Pre- and Postmating Reproductive Isolation in Populations of the Red-sided Garter Snake By Rachel McAlister Mentors: Drs. Robert Mason, Suzanne Estes, & Steve Arnold Department of Zoology Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection (R.A. Fisher 1930). Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection. premating reproductive isolation- behavior preventing individuals from mating and producing offspring. Male Female gold finches choose mates based on the color and the brightness of their plumage. Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection. post-mating reproductive isolation- prevents a hybrid produced by two different species from developing into a viable, fertile adult. = X Horse Donkey Mule (Sterility) Postmating reproductive isolation also occurs as a result of reduced fitness and increased mortality of hybrid offspring. Non-hybrid Hybrid Evolutionary theory predicts that during a speciation event, premating reproductive isolation will evolve faster than postmating reproductive isolation in populations undergoing sexual selection. sexual selection- A difference between the mating success of individuals with a particular phenotype versus individuals with a different phenotype. Galapagos Island Marine Iguana Male-male competition (Body size and aggressiveness) Peacock Female choice (Tail length and elaboration) Most research on reproductive isolation is conducted between species, not between populations—the level at which speciation generally occurs. Research Question Does premating reproductive isolation evolve faster than postmating reproductive isolation in populations of the red-sided garter snake? Red-sided Garter Snake (Thamnophis sirtalis parietalis) Mate after spring emergence Females can store sperm Highly philopatric-always return to the same den Island-like populations (geographically distinct populations) Populations differ phenotypically Body size Coloration Female pheromone composition Levels of premating isolation Experience sexual selection on body size Methods: Collected males and females from 2 populations in Manitoba, Canada during May 2003 Snake Island Inwood * * * * Methods: Premating Reproductive Isolation Simultaneous choice tests 20 Snake Island ♂ 1 Snake Island ♀ 1 Inwood ♀ 20 Inwood ♂ 1 Snake Island ♀ 1 Inwood ♀ Results: No evidence (yet) for premating isolation Premating Isolation 1.0 N=6 N=6 Snake Island males MAY prefer their own females over Inwood females. 0.5 0.0 -0.5 Inwood Snake Isl. Snake Male Population Methods: Postmating Reproductive Isolation Within- and between-population crosses: within { Inwood ♀ X Inwood ♂ Snake Isl. ♀ X Snake Isl. ♂ Inwood ♀ X Snake Isl. ♂ Inwood ♂ X Snake Isl. ♀ Methods: Postmating Reproductive Isolation Within- and between-population crosses: between { Inwood ♀ X Inwood ♂ Snake Isl. ♀ X Snake Isl. ♂ Inwood ♀ X Snake Isl. ♂ Inwood ♂ X Snake Isl. ♀ Methods: Postmating Reproductive Isolation Body Mass SVL (Snout-Vent Length) & Tail Length Snout Body Condition—regression of SVL on mass Vent/Genitalia Results: No evidence (yet) for postmating isolation (Hybrids) (Hybrids) Standardized Means 2.5 2.0 Inwood♀ x Inwood♂ Inwood♀ x Snake♂ (Hybrids) Snake ♀ x Snake♂ Snake♀ x Inwood♂ 1.5 Mass1 SVL1 1.0 Condition1 Tail length 0.5 0.0 -0.5 Cross Results: No evidence (yet) for postmating isolation Postmating isolation reduction in hybrid fitness correlates compared to within-population offspring (Hybrids) (Hybrids) Standardized Means 2.5 2.0 Inwood♀ x Inwood♂ Inwood♀ x Snake♂ (Hybrids) Snake ♀ x Snake♂ Snake♀ x Inwood♂ 1.5 Mass1 SVL1 1.0 Condition1 Tail length 0.5 0.0 -0.5 Cross Results: No evidence (yet) for postmating isolation Hybrid Vigor? (Hybrids) (Hybrids) Standardized Means 2.5 2.0 Inwood♀ x Inwood♂ Inwood♀ x Snake♂ (Hybrids) Snake ♀ x Snake♂ Snake♀ x Inwood♂ 1.5 Mass1 SVL1 1.0 Condition1 Tail length 0.5 0.0 -0.5 Cross BUT, because females store sperm, paternity of individual offspring is unknown… Paternity Assignment Is postmating isolation data confounded by multiple paternity of litters? How many fathers are responsible for a given litter? Sperm precedence: How many offspring sired by experimental male vs. stored sperm? Methods: Paternity Assignment Determining paternity using two microsatellite markers a) Collect tail tips from known parents & offspring b) Tissue digestion c) DNA extraction d) DNA amplification -Polymerase chain reaction (PCR) e) Genotyping f) Paternity assignment by exclusion microsatellite GCATACACACACACGAGGTGAC Results: Extensive multiple paternity Multiple paternity was detected in 68% of the litters (15/22) 16 14 Most litters sired by at least 2 males One litter sired by at least 3 males Frequency 12 10 8 6 4 2 0 1 2 3 Number of sires per litter Experimental males sire 63% of each litter on average. However, for betweenpopulation crosses, experimental males sire fewer offspring than experimental males in within-population crosses. Fraction of litters sired by experimental male Results: Sperm Precedence (non-significant) 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 N =11 N =11 Between-population Within-population 0 Cross Type Conclusions Multiple paternity is common in T. s. parietalis litters 68% of litters were sired by 2 or more males Data on postmating reproductive isolation (i.e., offspring fitness) is likely confounded by multiple paternity. Only about half of each litter was sired by the experimental male; half was sired by stored sperm Research Question Does premating reproductive isolation evolve faster than postmating reproductive isolation in populations of the red-sided garter snake? Future Directions Reanalyze offspring fitness data taking paternity into account (Hybrids) Standardized Means 2.5 2.0 Inwood♀ x Inwood♂ Inwood♀ x Snake♂ (Hybrids) Snake ♀ x Snake♂ Snake♀ x Inwood♂ 1.5 Mass1 SVL1 1.0 Condition1 Tail length 0.5 0.0 -0.5 Cross Future Directions Within- and between-population crosses were repeated and offspring await paternity analysis Mating trials will be repeated in May 2005 Acknowledgements Dr. Suzanne Estes Dr. Robert Mason Dr. Steve Arnold HHMI Dr. Kevin Ahern Premating Isolation Premating isolation = within-population – between-population pairings pairings total number of pairings Hybrid (between-population) litters have more sires represented than do nonhybrid (within-population) ones Average # of sires/litter Results: Extensive Multiple Paternity NS (non-significant) 2.5 2.0 1.5 1.0 0.5 N =11 N =11 Between-population Within-population 0.0 Cross Type