Veterinary Immunology and Immunopathology 108 (2005) 373–385
www.elsevier.com/locate/vetimm
Differential expression of inducible nitric oxide synthase
and cytokine mRNA in chicken lines divergent for
cutaneous hypersensitivity response
N.R. Sundaresan b,1, K.A. Ahmed a,1,*, V.K. Saxena a,*, K.V.H. Sastry a,
M. Saxena b, A.B. Pramod b, M. Nath a, K.B. Singh d, T.J. Rasool c,
A.K. DevRoy a, R.V. Singh a
a
Disease Genetics and Biotechnology Laboratory, Central Avian Research Institute, Izatnagar 243122, Bareilly, India
b
Indian Veterinary Research Institute, Izatnagar 243122, Bareilly, India
c
Indian Veterinary Research Institute, Mukteswar 263138, Uttaranchal, India
d
M.J.P. Rohilkhand University, Bareilly 243006, India
Received 3 March 2005; received in revised form 21 June 2005; accepted 21 June 2005
Abstract
Phytohemagglutinin (PHA)-induced delayed-type hypersensitivity is an immunocompetent trait considered an indicator of
cell-mediated immune or T-cell responses. Divergent selection was performed to generate high and low lines for response to
PHA-P. Extreme-responder birds of the F2 generation in each line were used to study possible differences in macrophage activity
and the associated functional genes. To evaluate macrophage activity, nitric oxide (NO) was estimated both systemically in
serum and in in vitro monocyte culture. Semi-quantitative RT-PCR was used to detect the differential mRNA expression patterns
of iNOS and MIP-1b in monocyte culture, whereas TH1 cytokines (IL-2 and IFN-g) were studied in peripheral blood
mononuclear cells (PBMC) at different time intervals after lipopolysaccharide (LPS) induction. The high line showed strong
systemic, as well as in vitro NO production, compared to the low line, upon stimulation with NDV and LPS, similar to early and
high iNOS mRNA expression. Following the pattern of iNOS gene expression, an early strong expression of cytokines with
powerful iNOS-inducing action, such as IFN-g and the chemokine MIP-1b, was observed in the high line. In contrast, for
response to PHA-P, low expression of IL-2 was observed in the high compared to the low line. In conclusion, the study revealed
that divergent selection for response to PHA-P resulted in a divergent effect on TH1 cell activity, resulting in altered macrophage
function in chickens. Selection, based on response to PHA-P, could lead to more resistant birds or birds with an enhanced
immune response.
# 2005 Elsevier B.V. All rights reserved.
Keywords: Divergent selection; PHA-P; Chicken; NO; iNOS; IFN-g; IL-2; MIP-1b
* Corresponding authors. Tel.: +91 581 231 0216; fax: +91 581 230 1321.
E-mail addresses: ashfaque_anjuman@yahoo.co.in (K.A. Ahmed), visheshmeeta@rediffmail.com (V.K. Saxena).
1
Both authors contributed equally.
0165-2427/$ – see front matter # 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetimm.2005.06.011
374
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
1. Introduction
For the commercial poultry breeder, the improvement of economic traits has been the main focus of
various programs, whereas the immunocompetence of
a flock is a particularly difficult trait to select (Fulton,
2004). In commercial poultry production, disease is
the major limiting factor and, in various diseases, cellmediated immune response plays an important role
(Baba et al., 1978; Sharma, 1981; Omar and Schat,
1996; Ara et al., 2004). Indirect selection, based on
immunocompetent traits or marker genes, has been
adjudged the best long-term strategy for developing
disease-resistant stock (Lamont, 1998). Immuneresponse mechanisms to various antigens have been
studied in chicken lines developed through different
selection criteria (Heller et al., 1992; Parmentier et al.,
1998; Sarker et al., 2000; Pitcovski et al., 2001;
Pinard-van der Laan et al., 2004). Phytohemagglutinin
(PHA)-induced delayed-type hypersensitivity (Parmentier et al., 1993) is an immunocompetent trait
considered an indicator of cell-mediated immune
response (CMI) or T-cell response (Klesius et al.,
1977; Corrier and DeLoach, 1990; Terrence et al.,
2002). Limited information is available in literature on
PHA-P response as a selection criterion and very little
is known about the effect of PHA-P selection on innate
and acquired immunity in chickens.
Delayed-type hypersensitivity (DTH) response is
characterized by a large influx of nonspecific
inflammatory cells, in particular, macrophages. As
macrophages accumulate at a DTH reaction site, they
are activated by cytokines. Activated macrophages
efficiently mediate activation of more T-cells, which in
turn secrete more cytokines that recruit and activate
even more macrophages. DTH-like reactions are
mediated by a TH1 subset of CD4+ TH cells, which
secrete IL-2, IFN-g, TNF-b and GM-CSF cytokines,
and are responsible for many cell-mediated functions.
