuated

Lm-IglC strain BH2182. Mice were vaccinated with 2x10 6 cfu IV or IM, 1x10 8 cfu SC or

ID, and 1x10 9 orally. These animals were boosted in December and will be challenged with a 100 IV LD

50

dose of LVS in Mid January.


None


The Anza methodology for anesthesia prior to IN administration needs to be modified.


None


Excellent


15%




Mucosal immunity will be evaluated again after oral immunization to determine whether the >2fold increase in mucosal immunity seen with the inlA M strain is reproducible.



The intranasal LD

50

will be repeated with DVC lot16 LVS using alternate anesthesia methodology



Murine epithelial cell line CT-26 will be used for invasion assays


None


None

Page 47 of 47