Running title: Transmission strategy of an insect nucleopolyhedrovirus
Occlusion body pathogenicity, virulence and productivity
traits
vary
with
transmission
strategy
in
a
nucleopolyhedrovirus.
Oihana
Cabodevilla,a
Itxaso
Ibañez,b
Oihane
Simón,a
Rosa
Murillo,a,b
Primitivo Caballero,a,b Trevor Williamsc*
a
Instituto de Agrobiotecnología, CSIC-Gobierno de Navarra, 31192 Mutilva Baja, Navarra, Spain;
b
Departamento de Producción Agraria, Universidad Pública de Navarra, 31006 Pamplona, Navarra, Spain;
c
Instituto de Ecología AC, Xalapa, Veracruz 91070, Mexico
*Corresponding author. Mailing address: Instituto de Ecología AC, Apartado Postal 63,
Xalapa, Veracruz 91070, Mexico. Tel: +52 228 8421800 ext. 2000, Fax: +52 228 8421800
ext. 4115. E-mail: trevor.williams@inecol.edu.mx
1
Summary
The prevalence of sublethal infections of Spodoptera exigua multiple nucleopolyhedrovirus
(SeMNPV) was quantified in natural populations of S. exigua in Almería, Spain, during 2006
and 2007. Of 1045 adults collected, 167 (16.1%) proved positive for viral polyhedrin gene
transcripts by RT-PCR. The prevalence of covert infection varied significantly according to
sex and sample date. Of 1660 progeny of field-collected insects, lethal disease was observed
in 10-33% of offspring of transcript-positive females and 9-49% of offspring of transcriptnegative females. Isolates associated with vertically transmitted infections were characterized
by restriction endonuclease analysis using BglII or EcoRV and compared with isolates
originating from greenhouse soil-substrate believed to be horizontally transmitted. Insects
from a sublethally infected Almerian colony were between 2.3-fold and 4.6-fold more
susceptible to infection than healthy insects from a Swiss colony, depending on isolate.
Horizontally transmitted isolates were significantly more pathogenic than vertically
transmitted isolates in insects from both colonies. Mean speed of kill in second instars (Swiss
colony) varied between isolates by >20 h, whereas mean occlusion body (OB) production in
fourth instars (Swiss colony) varied by 3.8-fold among isolates. Intriguingly, all three
horizontally transmitted isolates were very similar in speed of kill and OB production,
whereas all three vertically transmitted isolates differed significantly from one another in both
variables, and also differed significantly from the group of horizontally transmitted isolates in
speed of kill (one isolate) or both variables (two isolates). We conclude that key pathogenicity
and virulence traits of SeMNPV isolates vary according to their principal transmission
strategy.
Keywords: Nucleopolyhedrovirus, Vertical transmission, Covert infections, Genotypic
variability
2
1. Introduction
The survival of virus pathogens between host generations is of critical importance in the
dynamics of infection (Dieckmann et al., 2002). The transmission of virus pathogens in natural
populations of insects may occur by horizontal transmission, from infected to healthy
individuals of each generation, and by vertical transmission, from parents to offspring
(Rothman and Myers, 2000). The efficiency of the virus transmission process within and
between generations will influence both the dynamics of viruses in natural insect populations
(Cooper et al., 2003; Fuxa, 2004) and their effectiveness as biological insecticides (Zhou et al.,
2005, de Souza et al., 2007).
Baculovirus infections may become persistent or latent after a sublethal dose of occlusion
bodies (OBs) has been ingested by the host. Latent viral infections have been defined as those
in which the virus exhibits minimal gene expression, whereas persistent viral infections are
those in which the virus is replicating and a range of viral genes are expressed without signs
of disease (Burden et al., 2002, 2003). Both latent and persistent viral infections may be
classed as covert in that neither results in obvious signs of disease. The covert infection
strategy is likely to be advantageous for pathogen survival when opportunities for horizontal
transmission are limited, such as during periods of low host density. Experimental and
anecdotal evidence suggest that sublethal infections can switch to patent lethal disease under
the appropriate conditions of crowding, physiological stress, or the presence of additional
pathogens (Fuxa et al., 1999). Covert infection may also offer opportunities for vertical
transmission of the pathogen to the offspring of infected parents (Kukan, 1999).
Baculovirus DNA and transcripts have been detected and found to persist in the immature
and adult stages of a number of moth species reared over multiple generations (Hughes et al.,
1993, 1997; Burden et al., 2002; Khurad et al., 2004). Natural insect populations also appear
susceptible to sublethal virus infections (Burden et al., 2003; Vilaplana et al., 2010), and a
theoretical framework has been developed to study the impact of sublethal infections on host3
pathogen population dynamics (Boots and Norman, 2000; Sorrell et al., 2009).
The Spodoptera exigua multiple nucleopolyhedrovirus (Family Baculoviridae, Genus
Alphabaculovirus, Species Spodoptera exigua multiple nucleopolyhedrovirus, SeMNPV) has
been intensively studied as a biopesticide for use in greenhouse and field crops in the United
States, Europe, southern and south-east Asia (Smits and Vlak, 1994; Kolodny-Hirsch et al.,
1997; Cunningham, 1998), and recently in southern Spain (Lasa et al., 2007a, b). SeMNPV
populations are often characterized by high genetic heterogeneity (Gelernter et al., 1986;
Caballero et al., 1992; Hara et al., 1995; Muñoz et al., 1998). Some of the genotypes present
within a field isolate, named SeMNPV-SP2, that originated from infected larvae collected
during a natural epizootic in Almería, southern Spain, were characterized by Muñoz et al.
(1999). A number of additional genotypes were subsequently identified from reservoirs of
OBs present in Almerian greenhouse soil-substrate samples (Murillo et al., 2007). Because
OBs in the soil can achieve transmission only if they are transported back onto plant surfaces
and then eaten by susceptible insects (Fuxa and Richter, 2001), the genotypes found in OB
reservoirs were suspected to be horizontally transmitted. In contrast, field collected insects
and laboratory colonies of Spodoptera exigua (Hübner) are frequently reported to succumb to
spontaneous NPV disease which is believed to originate from vertically transmitted
infections. However, the identity of genotypes involved in vertically transmitted infections is
uncertain and the diversity of genotypes present in SeMNPV populations led us to
hypothesize that certain genotypes may be specialized for different routes of transmission.
To assess SeMNPV abundance and diversity present in natural S. exigua populations, we
analyzed field caught insects and performed a preliminary characterization of genotypes
associated with covert infections that are likely to be vertically transmitted. To provide
insights into the relationship between genetic diversity and transmission strategy,
The main objectives of the present study were to quantify the incidence of covert infections
and the prevalence of vertical transmission of SeMNPV in natural insect populations in
4
Almerian greenhouses. Genotypes involved in vertical transmission were subsequently
characterized for insecticidal properties and the ability to cause lethal or sublethal disease was
compared in isolates with likely different transmission strategies; specifically we examined
the hypothesis that vertically and horizontally transmitted genotypes would differ in their
ability to cause disease and in their patterns of host exploitation. We also postulated that the
host response to each genotype would depend on its infection status.