Cytokines from TH1 cells, particularly IL-2 and IFNg, mediate the differentiation of fully cytotoxic T-cells
from CD8+ precursors. Moreover, IFN-g and TNF-b
are responsible for macrophage activation. This
activation results in increased expression of MHC
class II molecules and TNF receptors, as well as
production of oxygen radicals and nitric oxide (NO),
in macrophages (Goldsby et al., 2003). Nitric oxide is
produced by macrophages through activation of the
inducible enzyme, nitric oxide synthese (Djeraba
et al., 2000), which has powerful antiviral and
anticancer properties (Stuehr and Nathan, 1989; Xie
and Nathan, 1994). In chicken macrophages, expression of inducible nitric oxide synthese (iNOS) gene is
under genetic control and associated with toll-like
receptor-4 expression (Dil and Qureshi, 2002).
Furthermore, chicken monocytes and macrophages
have been shown to secrete macrophage inflammatory
protein-1b (MIP-1b), a chemotactic factor attracting
lymphocytes, especially T-cells (Oguccioni et al.,
1995; Tedla et al., 1998). MIP-1b has also been shown
to be a potent and effective modulator of adaptive
mucosal immunity (Lillard et al., 2003).
The mechanism of delayed-type hypersensitivitylike reaction is relatively complex, and identification
of the cellular and molecular events inherent in this
phenomenon is still incomplete (Terrence et al.,
2002). A clearer understanding of the effect of
selection based on DTH-like reaction is pertinent
because it represents a form of cell-mediated
immunity and, as such, has the potential to provide
the tools for protection against intracellular pathogens (Lausch et al., 1987; Szczepanik et al., 2003).
The aim of this study was to analyze possible
differences in macrophages activity and the associated functional genes between lines divergently
selected for PHA-P or DTH responses. Lipopolysaccharide (LPS) has been found to be a potent
activator of immune and inflammatory cells, resulting
in induction of various pro-inflammatory cytokines
and cytotoxic molecules through TLR-4-mediated
host-cell signaling (Dil and Qureshi, 2002). In an
earlier study (F1 generation), with high and low
responder lines to PHA-P, differential expression of
iNOS and MIP-1b genes, on induction of macrophages with LPS, were obtained (Sundaresan, 2004).
These results prompted a further exploration in the F2
generation, the effect of selection on gene expression
patterns studied earlier and TH1-secreted cytokines.
To gain a more detail insight, expression of iNOS
gene and the NO production capacity of macrophages
were studied and, at the same time, expression of the
NO-inducing chemokine MIP-1b (Villata et al.,
1998), TH1 cytokines, i.e. IFN-g with powerful
iNOS-inducing properties (Vilcek and Oliveira,
1994) and the IL-2 role in T-cell proliferation were
included.
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
2. Materials and methods
2.1. Genetic background of experimental birds
The white-plumaged synthetic broiler dam line
(SDL), utilized in the study, has been undergoing longterm selection for economic traits, mainly, juvenile
body weight and egg number. However, for the last
two generations, divergent selection for response to
phytohemagglutinin-P (PHA-P) has also been performed.
2.2. Assessment of PHA-P response
In vivo CMI response to PHA-P was evaluated in
each individual bird at 4–5-week-old by the method of
Corrier and DeLoach (1990), with some modifications.
Briefly, a solution of PHA-P (1 mg/ml; BactoTM;
Bacton Dickinson, Sparks, MD, USA) was prepared in
sterile phosphate-buffered saline (PBS). PHA-P solution (0.1 ml, i.e. 100 mg) was injected intradermally
into the space between the 3rd and 4th digit of the right
foot. The left foot served as control and received the
same amount of sterile PBS. The thickness of both foot
webs at the site of injection was measured using a dialtype micrometer at 0 and 24 h post-injection. Changes
in foot web thickness, referred to as foot web index
(FWI), were calculated using the following formula:
FWI = increase in thickness of the right foot web (PHAP) increase in thickness of the left foot web (PBS).
The FWI was converted into absolute percentage values
over that of initial 0-h values (mean of left and right foot
web thickness).
