PhIP-induced Mutation in Mlh1-deficient Mice Stacy Hill 6/28/2016 Stacy Hill Buermeyer Lab Group 1 Significance 2-5% of all colorectal cancer cases in humans result from a genetic predisposition called hereditary nonpolyposis colorectal cancer (HNPCC). HNPCC is the most commonly inherited form of colorectal cancer. Those who have inherited HNPCC have an 80% risk of developing an early onset internal cancer, such as colorectal cancer. 6/28/2016 Stacy Hill Buermeyer Lab Group 2 HNPCC Syndrome & Mlh1 HNPCC is a syndrome caused by inherited defects in DNA Mismatch Repair (MMR). There are 4 different MMR genes linked to HNPCC, Mlh1 and Msh2 being the most common. Most HNPCC individuals have normal MMR activity in their cells, due to the fact that they are heterozygous for their MMR mutation. In the rare event that an individual is born with no proficient MMR activity, the individual usually dies by the age of 5 years. 6/28/2016 Stacy Hill Buermeyer Lab Group 3 HNPCC Syndrome Individual cells that become homozygous deficient for Mlh1 are at high risk for becoming cancers. 6/28/2016 Stacy Hill Buermeyer Lab Group 4 Risk Factors Of HNPCC Little is known about the modulation of cancer risk by environmental factors, such as heterocyclic amines (HCA). Mlh1-/- mice can be used to identify modulators of cancer risk associated with MMR deficiency. Research Question: Does HCA exposure actually increase the risk of cancer development in an individual with MMR deficiency? 6/28/2016 Stacy Hill Buermeyer Lab Group 5 What Are Heterocyclic Amines? Heterocyclic amines (HCA) are the carcinogenic chemicals formed from the cooking of muscle meats such as beef, pork, fowl, and fish. HCA form when amino acids and creatine (a chemical found in muscles) react at high cooking temperatures. Frying, broiling, and barbecuing produce the largest amounts of HCA because the meats are cooked at very high temperatures. 6/28/2016 Stacy Hill Buermeyer Lab Group 6 What Are We Afraid Of? 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) PhIP is the most abundant HCA, which we are currently using for analysis. MMR deficient cells have been shown to be hypermutable by exposure to PhIP in cell culture. 6/28/2016 Stacy Hill Buermeyer Lab Group 7 Experimental Model We use genetically engineered mice to model cancer predisposition in individuals with MMR deficiency. Wildtype Mice PhIP Vehicle 6/28/2016 Mlh1-/- Mice Stacy Hill Buermeyer Lab Group PhIP Vehicle 8 Study Design PhIP vs. Vehicle Mutagenesis 6/28/2016 Tumorigenesis Stacy Hill Buermeyer Lab Group Cell Turnover 9 Research Focus Mutagenesis The level of mutations, induced by PhIP, in both wildtype (normal) mice and in Mlh1-/- mice. Mlh1-/- or “knockout” mice are Mlh1-deficient. Mutations resulting from PhIP exposure are believed to be a result of the formation of PhIPDNA adducts, primarily to guanine residues. 6/28/2016 Stacy Hill Buermeyer Lab Group 10 Characterizing PhIP-induced Mutations A recoverable lambda shuttle vector, previously integrated into the mouse genome, will be used to characterize mutations. Illustration of the mouse chromosome. 6/28/2016 Stacy Hill Buermeyer Lab Group 11 Recovering Lambda Phage Isolating Genomic DNA Mutation Selection Phage Packaging 6/28/2016 Stacy Hill Buermeyer Lab Group G1250 E.coli infection 12 The Selection Process 6/28/2016 Stacy Hill Buermeyer Lab Group 13 Data Analysis All of the plates are then collected and the number of visible plaques, or plaque forming units (pfu) are counted, to determine mutation frequency (MF). MF = # of pfu 24ºC ‘ # of pfu 37ºC x Dilution Factor Plaques are then purified and the cII gene is sequenced. Then mutations are determined. 6/28/2016 Stacy Hill Buermeyer Lab Group 14 Mutation Frequency Results (Mutation Frequency) 1.20E-03 1.00E-03 8.00E-04 6.00E-04 Vehicle PhIP 4.00E-04 2.00E-04 0.00E+00 Wildtype Knockout Treatment Group PhIP-induced mutations: 6/28/2016 Wildtype Knockout 6 x 10-5 47 x 10-5 Stacy Hill Buermeyer Lab Group 15 Results (cII Gene Map) PhIP n=35 C T A T T A KO 5Х-ATGGTTCGTGCAAACAAACGCAACGAGGCTCTACGAATCGAGAGTGCGTTGCTTAACAAAATCGCAATGCTTGGAACTGAGAAGACAGCGGAAGCTGTGGGCGTTGATAAGTCGCAGATCA Vehicle A AG A A C A T A G T n=50 G A A T T G s t T s tt C G s PhIP n=35 T T t s A C T C T ss s GCAGGTGGAAGAGGGACTGGATTCCAAAGTTCTCAATGCTGCTTGCTGTTCTTGAATGGGGGGTCGTTGACGACGACATGGCTCGATTGGCGCGACAAGTTGCTGCGATTCTCACCAATAAAAAACGC Vehicle n=50 G G ss s G T T s s s t s A PhIP n=35 CCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGA -3Х Vehicle n=50 PhIP n=12 A T T A A T A WT 5Х-ATGGTTCGTGCAAACAAACGCAACGAGGCTCTACGAATCGAGAGTGCGTTGCTTAACAAAATCGCAATGCTTGGAACTGAGAAGACAGCGGAAGCTGTGGGCGTTGATAAGTCGCAGATCA Vehicle n=2 A A PhIP n=12 T T t T A GCAGGTGGAAGAGGGACTGGATTCCAAAGTTCTCAATGCTGCTTGCTGTTCTTGAATGGGGGGTCGTTGACGACGACATGGCTCGATTGGCGCGACAAGTTGCTGCGATTCTCACCAATAAAAAACGC Vehicle n=2 PhIP n=12 CCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGA -3Х Vehicle n=2 t =independent insertion =non-independent insertion s =independent deletion =non-independent deletion 6/28/2016 Stacy Hill Buermeyer Lab Group 16 Results (Mutation Spectrum) Colon Total Mutants WT Vehicle 2 0 (0%) Frameshifts WT PhIP 12 KO Vehicle 50 1 (8%) 1 +G -G +A -A Other KO PhIP 37 28 (56%) 3 11 19 (54%) 4 9 13 1? 6 2 (100%) 11 (92%) 22 (44%) 18 (46%) Transitions G:C A:T A:T G:C 2 2 3 2 1 19 12 7 8 8 Transversions G:C C:G G:C T:A A:T C:G A:T T:A 0 8 3 2 1 10 5 5 Base Substitutions 6/28/2016 7 1 Stacy Hill Buermeyer Lab Group 17 Summary Mlh1-/- mice were hypersensitive to PhIPinduced mutations in the colon. Most PhIP-induced mutations in both wildtype and knockout mice involved G/C base pairs. Preliminary data suggest Mlh1-/- mice are hypersensitive to PhIP-induced carcinogenesis. PhIP, and perhaps other HCA, exposure may increase cancer risk in people with MMR deficiencies. 6/28/2016 Stacy Hill Buermeyer Lab Group 18 Acknowledgements Howard Huges Medical Institute (HHMI) Undergraduate Research Innovation Scholarship Creativity (URISC) Stephanie Smith-Roe Andrew Buermeyer Kevin Ahern 6/28/2016 Stacy Hill Buermeyer Lab Group 19