2. Materials and methods
2.1. Insect cultures and virus stock
S. exigua larvae were obtained from three laboratory populations and each was maintained on
artificial diet and virus-free conditions in a rearing room exclusively used for that purpose at the
insectary facilities of the Universidad Pública de Navarra, Pamplona, Spain. Each colony was
started using the larvae from one of three origins: i) a short-term culture that had been
maintained in the laboratory for four generations and that was started using eggs laid by fieldcollected adults collected in Almería (Spain), which we named the Almerian colony (RT-PCR
studies described in section 2.3, indicated that ~80% of the adults from this culture were
sublethally infected by SeMNPV), ii) a long-term laboratory culture for which evidence of a
persistent infection had been observed in at least 21% of insects (R.D. Possee and R. Murillo,
unpublished data) from the Centre for Ecology and Hydrology, Oxford (UK), which we named
the Oxford colony, iii) a virus-free culture provided by Andermatt Biocontrol AG
(Grossdietwil, Switzerland), which we named the Swiss colony. This colony consistently
proved negative for SeMNPV infection in RT-PCR analyses performed during the period of
the experiment and in qPCR studies performed subsequently. The Oxford colony was
5
established in December 2003 and originated from a laboratory colony maintained in the
insectary of Syngenta UK (Jealott's Hill International Research Center, Bracknell, UK),
whereas the Swiss colony is of uncertain origin. Prior to the start of this study the Swiss,
Almerian and Oxford colonies were reared on the same diet and conditions for 2, 4, and >10
generations, respectively.
The different strains of SeMNPV were obtained either from our virus collection or were
isolated in this study. The SeMNPV strains SeG24, SeG25, and SeG26 were obtained from
OBs present in the greenhouse soil-substrate environment (Murillo et al., 2007); they were
considered to be horizontally transmitted and are hereafter prefixed with the letters HT. These
strains each comprise a single dominant genotype (as indicated by an absence of submolar
fragments in restriction endonuclease profiles), although none of them have been subjected to
cloning procedures. Other isolates used in this study were each obtained from the patently
diseased progeny of field collected or laboratory insects and are considered to be vertically
transmitted isolates, and are prefixed with the letters VT.
2.2. Field collection of Spodoptera exigua and identification of vertically transmitted viruses
Adult S. exigua of both sexes were attracted by UV light tramps and caught on a white
sheet shortly after sunset in July and September of 2006 and 2007 in the greenhouse zone
around Almería, within a 20 km radius of the sites where the horizontally transmitted isolates
were collected. Females were placed in 25 ml perforated plastic cups containing a damp
cotton pad and were allowed to lay eggs for 1-2 days. Egg masses were not subjected to
surface decontamination. Twenty neonate larvae from each female were selected at random,
individualized in cups containing diet and reared through to the adult stage. Larvae were
monitored daily for signs of viral disease and those that died were stored at -20ºC for
restriction endonuclease analysis (REN) of viral DNA. Each NPV-killed larva was considered
6
to have succumbed to a vertically transmitted infection. Additional vertically transmitted
isolates used in this study were obtained from the Oxford insect colony. For this, 15 pairs of
adults were selected at random, allowed to mate and the incidence of NPV disease in their
progeny was monitored as described above.
2.3. Detection of SeMNPV transcripts in Spodoptera exigua using RT-PCR
Total RNA was extracted from the adults using Trizol Reagent (Invitrogen, Carlsbad, CA,
USA) following the manufacturer instructions. Briefly, adults that had been stored
individually at -80º C were allowed to thaw and their abdomens were dissected with sterilized
toothpicks on a sterile plate. A 50-100 mg tissue sample was taken from each abdomen and
homogenized in 1 ml of Trizol reagent. Then 100 µl chloroform was added to separate two
phases by centrifugation at 12,000 × g for 15 min at 4ºC. The aqueous phase was precipitated
using 2-propanol and centrifuged at 12,000 × g for 10 min at 4º C. RNA pelleted was washed
with 75% ethanol and resuspended in 50 µl deionized water. All equipment and reagents were
previously sterilized and treated with diethylpyrocarbonate (DEPC) to remove RNases.
Total RNA sampes extracted from adults and a virus infected moribund larva as positive
control were used for RT-PCR reactions to detect transcripts of the polyhedrin and DNApolymerase genes using specific primers. RNA samples were previously treated with DNase
to avoid DNA contamination. Similar amounts of RNA (160 - 400 ng) were used in each
reaction. RT-PCR was performed in two steps. First, cDNA synthesis was performed using
the ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and the polyhedrin
reverse primer Sepolh.2 (5' TGTCTTCCATGAAACGCGTC 3') that amplified in the
SeMNPV polyhedrin stop codon, or DNA-polymerase reverse primer Sednapol.2 (5'
TAGCACGTCGTCTTAGCGTG 3') that amplified in the DNA-polymerase stop codon,
according to the manufacturer's instructions. One quarter volume of the reaction was then
7
subjected to PCR amplification with Taq DNA polymerase (Bioline) and the two internal
primers for the polyhedrin gene: Sepolh.1 (5' ATGTATTACTCGCTACAGCTA 3') that
amplified 319 bp upstream of the stop codon and Sepolh.2. Alternatively, the DNApolymerase gene primer pair was used: Sednapol.1 (5' ATGACTTCTTCGTCGTCGTC 3')
that amplified 320 bp upstream of the DNA-polymerase stop codon and Sednapol.2. Samples
from each insect were subjected to PCR analysis in triplicate. PCR calibration studies
performed in triplicate indicated that the consistent detection limit of this technique was 5 x
10-6 ng of genomic DNA, equivalent to ~35 virus genome copies. PCR products were
electrophoresed in 1% agarose gels, alongside a 100 bp marker ladder (Invitrogen). DNA
fragments were stained with ethidium bromide, visualized in a UV transilluminator,
photographed and examined using the molecular analyst program Chemi doc (Bio-Rad,
Hercules, CA, USA). To determine the effect of collection data and sex on the prevalence of
infection in field collected adults and their progeny, RT-PCR results were subjected to
Pearson's 2 test (SPSS version 10.0).
2.4. Genotypic variability of vertically transmitted isolates
The progeny of Oxford colony insects that died from polyhedrosis disease were
individually subjected to REN analysis of viral DNA. For this, cadavers were individually
homogenized in 0.1% SDS, filtered through muslin and washed twice with 0.1% SDS by
centrifugation. OBs were suspended in 300 µl distilled water, 150 µl 0.5 M Na2CO3 and 50 µl
1% SDS to dissolve the OB matrix. The released virions were incubated with proteinase K for
1 h at 50ºC. DNA was extracted by two passes of phenol and a final step with chloroform.
