Name
Date
Homework 4
1. A typical bacterium has how many chromosomes?
a. 1
b. 2
c. 23
d. 46
2. DNA is composed of the following molecules:
a. Adenosine, glutamate, cysteine, thymine
b. Adenine, guanine, cytosine, thymine
c. Adenine, guanine, cytosine, uracil
d. Adenosine, uracil, cysteine, tyrosine
3. A mutation that results in the addition or deletion of one or more bases is known as a:
a. Missense mutation
b. Nonsense mutation
c. Silent mutation
d. Frameshift mutation
4. What are “jumping genes” and how do they jump?
5. How does Nitrosoguanidine cause mutations?
a. It causes a Frameshift mutation
b. It causes Thymine:Thymine dimers
c. It pairs a Guanine with a Thymine by methylation
d. It replaces a Cytosine with a Uracil
6. What are nucleoside analogs?
7. The proof-reading function that repairs Thymine Dimers by excision is called:
a. Light repair
b. Dark repair
c. Ligation
d. All of the above
8. What is the Ames test and how is it useful?
9. Using Table 7.4 (pg 171), answer the following questions given the following sequence:
AUGGCUAAACUUGUUAGAUAA
a. What are the amino acids encoded by this mRNA?
b. Write the sequence of DNA that coded for this mRNA (Is this the minus or plus strand?)
c. Write the Template DNA sequence that resulted in this protein (Hint, this is not the
same sequence as in part B):
10. Define the following terms:
a. Primase
b. DNA Polymerase
c. DNA Ligase
d. Helicase
11. Which strand of DNA codes for mRNA?
a. The plus strand
b. The minus strand
12. What are two reasons why prokaryotes can transcribe and translate simultaneously?
13. Describe how the Lac Operon functions:
Lab Questions:
14. Why is EMB (Eosin Methylene Blue) Agar considered both selective and differential?
15. Why would you choose to use an antiseptic instead of a disinfectant? What’s the difference?
16. What is the visible spectrum of light?
a. 220-400nM
b. 400-800nM
c. 800-1000nM
d. 300-500nM
17. What are the effects of ultraviolet light on cells?