SUPPLEMENTARY METHODS.
Supplementary Table 1. Sequence of the primer pairs used in the synthesis of the engineered constructs.
The restriction site added to allow cloning is underlined, and the corresponding restriction enzyme is
indicated in brackets.
CONSTRUCT
FORWARD PRIMER
REVERSE PRIMER
SH3TC2-GFP
ggaaagatctatgggtggctgcttctgcatcc (BglII)
gcgcccgcggtacgagggccaggccaccacc (SacII)
GFP-SH3TC2
ggaaagatctatgggtggctgcttctgcatcc (BglII)
gcgcccgcgggtctggccatgccaaatgtcc (SacII)
myc-SH3TC2
ggaagaattcggatgggtggctgcttctgcatcc (EcoRI)
gcgcggtaccgtctggccatgccaaatgtcc (KpnI)
SH3TC2-HA
ggaaggtaccatgggtggctgcttctgcatcc (KpnI)
gcgcgatatccgagggccaggccaccacc (EcoRV)
Δ2-6
ggaaggtaccatgcccagggagcggagtctgacc (KpnI)
gcgcgatatccgagggccaggccaccacc (EcoRV)
ΔSH3ΔTPR
ggaaggtaccatgggtggctgcttctgcatcc (KpnI)
gcgcgatatccgaagtggccttcctgtatcagg (EcoRV)
ΔTPR
ggaaggtaccatgggtggctgcttctgcatcc (KpnI)
gcgcgatatccggattcaaacccactgagcc (EcoRV)
ΔSH3 (Nt)
ggaaggtaccatgggtggctgcttctgcatcc (KpnI)
gcgcgaattcgccttcctgtatcaggagtcc (EcoRI)
ΔSH3 (Ct)
ggaagaattctattccccaatgagcagg (EcoRI)
gcgcgatatccggattcaaacccactgagcc (EcoRV)
myr-TPR1
ggaaggtaccatgggtggctgcttctgcatcc (KpnI)
gcgcgatatccggccaaggcagaaacttcacc (EcoRV)
SUPPLEMENTARY FIGURES.
Figure S1. Organellar markers that do not co-localize with SH3TC2. COS-7 cells transfected with a
plasmid encoding SH3TC2-HA were fixed and immunostained with anti-HA (green channel in all
panels), and one of the following organellar markers: anti-GRP94 for endoplasmic reticulum (A), antiPMP70 for peroxisomes (B), anti-LAMP1 for lysosomes (C). The organellar markers are shown in the
red channel, and the overlay of both channels is shown in the right panel. The scale bar is 10 µm.
Figure S2. Localization of deleted forms of SH3TC2. Different deletions (see description in Fig. 4) were
HA-tagged in their C-termini and their sub-cellular distribution revealed with anti-HA (green channel).
The variants analyzed were SH3TC2(ΔSH3ΔTPR) (A, B), SH3TC2(ΔSH3) (C, D), SH3TC2(ΔTPR) (E,
F), and SH3TC2(Myr-TPR1). We investigated co-localization with the following markers: anti-EEA1
(A), anti-M6PR (B) and Na,K-ATPase (C-H). The organellar markers are shown in the red channel and
the overlay is shown on the right panel. The scale bar is 10 µm.
Figure S3. Sub-cellular localization of the p.R658C mutant. The localisation of HA-tagged SH3TC2
harbouring the p.R658C mutation (anti-HA, green channel) was compared to the distribution of Na,KATPase (A), Clathrin-heavy chain (B), EEA1 (C) and M6PR (D). The organellar markers are shown in
the red channel and the overlay is in the right panel. The scale bar is 10 µm.
Figure S4. Histopathological studies in the sural nerve biopsy from a patient homozygous for the
p.R1109X mutation. (A) Semi-thin transverse section showing demyelinated fibres and onion bulbs. The
scale bar is 20 µm. (B) Electron micrograph showing a demyelinated axon surrounded by the excess of
basal lamina that generates the onion bulb structure. The associated Schwann cell shows a long and
attenuated morphology. The scale bar is 2 µm. Light and electron microscopy studies were performed
using standard methods as previously described in Sevilla et al. Brain 2003; 126:2023-2033.