DNA was precipitated by the addition of 2.5 volumes of ice-cold ethanol and 0.1 volumes of
sodium acetate. DNA was washed with 70% ethanol and resuspended in 50 µl of distilled
sterile milli-Q water. Samples of 2 µg of viral DNA were treated with BglII, loaded in 0.7%
8
agarose gel with TAE buffer (40mM Tris-Acetate; 1mM EDTA) and electrophoresed at 16 V
overnight. BglII was used because it allowed clear discrimination among SeMNPV genotypes
(Murillo et al., 2007). Ethidium bromide stained gels were then visualized on a UV
transilluminator, photographed and examined.
The genomes of the Oxford colony isolate VT-SeOx4 and the vertically and horizontally
transmitted isolates originating from Almerian greenhouses were sequenced (O. Cabodevilla
and E. A. Herniou, unpublished data) and subjected to digestion in silicio using BglII, and
EcoRV in the case of VT-SeAl1 and HT-SeG26, using the NEBcutter V2.0 program (Vincze
et al., 2003).
2.5. Bioassay for the induction of covert infection
Pre-molted S. exigua fourth instars from the Swiss and Almerian colonies were starved
overnight and, having molted, were inoculated by the droplet feeding method (Hughes and
Wood, 1981) with an OB suspension containing 9 × 103 OB/ml in sterile distilled water, 10%
sucrose (w/v) and 0.001% (w/v) of the food dye Fluorella Blue. Virus treatments involved
inoculation with one of three horizontally transmitted (HT-SeG24, HT-SeG25 and HTSeG26) and three vertically transmitted (VT-SeAl1, VT-SeAl2, VT-SeOx4) isolates. Fourth
instars ingested 3.3 µl during droplet feeding (Smits et al., 1987), that equates to 30
OBs/larva. Larvae were allowed to drink for 10 min or until they moved away from the
droplet and were then transferred individually to a 24-compartment plate containing diet.
Twenty-four larvae were dosed for each virus-treatment and a negative control was treated
with sterile distilled water instead of virus. Larvae were reared at 25 ± 2º C and mortality was
recorded daily. Adult survivors were subjected to RT-PCR to detect transcripts of the
polyhedrin and DNA polymerase gene. Bioassays were performed independently on three
occasions. The prevalence of RT-PCR positive insects was analyzed by fitting generalized
9
linear models with a binomial error structure specified in GLIM 4 (Numerical Algorithms
Group, 1993). When necessary, models were scaled to account for overdispersion in the error
distribution (Crawley, 1993).
2.6. Determination of OB concentration-mortality response
The pathogenicity of the horizontally and vertically transmitted isolates was determined by
inoculating S. exigua second instars as described above with one of the following
concentrations of OBs: 2.54 × 105, 8.18 × 104, 2.72 × 104, 9.09 × 103 and 3.03 × 103 OBs/ml.
This range of concentrations killed between 95 and 5% of the test larvae in preliminary
bioassays. A cohort of 24 larvae was allowed to drink from an OB-free suspension and served
as a control. Larvae were reared at 25 ± 2 ºC and mortality was recorded for 7 days postinoculation. Bioassays were performed three times for each isolate. Data were subjected to
logit regression using GLIM 4. To compare the responses of healthy and covertly infected
insects, the entire bioassay was performed using the Swiss and Almería colony insects,
respectively.
2.7. Determination of mean time to death
Second instars from the healthy Swiss colony were allowed to drink for 10 min from
droplets of a single concentration of OBs of each isolate that was previously estimated to
result in ~90% mortality. Twenty-four inoculated larvae were transferred individually to diet
and monitored at 8 h intervals for 5 days. Bioassays were performed on three occasions. Time
mortality results of individuals that died due to NPV infection by different isolates were
subjected to Weibull survival analysis in GLIM. The validity of the Weibull model was
determined by comparing fitted values with Kaplan–Meier survival function estimated values
10
(Crawley, 1993).
2.8. Determination of OB production
Groups of 48 fourth instars from the healthy Swiss colony were starved overnight and then
allowed to drink for 10 min from a suspension of 5 x 107 OBs/ml of each of the isolates.
Inoculated larvae were individualized in 24 well culture plates containing diet and checked
daily for virus-induced mortality. Virus-killed larvae were frozen to avoid liquefaction and
OBs were collected and individually homogenized in 1 ml sterile distilled water. Each
homogenate was filtered through a fine wire mesh to remove debris and the resulting
suspension was counted in triplicate in a Neubauer chamber at 400x magnification. Counts
were performed on 30 randomly selected larvae for each isolate. OB production data were
loge-transformed and analyzed by fitting generalized linear models in GLIM. Model estimates
and corresponding SEs were used to perform pairwise t-tests on differences between isolates
in loge OB production/larva.
3. Results
3.1. Incidence of SeMNPV infection in S. exigua field populations
From a total of 1045 adults (males and females) collected during four sampling periods and
analyzed by RT-PCR, 167 (16.1%) proved positive for transcripts of the viral polyhedrin gene
(Fig. 1A). The prevalence of covert infection varied according to sex and sample date. The
prevalence of infection did not differ significantly between males and females in 2006 (2 =
0.847; d.f. = 1; P >0.05), whereas in 2007, infections in males were significantly more
frequent than those in females (2 = 39.1; d.f. = 1; P <0.001) (Fig. 1B). The prevalence of
11
sublethal infections was significantly reduced in insects captured in 2007 compared to 2006
(χ2 = 123.2; d.f. = 1; P <0.001).
The females tested by RT-PCR were classified as transcript-positive or negative and
batches of 10-20 offspring from each female were individually reared under clean conditions
in the laboratory. Overall, lethal NPV disease was observed in 333 (20%) out of 1660
progeny obtained from field collected females (Fig. 1B). Lethal polyhedrosis disease was
observed in the offspring of both transcript-positive and transcript-negative females. The
proportion of transcript-positive females that produced diseased progeny varied from zero to
91% (11 out of 12 insects) but sample sizes were too small to draw conclusions (Fig. 1B).
Among the transcript-negative females, 37% (7 out of 19 females) and 90% (18 out of 20
females) produced diseased cohorts of offspring in the samples taken in July and September
2006, respectively, compared to 27% (42 out of 155 females) and 11% (18 out of 164
females) in samples taken in July and September 2007, respectively.