2.3. Divergent selection for PHA-P
Divergent selection for cell-mediated immune
response was carried out following the method of
Afraz et al. (1994). Divergent selection for high cellmediated immunity (HCMI) and low cell-mediated
immunity (LCMI) commenced from a base population
of 1546 individuals. In each generation, 5% males and
30% females from extreme responders (birds showing
higher response to PHA-P in HCMI line and those
showing lower PHA-P response in LCMI line) were
selected to produce progeny in next generation. In
HCMI line, males with high PHA-P response were
mated with high PHA-P responder females. Similarly,
375
in LCMI line, males with low PHA-P response were
mated with females having low PHA-P response. In
each line, six to eight females were mated with a single
male and a total of eight males were used. In the F1
generation, 398 individuals in HCMI and 392
individuals in LCMI lines were screened for PHA-P
response. Similarly, in the F2 generation, 565 birds in
HCMI and 497 birds in LCMI lines were screened. For
the present study, 20 extreme responders from each
HCMI and LCMI line in the F2 generation were
selected and utilized.
2.4. Differential expression of iNOS and cytokine
genes
2.4.1. Sample size
Six birds were randomly selected from the 20
extreme responders in each HCMI and LCMI line for
differential expression analysis.
2.4.2. Adherent monocytes culture
Two millilitres of heparinzed venous blood was
obtained from the extreme responders, under experimental conditions, in the HCMI and LCMI lines,
layered on 2 ml Histopaque-1077 (Sigma Diagnostics,
St. Louis, MO, USA) and centrifuged at 800 g for
15 min. Mononuclear cells at the interphase were
collected and washed three times with RPMI 1640
medium (Sigma). Washed cells were then dispensed in
six-well tissue-culture plates (Nunc, City, Denmark)
containing RPMI 1640 medium supplemented with
10% fetal calf serum (FCS; Sigma), 2 mM Lglutamine, 2 mM L-arginine, penicillin (1000 IU/ml)
and incubated for 4 h in 5% CO2 tension at 41 8C in a
humidified chamber. Non-adherent cells in the supernatant were decanted and adherent cells washed three
times. Adherent monocytes were harvested by gentle
friction with a rubber policeman and flushing with
medium. Harvested monocytes from each bird were
stained with trypan blue for cell viability assessment
and counted in a hemocytometer (Fein-Optik, Jena,
Germany) to adjust the concentration to 2 106 cells
per ml in RPMI-1640 medium. Cells were plated on
24-well tissue-culture plates (Nunc), in triplicate for
each time interval (3, 6 and 9 h), under 5% CO2
tension in a humidified atmosphere. Lipopolysaccharide from Escherichia coli (Sigma) was added (at a rate
of 1 mg/ml of medium) to each well for induction.
376
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
Table 1
Sequences of PCR primers for b-actin, iNOS and cytokines mRNA
Gene
Accession Number
Forward primer
Reverse primer
Product size
b-Actin
IFN-g
IL-2
iNOS
MIP-1b
L08165
AJ634956
AJ578467
U46504
L34553
CATCACCATTGGCAATGAGAGG
ATGACTTGCCAGACTTACAACTTG
ATGATGTGCAAAGTACTGATC
AGGCCAAACATCCTGGAGGTC
ATTGCCATCTGCTACCAGACCT
GCAAGCAGGAGTACGATGAATC
TTAGCAATTGCATCTCCTCTGAGA
TTATTTTTGCAGATATCTCAC
TCATAGAGACGCTGCTGCCAG
TCAGGTAGCTCTCCATGTCACA
353
495
432
371
322
2.4.3. Peripheral blood mononuclear cells
(PBMC) culture
Two millilitres of haparinized blood was first
depleted of thrombocytes by low-speed centrifugation. The buffy coat was then layered on Histopaque
(Sigma) and centrifuged for 15 min at 800 g. Cells
at interphase were collected and washed three times
with medium. Viability of these cells was assessed
using trypan blue staining and the cells were counted
in a hemocytometer and the concentration adjusted to
2 106 cells per ml in RPMI-1640 medium. Like
monocytes, PBMC from each line were placed on 24well tissue-culture plates, in triplicate for each time
interval (0.5, 1, 2, 3, 4, 5 and 6 h), and induced with
1 mg of LPS/ml of medium.
2.4.4. Semi-quantitative RT-PCR
Induced monocytes and PBMC, along with
uninduced controls, were harvested by low-speed
centrifugation at regular time intervals after induction
(3, 6 and 9 h for iNOS, MIP-1b and b-actin from
monocytes and 0.5, 1, 2, 3, 4, 5 and 6 h for IFN-g, IL-2
and b-actin from PBMC) to study the kinetics and
mRNA expression of these genes. Total RNA was
extracted from harvested cells at each time interval by
the RNAgents—Total RNA isolation system (Promega, Madison, WI, USA), according to the
manufacturer’s instructions. Concentrations and purities of RNA preparations were determined spectrophotometrically using absorbance at 260 and 280 nm.
