Discovery Of A Novel Nucleotide Sequence In Taricha granulosa David J. Stanley Mentor: Frank L. Moore Department of Zoology Cell Signaling : Genomic vs Non-Genomic Genomic: Gene transcription promoted in nucleus; minutes to hours Non-Genomic: Entire signaling process takes place outside the nucleus, no transcription takes place; seconds to minutes Arginine Vasotocin (AVT) • Major physiological actions: stress response, water retention. • 3 distinct receptor isoforms : V1aR, V1bR (stress signaling), and V2R (anti-diuretic properties). • Pituitary, kidney and bladder tissues used. WhyTaricha? • V1bR has not been cloned in an amphibian. V2R has, but only in Hyla japonica (Japanese tree frog). • Simple, predictable behavior to stimulus. • Relative simplicity of brain allows for analysis of neuronal mechanisms. • Similarity of Taricha brain to human limbic system. • Abundant in our local environment. Investigative Strategy RNA extraction cDNA synthesis by Reverse transcription Sequence PCR product Design primers Amplification of desired gene by PCR Analysis of PCR products mRNA 4 cDNA Random hexamers ( ) SuperScript II reverse transcriptase Application of RNAase H Single cDNA strand Primer Design Sequences aligned by ClustalW program: Forward 4 Mouse V2R Human V2R Cow V2R Rat V2R CATGTATGCCTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACC CATGTATGCCTCTTCCTACATGATCCTGGCCATGACACTAGACCGCCATC CATGTATGCCTCCTCCTACATGATCCTGGCCATGACACTAGACCGCCATC CATGTATGCCTCCTCCTACATGATCCTGGCCATGACACTAGACCGCCATC ************ *********************** ** ******** * 3Reverse Mouse V2R Human V2R Cow V2R Rat V2R GTGCCATCTGCCGTCCCATGCTGGCGTACCGCCATGGAAGTGGGGCTCAC GCGCCATCTGCCGCCCTATGCTGGCATACCGCCATGGAGGTGGGGCTCGC GTGCCATCTGCCGCCCTATGCTAGCATACCGCCATGGAGGTGGGGCTCGC GTGCCATCTGCCGCCCCATGCTGGCACACCGCCATGGGGGTGGCACTCAT * *********** ** ***** ** ********** **** *** * = conserved nucleotide Considerations: - Melting or annealing temperature, length of primer. - GC Clamps. - Self-annealing should be avoided. - Position of any degeneracies. - % GC content. Primer Use / RT-PCR Primer cDNA Template 3’ 5’ Primers :Forward Reverse: N = 2^0 N = 2^1 N = 2^2 N = 2^3 PCR Analysis Thermal Gradient PCR Bands expected at 320 bp Bands expected at 420 bp Screening of ligated products Justification • Sequences can provide clues leading to an understanding of the structure, pharmacological profile, distribution of expression, and regulation of a protein. • Phylogenetics – Evolutionary relationships can be inferred based on sequence comparisons. • Proteins of a known nucleotide sequence can be expressed in any quantity desired. Further Investigations • Primers based on Hyla V2R sequence could be more effective. Acknowledgements Howard Hughes Medical Institute National Science Foundation Dr. Frank L. Moore Sam Bradford Eliza Walthers And last but not least…The Newts