The prevalence of polyhedrosis disease among offspring of transcript-positive females was
10% (1 out of 10 offspring) in the July 2006 sample, 33% (43 out of 130 offspring) in the
September 2006 sample, whereas no offspring of transcript-positive females died of NPV
disease in the 2007 samples. In contrast, the prevalence of disease among offspring of
transcript-negative females collected in 2006 was 11% (8 out of 70 offspring) in the July
sample and 49% (122 out of 250 offspring) in the September sample, compared to 15% (126
out of 840 offspring) and 9% (33 out of 360 offspring) in the July and September 2007
samples, respectively.
3.2. Identification of virus genotypes involved in vertical transmission
OBs isolated from the virus diseased offspring of field-collected and laboratory colony
insects were subjected to extraction of viral DNA and REN analysis, either in vitro or in
12
silicio following genome sequencing. NPV-killed larvae from the offspring of field collected
adults were analyzed and two different isolates were identified, VT-SeAl1 (8/14, 57%) and
VT-SeAl2 (6/14, 43%) (Fig. 2A). The BglII profile of VT-SeAl1 comprised 20 fragments
(named BglII-A to BglII-T) and was identical to HT-SeG26, but could be differentiated from
this isolate by treatment with EcoRV (Fig. 2B). The profile of VT-SeAl2 was also identical to
that of VT-SeAl1 except the BglII-K fragment was shorter (~4.8 kb) (Fig 2A).
Of a total of many thousands of larvae reared from the Oxford colony, 45 died from
polyhedrosis disease. Of these, 42 insects (93%) were found to have succumbed to a single
genotype, named VT-SeOx1 that was identical in terms of BglII profile to the Spanish isolate
VT-SeAl2 (Fig. 2C). Additional genotypes were each isolated from single diseased larvae:
VT-SeOx4 and VT-SeOx5 were characterized by a unique fragment of ~5.3 kb and 21 kb,
respectively, whereas VT-SeOx6 lacked the BglII-A (~23 kb) fragment. The VT-SeOx4
isolate was selected for further study as it was found to be stable on passage in insects,
whereas a degree of genetic instability was observed in VT-SeOx5 and VT-SeOx6.
3.3. Induction of covert infections
Fourth instars from both the Swiss and Almerian colonies were infected with ~30 OBs of
one of the three vertically (VT-SeAl1, VT-SeAl2, VT-SeOx4) or horizontally transmitted
isolates (HT-SeG24, HT-SeG25, HT-SeG26), in groups of 24 per treatment. The prevalence
of NPV mortality varied between 25 and 59% of inoculated larvae and did not differ
significantly between isolates (2 = 7.68, d.f. = 5, P = 0.18). Overall, insects from the Swiss
population experienced an average 53% mortality that was significantly higher than the 40%
mortality experienced by insects from the Almerian colony (2 = 9.90, d.f. = 1, P < 0.05). No
mortality was observed in controls in either host population.
Adult survivors of the virus challenge were analyzed by RT-PCR using both polyhedrin
13
and DNA-polymerase primer sets alternatively. DNA-polymerase transcripts were detected in
different proportions, but polyhedrin transcripts were not detected. No positive amplifications
were detected in adults from control larvae of the Swiss population, whereas over 80% of
control larvae from the Almerian colony were RT-PCR positive for DNA-polymerase
transcripts (data not shown). The prevalence of RT-PCR positive insects differed significantly
between isolates (F5,34 = 5.23, P < 0.05) and between insect populations (F1,34 = 5.01, P <
0.05). No clear pattern among either horizontally or vertically transmitted isolates were
apparent in their ability to induce persistent infections in the Swiss insect colony (Fig. 3);
100% of the adults infected as larvae with the vertically transmitted VT-SeAl1 or VT-SeAl2
isolates were positive for DNA-polymerase transcripts, whereas only 16% of adults from
larvae inoculated with the horizontally transmitted HT-SeG25 were transcript positive, all
other isolates were intermediate between these values.
3.4. Pathogenicity of horizontally and vertically transmitted isolates
To compare the OB pathogenicity characteristics of vertically and horizontally transmitted
isolates, concentration-response assays were performed using insects from the Almerian and
Swiss populations (Table 1). In all cases, mortality increased significantly with OB
concentration (F1,53 = 521, P < 0.001, scale parameter 1.36). Insects from the Almerian colony
were significantly more susceptible to infection than the Swiss colony insects (data pooled
across all genotypes) (F1,53 = 80.1, P < 0.001, scale parameter 1.36). The magnitude of colony
differences in susceptibility, based on the ratio of LC50 values (Table 1), ranged from 2.3-fold
for the VT-SeAl2 isolate to 4.6-fold for the HT-SeG26 isolate. Genotypes differed
significantly in their pathogenicity (F5,52= 47.7, P < 0.001, scale parameter 1.36), with HTSeG25 being the most pathogenic isolate of those tested for both colonies, and VT-SeAl2
being the least pathogenic for both colonies, although these differences were only significant
14
in insects from the Almerian colony (Table 1). When grouped according to transmission
strategy, horizontally transmitted isolates were significantly more pathogenic than vertically
transmitted isolates in insects from both colonies (F1,57 = 18.7, P < 0.001, scale parameter
1.82). No virus mortality was registered in mock-infected control insects from either colony.
3.5. Speed of kill and OB production
The mean (±SE) speed of kill in second instars from the healthy Swiss colony varied
significantly between isolates (12 = 1516; P < 0.001; Weibull hazard function α = 10.787)
from a minimum of 89.5 ± 1.9 h for insects infected by VT-SeOx4 to a maximum of 110.0 ±
2.5 h for insects infected by VT-SeAl1. Similarly, mean OB production per larva varied
significantly among isolates (F5,193 = 15.4; P < 0.001) with a minimum of 2.99 x 108 ± 4.59 x
107 OBs/larvae for VT-SeOx4 to a maximum of 1.14 x 109 ± 1.26 x 108 OBs/larvae for VTSeAl2. Intriguingly, a plot of speed of kill in second instars against OB production in fourth
instars (Fig. 4) revealed that all three horizontally transmitted isolates were very similar in
these characteristics (indicated by the shaded region in Fig. 4), whereas all three vertically
transmitted isolates differed significantly from one another in both variables; vertically
transmitted isolates also differed significantly from the cluster of horizontally transmitted
isolates in speed of kill (VT-SeAl1) or both variables (VT-SeOx4, VT-SeAl2).
4. Discussion
The main objectives of the present study were to quantify the incidence of covert infections
and the prevalence of vertical transmission of SeMNPV in natural insect populations in
Almerian greenhouses, and to compare the pathogenicity and virulence characteristics of NPV
isolates with likely different transmission strategies.
