Supplementary Materials Patients’ information. The inclusion criteria for participants are: (i) gastric adenocarcinoma with a pathological diagnosis; (ii) informed consent or waiver of consent provided by the patient; and (iii) follow-up information available. We excluded GC patients with (i) failure to provide informed consent; (ii) non-adenocarcinoma or multiple cancers; (iii) no tissue sample obtained; (iv) loss of contact after surgery; or (v) stage IV GC without palliative surgery. Among the 311 GC patients, 237 cases are with R0 resection, 63cases with R1 resection and 11 cases with R2 resection. Patients were obtained their surgical operation during 1997 to 2001. All GC patients were Asian (Chinese). 153 of 311 patients had post-surgery adjuvant chemotherapy. The combination chemotherapy regimens included folinic acid, 5-fluorouracil and oxaliplatin (FOLFOX6; 73 Cases); epirubicin, oxaliplatin and Xeloda (EOX; 12 cases); 5-fluorouracil, epidoxorubicin and mitomycin C (FEM; 9 cases); etoposide, leucovorin and 5-fluorouracil (ELF; 38 cases); mitomycin C and 5-fluorouracil (MF; 4 cases); and others (oral S-1/x, docetaxel-based and other protocols; 17 cases). All patients were followed up until January 2012. The TNM stage data for the participants were obtained from the clinical and pathological diagnoses and determined according to the NCCN guidelines for GC (Version 2, 2011). Table S1. LZTFL1 expression was associated with GC cell differentiation Cell lines name MKN28 MKN45 SGC7901 MC803 Normal immortal gastric epithelium Middle differentiation Low differentiation Low differentiation Low differentiation Low differentiation Low differentiation KatoIII NCI-N87 HGC27 Signet-ring cell Liver metatsasis Undifferentiation GES 1 BGC823 AGS LZTFL1 expression level Differentiation/Origination High High Moderate Low Low Low Low Scarce Scarce Scarce 1 Table S2. siRNA sequences used in this work Name Sequence Sense 5’UUCUCCGAACGUGUCACGUTT3’ Si-control Antisense 5’ACGUGACACGUUCGGAGAATT3’ Sense 5’GCAGAGAUUACAUCUUCAATT3’ Si-LZTFL1-homo-496 Antisense 5’UUGAAGAUCUAAUCUCUGCTT3’ 2 Table S3. Primers used in this work and their sequences Primers names Tm(oC) Sequences AGATTCCTGCTTCCAAGAC 55.4 CTGCTGTTCCACCTTCAT 55 GTCTCTCTCACCACCTCCACAG 63.8 CTCGGACACTTCCACTCTCTTT 60.07 TATCAACCAGAGGGAGTG 61.92 GCGAGGAGAGCAGGATTTCT 59.85 AGAGACAGTGGATGATGCCTTT 58.2 ATCGTCATCAAAATGGGAGTCT 56.3 TGTACCGCTATGGTTACACTCG 60.1 GGCAGGGACAGTTGCTTCT 59.7 TTTCTGGTTCTGTGTCCTCTG 58 TGTCAGCCTTTGTCCTGTAGC 60 CTGGCTGGTGGAAATGATGT 57.6 AAGGACGGCTTCTTCTCTTATG 58.2 CAGGAAGAACCCTTGAACTTGT 58.2 GGCACTTGGTGGGATTACATT 58 TCCGAAGCCAAATGACAAA 53.2 CTCTCTCTGTGGGTGTGTTGT 61.9 GAGCAAGATTCAGACCCTCAAG 60.1 CCATCCTCCAGACCGAGAAG 61.9 GAAGGTGAAGGTCGGAGTCA 60 TTCACACCCATGACGAACAT 60 LZTFL1 E-Cadherin Vimentin MMP2 MMP9 Snail ZO-1 ZEB-1 Slug Twist GAPDH 3 Figure S1. Alteration o LZTFL1 in SGC7901 or BGC823 cells does not change the cellular morphology. (A) SGC7901 cells were transfected without, with pcDNA, and with pcDNA-LZTFL1. (B) BGC823 cells were transfected without, with control and LZTFL1 siRNA. 4 Figure S2. LZTFL1 inhibits cellular phenotypes associated with EMT. (A) Migration assays of SGC7901 and BGC823 cells transfected with/without indicated plasmid or siRNA were measured by Transwell assay. Representative images for SGC7901 and BGC823 cells were shown. Cells migrated to the membrane facing the lower-chamber were stained with DAPI. (B) The invasion of cells described in (A) across matrigel-coated transcwell plates was assayed. Migrated cells were stained with 0.5% crystal violet. 5