15
RT-PCR studies revealed that overall, 16% of field-collected S. exigua adults harbored a
persistent NPV infection. These insects were found to contain viral transcripts of the
polyhedrin gene, suggesting that the virus was actively replicating. Studies on other
lepidopteran species suggest that PCR studies targeting viral DNA tend to result in higher
estimates of the prevalence of covert infection than RT-PCR studies that target viral
transcripts (Burden et al., 2002; Vilaplana et al., 2010). A likely explanation is that in a
sublethal infection, only a fraction of the total virus population is actively replicating and
producing transcripts, so that the concentration of RT-PCR targets may be close to the limits
of detection in some or most of the covertly infected insects. As our study was based on
detection of viral transcripts it is likely that the estimates of covert infection were
conservative in nature. The use of primers that target polyhedrin transcripts has proved useful
in other studies aimed at quantifying the prevalence of covert infection in lepidopteran
populations (Martínez et al., 2005; Vilaplana et al., 2010). However, detection of DNA
polymerase transcripts appeared to be a more sensitive indicator of infection than polyhedrin
transcripts, so the values given in Figure 1B are likely to be conservative estimates of the
prevalence of covert infection in the S. exigua population. We designed these primer sets
based on the published SeMNPV genome sequence (Ijkel et al., 1999), but did not test the
specificity of the primers in other NPVs and cannot exclude the possibility that some
infections we detected were caused by different viruses.
Both sample date and sex significantly influenced the prevalence of persistent virus
infections in S. exigua field-collected adults. The percentage of infected males (21.8%) was
significantly higher than that of females (6.0%) and the proportion of diseased offspring was
higher for negative transcripts females. This intriguing observation that males might be more
influential than females in the transmission of viral infections merits additional study, and
finds a number of similarities with the baculovirus-like nudivirus infections that are sexually
transmitted in certain lepidopteran and orthopteran populations (Wang et al., 2007).
16
Moreover, a particularly high prevalence of infection was observed in the progeny of insects
captured in September 2006 compared to other sample dates, for reasons that are unclear, but
that may have been related to population density or environmental stressors. For example,
high-density field populations were found to harbor inapparent baculovirus infections whereas
low-density populations did not (Cooper et al., 2003). The prevalence of patent NPV disease
can change rapidly from one year to the next, particularly during or following epizootics
(Fuxa, 2004), whereas the dynamics of covert infections in host populations remain largely
unknown.
Vertical transmission of baculovirus infections appears to be a common phenomenon in
Lepidoptera (Kukan, 1999), although the mechanisms and factors that regulate this process
are not well understood. Vertical transmission has been suggested as a survival strategy for
the virus which persists in sublethally infected insects during periods of low host density
when opportunities for horizontal transmission are highly restricted (Cory and Myers, 2003).
The combination of covert infection and vertical transmission may also be an effective
strategy for viral dispersal via host migration, especially for moths such as Spodoptera spp. in
which adults may fly long distances in search of suitable host plants for oviposition. In the
case of S. exigua, moth populations annually arrive in Almería from the North Africa region
during the months of April through to August. Previous studies on the incidence of vertical
transmission in Spodoptera spp. that survived virus inoculation in the larval stage also
reported a wide variation (~5 to 50%) in the prevalence of lethal infection in the progeny
(Abul-Nasr et al., 1979; Smits and Vlak, 1988; Fuxa and Richter, 1991). More recent
molecular studies have confirmed the presence of virus in the progeny of field-collected
insects (Cooper et al., 2003; Vilaplana et al., 2008). Burden et al. (2002) detected viral mRNA
in 60-80% of the samples derived from mating between infected and non-infected individuals
in Plodia interpunctella (Hübner), although none of the progeny larvae died of virus
infection. Similarly, Vilaplana et al. (2010) detected viral DNA in 78% of S. exempta
17
(Walker) progeny of field collected adults. In the present study, overall 25% of females (that
were positive or negative for infection by RT-PCR) produced cohorts of offspring, some of
which died of NPV disease. The average prevalence of lethal disease in these progeny larvae
was 20.1%, although considerable variation was present across sampling dates (from 9 to
49%), including the progeny of females in which viral transcripts were not detected by RTPCR analysis.
It is unclear how virus-transcript negative females were able to transmit the infection, but
possible explanations include: i) that those females had previously copulated with males
carrying a persistent infection, ii) that the virus could be in a non-replicating state
undetectable by RT-PCR, iii) the abundance of viral transcripts may be below the detection
threshold levels for detection by RT-PCR in some covertly infected insects. Nonetheless, it is
clear that vertical transmission of SeMNPV infections are a common feature of the natural
populations of S. exigua in Almería. The results of our study did not provide clues as to the
mechanism by which virus is transmitted from parents to offspring; this may be transovum for
virus that contaminates the outside of the egg, or transovarial for virus transmitted within the
egg (Fuxa et al., 2002). Transovum transmission may explain the observation that virus
transcript negative females produced offspring that died of polyhedrosis disease, as
replication and tissue trophism may differ for viruses adopting each transmission strategy.
However, surface decontamination using formalin or sodium hypochlorite did not marked
affect that incidence of vertical transmitted NPV infections in a laboratory colony of S.
exempta compared to field collected material, suggesting that transmission is mostly
transovarial rather than transovum in this species (Vilaplana et al., 2010).
REN characterization of vertically transmitted NPVs has been performed for Mamestra
brassicae (L.) (Burden et al., 2006), Malacasoma spp. (Cooper et al., 2003) and S. exempta
(Vilaplana et al., 2008), but the present study significantly advances previous findings in that
distinct genotypic variants have been found to be associated with each route of infection.
18
Previous studies of genotypic variability with SeMNPV in both field-collected insect cadavers
(Muñoz et al., 1999) and soil samples (Murillo et al., 2007) suggest that genotypes may be
adapted to particular habitats or routes of transmission. We attempted to determine the
isolates associated with vertically transmitted infections either from the progeny of fieldcollected adults and from laboratory-reared adults. Two different virus genotypes were
detected in the progeny of field-collected adults (VT-SeAl1 and VT-SeAl2) and four in the
larval progeny of laboratory-reared adults (VT-SeOx1, VT-SeOx4, VT-SeOx5 and VTSeOx6).
We hypothesized that horizontally transmitted isolates would be likely to be more
pathogenic, in terms of concentration-mortality metrics than vertically transmitted genotypes,
and this was indeed the case. This is because horizontal transmission depends entirely on
achieving peroral infection. In contrast, vertically transmitted isolates are not limited to a
single transmission mechanism; they may kill their host and adopt a horizontal route when
conditions are favorable for peroral infection and vertical route when they are not. Higher
insecticidal capacity of OBs of horizontally transmitted isolates was observed in insects from
both covertly infected and healthy S. exigua colonies. Interestingly, infections in the healthy
Swiss colony insects, in which no interference was possible due to covert infections,
vertically transmitted genotypes were markedly more heterogeneous in their speed of kill and
OB production characteristics compared to horizontally transmitted genotypes that clustered
as a single group in Figure 4.
This suggests an intriguing possibility that vertically transmitted isolates present
phenotypically disparate characteristics in response to adverse conditions that may favor
unusual virulence and productivity traits that differ from those of horizontally transmitted
genotypes, because at certain moments environmental or ecological conditions are not
favorable for horizontal transmission. The genetic differences in the insect colonies used and
the limited geographical area from which our samples were collected limit our ability to
19
generalize the results of our study. Verification of this hypothesis will require studies on
vertically and horizontally transmitted baculovirus isolates collected over a broad
geographical range (Erlandson, 2009), at different host densities (Reeson et al., 1998) and
from a range of host plants (Hodgson et al., 2002), that can affect the transmission of these
viruses.
The infected Almerian population was significantly more susceptible to the genotypes that
we tested than the healthy Swiss colony. It remains to been determined whether this is
because covertly infected insects are intrinsically more susceptible to lethal infection
following the consumption of OBs, or whether this result reflects the fact that in the present
study, five out of six genotypes tested originated from Almería. NPV isolates tend to be more
pathogenic to local host populations, in terms of dose-mortality metrics, than insects from
geographically distinct origins (Shapiro and Robertson, 1991; Del Rincón-Castro et al., 1997).
Alternatively, the differences in virus susceptibility between the Swiss and Almerian insect
colonies may be due to the genetic background of the insects rather than their infection status.
This study confirms that covert infections in adults occur as a result of surviving SeMNPV
challenge, as occurs in other baculovirus systems (Burden et al., 2002). RT-PCR results
suggested a differential ability to establish covert infection among the different isolates tested.
It seems that VT-SeAl1, VT-SeAl2 and HT-SeG26 had the highest capacity to produce covert
infection, whereas few of the survivors of HT-SeG25 proved positive for covert infection by
RT-PCR. These isolates are now being studied to identify possible genetic characteristics
associated in each transmission strategy.
In conclusion, the prevalence of covert SeMNPV infection in field-collected adults was
found to vary with sex and sampling date. Vertical transmission of SeMNPV resulted in
significant levels of mortality in the offspring of infected parents. As hypothesized, genotypes
associated with horizontally transmitted infections were more pathogenic to insects from
covertly infected or healthy colonies than vertically transmitted genotypes. Improved
20
understanding of the genetic and ecological factors that modulate vertical transmission of
NPV disease could have clear applications for trans-generational biological control of S.
exigua infestations in greenhouse and field crops.
Acknowledgments
We thank N. Gorria, S. Ros, R. Lasa, and P. Navarro for technical assistance. This
study received financial support from the Spanish Ministry for Science and Technology
(AGL2005-07909-CO3-01,
AGL2008-05456-C03-01).
O.C.
received
a
predoctoral
fellowship from the Spanish Ministry of Education and Culture.
21
References
Abul-Nasr, S. E., Ammar, E. D., Abul-Ela, S. M., 1979. Effects of nuclear polyhedrosis virus
on various developmental stages of the cotton leafworm Spodoptera littoralis. Journal
of Applied Entomology 88, 181-187.
Boots, M. J., Norman, R., 2000. Sublethal infection and the population dynamics of hostmicroparasite interactions. Journal of Animal Ecology 69, 1-9.
Burden, J. P., Griffiths, C. M., Cory, J. S., Smith, P., Sait, S. M., 2002. Vertical transmission
of sublethal granulovirus infection in the Indian meal moth, Plodia interpunctella.
Molecular Ecology 11, 547-555.
Burden, J. P., Nixon, C. P., Hodgkinson, A. E., Possee, R. D., Sait, S. M., King, L. A., Hails,
R. S., 2003. Covert infections as a mechanism for long-term persistence of
baculoviruses. Ecology Letters 6, 524-531.
Burden, J. P., Possee, R. D., Sait, S. M., King, L. A., Hails, R. S., 2006. Phenotypic and
genotypic characterisation of persistent baculovirus infections in populations of the
cabbage moth (Mamestra brassicae) within the British Isles. Archives of Virology 151,
635-649.
Caballero, P., Zuidema, D., Santiago-Alvarez, C., Vlak, J. M., 1992. Biochemical and biological
characterization of four isolates of Spodoptera exigua nuclear polyhedrosis virus.
Biocontrol Science and Technology 2, 145-157.
Cooper, D., Cory, J. S., Theilmann, D. A., Myers, J. H., 2003. Nucleopolyhedroviruses of forest
and western tent caterpillars: cross-infectivity and evidence for activation of latent virus
in high density field populations. Ecological Entomology 28, 41–50.
22
Cory, J. S., Myers, J. H., 2003. The ecology and evolution of insect baculoviruses. Annual
Review of Ecology, Evolution and Systematics 34, 239-272.
Crawley, M. J., 1993. GLIM for Ecologists. Blackwell, Oxford, UK.
Cunningham, J. C., 1998. Insect Viruses and Pest Management In: Hunter-Fujita, F. R.,
Entwistle, P. F., Evans, H. F., Crook, N. E. (Eds.), North America, Wiley, Chichester,
UK, pp. 313-331.
de Souza, M. L., de Castro, M. E. B., Moscardi, F., 2007. Virus for Biological Control of
Insects, In: D. Pimentel (Eds.), Encyclopedia of Pest Management, vol. 2. CRC Press,
Boca Raton, Florida, pp. 689-692.
Del Rincón–Castro, M. C., Ibarra, J. E., 1997. Genotypic divergence of three single nuclear
polyhedrosis virus (SNPV) strains from the cabbage looper Trichoplusia ni.
Biochemical Systematics and Ecology 25, 287-295.
Dieckmann, U., Metz, J. A., Sabelis, M. W., Sigmund, K., 2002. Adaptive dynamics of
infectious diseases: in pursuit of virulence management. Cambridge University Press,
Cambridge, UK.
Erlandson, M. A., 2009. Genetic variation in field populations of baculoviruses: mechanisms
for generating variation and its potential role in baculovirus epizootiology. Virologica
Sinica 24, 458-469.
Fuxa, J. R., 2004. Ecology of insect nucleopolyhedroviruses. Agriculture, Ecosystems and
Environment 103, 27-43.
Fuxa, J. R., Richter, A. R., 1991. Selection for an increased rate of vertical transmission of
Spodoptera frugiperda (Lepidoptera: Noctuidae) nuclear polyhedrosis virus.
Environmental Entomology 20, 603-609.
23
Fuxa, J. R., Richter, A. R., 2001. Quantification of soil-to-plant transport of recombinant
nucleopolyhedrovirus: effects of soil type and moisture, air currents, and precipitation.
Applied and Environmental Microbiology 67, 5166-5170.
Fuxa, J. R., Richter, A. R., Ameen, A. O., Hammock, B. D., 2002. Vertical transmission of
TnSNPV, TnCPV, AcMNPV, and possibly recombinant NPV in Trichoplusia ni.
Journal of Invertebrate Pathology 79, 44-50.
Fuxa, J. R., Sun, J. Z., Weidner, E. H., LaMotte, L. R., 1999. Stressors and rearing diseases of
Trichoplusia ni: evidence of vertical transmission of NPV and CPV. Journal of
Invertebrate Pathology 74, 149-155.
Gelernter, W. D., Federici, B. A., 1986. Isolation, identification and determination of
virulence of a nuclear polyhedrosis virus from the beet armyworm, Spodoptera exigua
(Lepidoptera: Noctuidae). Environmental Entomology 15, 240-245.
Hara, K., Funakoshi, M., Kawarabata, T., 1995. In vivo and in vitro characterization of several
isolates of Spodoptera exigua nuclear polyhedrosis virus. Acta Virologica 39, 215222.
Hodgson, D. J., Vanbergen, A. J., Hartley, S. E., Hails, R. S., Cory, J. S., 2002. Differential
selection of baculovirus genotypes mediated by different species of host food plant.
Ecology Letters 5, 512–518.
Hughes, D. S., Possee, R. D., King, L. A., 1993. Activation and detection of a latent
baculovirus resembling Mamestra brassicae nuclear polyhedrosis virus in M.
brassicae insects. Virology 194, 608-615.
Hughes, D. S., Possee, R. D., King, L. A., 1997. Evidence for the presence of a low-level,
persistent baculovirus infection of Mamestra brassicae insects. Journal of General
24
Virology 78, 1801-1805.
Hughes, P. R., Wood, H. A., 1981. A synchronous peroral technique for the bioassay of insect
viruses. Journal of Invertebrate Pathology 37, 154-159.
IJkel, W. F., van Strien, E. A., Heldens, J. G., Broer, R., Zuidema, D., Goldbach, R. W., Vlak, J.
M., 1999. Sequence and organization of the Spodoptera exigua multicapsid
nucleopolyhedrovirus genome. Journal of General Virology 80, 3289-3304.
Khurad, A. M., Mahulikar, A., Rathod, M. K., Rai, M. M., Kanginakudru, S., Nagaraju, J., 2004.
Vertical transmission of nucleopolyhedrovirus in the silkworm, Bombyx mori L. Journal
of Invertebrate Pathology 87, 8-15.
Kolodny-Hirsch, D. M., Sitchawat, T., Jansari, J., Chenrchaivachirakul, A., Ketunuti, U., 1997.
Field evaluation of a commercial formulation of the Spodoptera exigua (Lepidoptera:
Noctuidae) nuclear polyhedrosis virus for control of beet armyworm on vegetable crops
in Thailand. Biocontrol Science and Technology 7, 475-488.
Kukan, B. 1999. Vertical transmission of nucleopolyhedrovirus in insects. Journal of
Invertebrate Pathology 74, 103-111.
Lasa, R., Caballero, P., Williams, T., 2007a. Juvenile hormone analogs greatly increase the
production of a nucleopolyhedrovirus. Biological Control 41, 389-396.
Lasa, R., Pagola, I., Ibanez, I., Belda, J. E., Williams, T., Caballero, P., 2007b. Efficacy of
Spodoptera exigua multiple nucleopolyhedrovirus as a biological insecticide for beet
armyworm control in greenhouses of southern Spain. Biocontrol Science and
Technology 17, 221-232.
Martínez, A. M., Williams, T., Lopez-Ferber, M., Caballero, P., 2005. Optical brighteners do
not influence covert baculovirus infection of Spodoptera frugiperda. Applied and
Environmental Microbiology 71, 1668-1670.
25
Muñoz, D., Castillejo, J. I., Caballero, P., 1998. Naturally occurring deletion mutants are
parasitic genotypes in a wild-type nucleopolyhedrovirus population of Spodoptera
exigua. Applied and Environmental Microbiology 64, 4372-4377.
Muñoz, D., Murillo, R., Krell, P. J., Vlak, J. M., Caballero, P., 1999. Four genotypic variants
of a Spodoptera exigua nucleopolyhedrovirus (Se-SP2) are distinguishable by a
hypervariable genomic region. Virus Research 59, 61-74.
Murillo, R., Ruiz-Portero, C., Alcázar, D., Belda, J. E., Williams, T., Caballero, P., 2007.
Abundance and genetic structure of nucleopolyhedrovirus populations in greenhouse
soil reservoirs. Biological Control 42, 216-552.
Numerical Algorithms Group, 1993. The GLIM System: Release 4 Manual. B. Francis, C.
Green, C. Payne (Eds.), Clarendon Press, Oxford, UK.
Reeson, A. F., Wilson, K., Gunn, A., Hails, R. S., Goulson, D. 1998. Baculovirus resistance in
the noctuid Spodoptera exempta is phenotypically plastic and responds to population
density. Proceedings of the Royal Society B. Biological Sciences 265, 1787–1791.
Rothman, L. D., Myers, J. H., 2000. Ecology of insect viruses, In: C. J. Hurst (Ed.), Viral
Ecology. Academic Press, New York, USA, pp: 385-412
Shapiro, M., Robertson, J. L., 1991. Natural variability of three geographic isolates of Gypsy
moth (Lepidoptera: Lymantriidae) nuclear polyhedrosis. Journal of Economic
Entomology 84, 71-75.
Smits, P. H., Van de Vrie, M., Vlak, J. M., 1987. Nuclear polyhedrosis virus for control of
Spodoptera exigua larvae in glasshouse crops. Entomologia Experimentalis et
Applicata 43, 73-80.
Smits, P. H., Vlak, J. M., 1988. Biological activity of Spodoptera exigua nuclear polyhedrosis
26
virus against S. exigua larvae. Journal of Invertebrate Pathology 51, 107-114.
Smits, P. H., Vlak, J., 1994. Registration of the first viral insecticide in the Netherlands: the
development of Spod-X based on Spodoptera exigua nuclear polyhedrosis virus.
Mededelingen Faculteit Landbouwwetenschappen Rijksuniversiteit Gent 59/2A, 385392.
Sorrell, I., White, A., Pedersen, A. B., Hails, R. S., Boots, M., 2009. The evolution of covert,
silent infection as a parasite strategy. Proceedings of the Royal Society B. Biological
Sciences 276, 2217-2226.
Vilaplana, L., Redman, E. M., Wilson, K., Cory, J. S., 2008. Density-related variation in
vertical transmission of a virus in the African armyworm. Oecologia 155, 237-246.
Vilaplana, L., Wilson, K., Redman, E. M., Cory, J. S., 2010. Pathogen persistence in
migratory insects: high levels of vertically-transmitted virus infection in field
populations of the African armyworm. Evolutionary Ecology 24, 147-160.
Vincze, T., Posfai, J., Roberts, R. J., 2003. NEBcutter: a program to cleave DNA with
restriction enzymes. Nucleic Acids Research 31, 3688–3691.
Wang, Y., Burand, J. P., Jehle, J. A., 2007. Nudivirus genomics: diversity and classification.
Virologica Sinica 22, 128-136.
Zhou, M., Sun, S., Xincheng, S., Vlak, J., Hu, H. Z., van der Werf, W., 2005. Horizontal and
vertical transmission of wild-type and recombinant Helicoverpa armigera singlenucleocapsid nucleopolyhedrovirus. Journal of Invertebrate Pathology 89, 165-175.
27
Table 1
Logit regression of concentration-mortality results of vertically and horizontally transmitted
isolates in insects from the covertly infected Almerian and the healthy Swiss colonies.
LC50 (x 104)
Range of 95%
(OBs/ml)
C.I. (x 104)
VT-SeAl1
1.40
VT-SeAl2
Insect
Colony
and
Intercept ± SE
Potency
P
1.01 - 1.94
-6.490 ± 0.3516
1
-
3.25
2.34 - 4.48
-7.067 ± 0.3620
0.43
0.015
VT-SeOx4
1.06
0.76 - 1.47
-6.308 ± 0.3735
1.32
0.285
HT-SeG24
0.85
0.60 - 1.19
-6.158 ± 0.3465
1.65
0.088
HT-SeG25
0.59
0.41 - 0.83
-5.909 ± 0.3435
2.38
0.015
HT-SeG26
0.66
0.46 - 0.93
-5.988 ± 0.3444
2.12
0.025
VT-SeAl1
4.95
3.13 - 7.92
-7.950 ± 0.523
1
-
VT-SeAl2
7.46
4.30 - 16.1
-8.146 ± 0.5285
0.66
0.429
VT-SeOx4
4.75
3.03 - 8.08
-7.920 ± 0.5218
1.04
0.901
HT-SeG24
3.59
2.27 - 5.87
-7.714 ± 0.5158
1.38
0.341
HT-SeG25
2.27
1.46 - 3.45
-7.377 ± 0.5064
2.18
0.046
HT-SeG26
3.03
1.94 - 4.81
-7.597 ± 0.5125
1.63
0.173
Isolate
I. Almerian colony1
II. Swiss colony2
Potencies were calculated as the ratio of effective concentrations relative to the VT-SeAl1
isolate.
1
Regressions were fitted with a common slope (±SE) of 0.681 ± 0.0335
2
Regressions were fitted with a common slope (±SE) of 0.736 ± 0.0474
28
Figure legends
Fig. 1. (A) Detection of SeMNPV polyhedrin gene expression using RT-PCR. Viral
transcripts were identified using the RNA extracted from adults collected in the field. RT
products were used as a template for PCR amplification of a 319-bp fragment of the
polyhedrin gene (lanes 1-9). M, Marker; 1-9, individual Spodoptera exigua adults from field;
water control (c-) and positive control using total RNA extracted from a laboratory-infected
moribund larva (c+). (B) Percentage of field adults (males and females) with positive
amplification for SeMNPV polyhedrin by RT-PCR and the number of tested individuals in
parentheses. Values followed by identical letters did not differ significantly (Pearson's 2, P >
0.05). Values within shaded columns indicate number of transcript positive females that
produced diseased offspring out of the total number of transcript positive females in each
sample.
Fig. 2. Restriction endonuclease (REN) profiles of SeMNPV DNA originating from vertically
(VT) and horizontally (HT) transmitted genotypic variants from Spodoptera exigua collected
from greenhouses in Almeria, Spain and isolated in the laboratory, or from a laboratory
colony originating from Oxford, UK. Viral DNA was subjected to digestion in silicio using
(A) BglII or (B) EcoRV. For the SeAl1 variant, the different fragments are labeled A to T in
(A) and arrowheads indicated REN profile differences with respect to the SeAl1 variant. (C)
DNA extracted from OBs was subjected to digestion in vitro using BglII for the variants
originating from the Oxford insect colony (Se-Ox1, Se-Ox4, Se-Ox5, Se-Ox6). Asterisks
indicate polymorphic fragments and the position of a single fragment absent with respect to
isolate Se-Al1 is indicated by a circle. The position of molecular markers (M) is shown in all
cases. The vertical transmission (VT) or horizontal transmission (HT) prefixes for isolate
names have been omitted for clarity.
Fig 3. Mean percentage of DNA-polymerase transcript positive adults by RT-PCR from the
healthy Swiss population inoculated as larvae with vertically and horizontally transmitted
isolates. Values above columns followed by different letters are significantly different (t-test,
P < 0.05). Bars indicated SE.
29
Fig. 4. Mean time to kill in second instars and loge OB production/larva in fourth instars from
the healthy Swiss colony that were infected with vertically or horizontally transmitted isolates
of SeMNPV. Each point is labeled with the name of the isolate. Isolate names followed by
identical lower case bold letters did not differ significantly in loge production of OBs/larva
(Generalized linear model, P > 0.05), whereas those followed by identical upper case bold
letters did not differ significantly in speed of kill (Weibull survival analysis, P > 0.05).
Horizontal and vertical bars indicate SE. Grey shaded area indicates cluster of horizontally
transmitted isolates and is defined arbitrarily.
30
Fig 1. Cabodevilla et al.
A)
M
kb
1
2
3
4
5
6
7
8
9
c -
c+
1.5
0.3
B)
60
Sublethal infections (%)
50
47.9a (48)
37.5a (32)
36.8a (155)
40
30
Males
Females
26.9a (26)
20
18b (300)
11/12
1/7
10
6.8c (161)
1.3d (157)
0/2
0
July '06
Sept '06
July '07
1.2d (166)
0/2
Sept '07
Sample Date
31
Fig 2. Cabodevilla et al.
A) BglII
B) EcoRV
VT
M
SeAl1
HT
SeAl2
SeOx4 SeG24 SeG25
VT
SeG26
M
HT
SeAl1 SeG26
A
B
C/D
E
F/G
H/I
J/K
L
M
N
O
P
Q
R
S
T
C) BglII
Kb
M SeOx1 SeOx4 SeOx5 SeOx6
*
12 -
65-
*
432-
32
Fig. 3. Cabodevilla et al.
33
Fig 4. Cabodevilla et al.
21.0
VT-SeAl2 aB
Loge [production OBs/larva].
20.5
VT-SeAl1 bC
20.0
HT-SeG26 bcB
HT-SeG24 bcB
19.5
HT-SeG25 cB
VT-SeOx4 dA
19.0
18.5
18.0
80
85
90
95
100
105
110
115
120
Speed of kill (h)
34