The A260/A280 ratio of the samples was >1.8. To
confirm the integrity of the RNA and assess possible
DNA contamination, 4 ml of each total RNA sample
was electrophoresed on agarose gel, containing
formaldehyde (Sambrook and Russell, 2001) and
visualized by ethidium bromide staining. Possible
traces of genomic DNA were removed by treating
5 mg of each RNA samples with 5 U of RNase-free
DNase at 37 8C for 1 h. DNase was subsequently
inactivated by incubation at 65 8C for 10 min. Each
Dnase-treated total RNA sample (1 mg) from both
lines was reverse-transcribed using the RevertAid
First strand cDNA synthesis kit (MBI Fermentas,
Hanover, MD, USA) according to the manufacturer’s
instructions. Negative controls were performed using
all components, but without added reverse transcriptase. Total RNA from chicken spleen was used for
positive controls and for establishing reaction conditions. The resultant cDNA was stored frozen at 20 8C
until further use.
Duplicate parallel PCR reactions were performed
in a thermal cycler (iCycler; Bio-Rad, Hercules, CA,
USA) on equal aliquots of cDNA from both lines, in
separate tubes, for the amplification of iNOS, IFN-g,
MIP-1b IL-2 and b-actin. The amplification mixture
for each sample was made up to a final volume of
25 ml, containing 10 pmol each of a 30 and a 50 genespecific primer, designed from the exons spanning
intron(s) to ensure further purity of the RNA used to
generate cDNA (Table 1) (Qiagen Operon Cologne,
Germany), 2 ml cDNA, 10 mM Tris–HCl (pH 8.8),
50 mM KCl, 2.5 mM MgCl2, 2.5 mM deoxynucleotide triphosphate and 1 Unit Taq DNA polymerase
(Promega). PCR conditions for each primer were
optimized. Separate plasmids (pGEM-T; Promega),
with inserts for iNOS, IFN-g, MIP-1b, IL-2 (used
from our laboratory), were amplified as a positive
control. Negative controls were samples in which (1)
the reverse transcriptase was omitted in the RT step to
test for DNA contamination and (2) Taq polymerase
was not added. PCR reaction conditions were defined
for each cytokine primer pair to obtain a linear
relationship of RNA and the final PCR product. The
number of cycles used to amplify each cDNA was
chosen to enable the PCR to proceed in a linear range
in the preliminary experiments. Amplification conditions were identical for all genes, except for annealing
temperature: 94 8C for 5 min and 35 cycles of 45 s at
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
94 8C, 45 s at 60 8C for iNOS, MIP-1b and b-actin (29
cycles), 50 and 52 8C for IL-2 and IFN-g, respectively,
and 1 min at 72 8C and a final extension of 5 min at
72 8C, for all the targets tested. Ten microlitres of each
PCR mixture was electrophoresed through 1.5%
agarose gels, stained with 0.5 mg of ethidium bromide
per ml, visualized with a UV transilluminator and
photographed. PCR product sizes were verified by
comparison with a 100-bp DNA ladder (GeneRular;
Fermentas) and quantitative DNA ladder (E-Gel;
Invitrogen, Carlsbad, CA, USA) run parallel on the
same gel.
377
amount of copper–cadmium alloy filings (approximately 100 mg), were added and incubated at 30 8C
for 1 h with gentle shaking. After 1 h, 100 ml of
0.35 M sodium hydroxide and 400 ml of 0.12 M zinc
sulphate was added and incubated for 10 min at room
temperature. The tubes were centrifuged at 4000 rpm
for 10 min and the supernatant transferred to wells of
microtiter plates in triplicate. Then, 75 ml of 1%
sulphalinamide and 75 ml of 0.1% N-naphthalene
diamine were added with gentle mixing. After a 10min incubation, the absorbance was measured at
545 nm in an ELISA reader (SpectaMAX; Molecular
Devices, City, State, USA). Negative and positive
controls were also loaded in parallel on the same plate.
RPMI 1640 medium was taken as blank. Nitrite
concentrations were determined using sodium nitrite
as standard.
2.4.5. Determination of cytokine mRNA
concentration
LPS-induced monocytes and PBMC of both lines
yielded products of expected sizes, following PCR
with gene-specific primers (IFN-g, IL-2, MIP-1b,
iNOS), whereas no detectable products were found in
uninduced controls. To regulate efficiency variations
in the RT step among different experimental samples,
b-actin mRNA concentrations (a ‘house-keeping’
gene, presumed to be expressed in constant amounts)
were also calculated, along with all cytokine mRNA
concentrations of targeted genes, by densitometry
analysis (Djeraba et al., 2002; Lindenstrom et al.,
2004), using Gene tool software (Syngene, City, State,
USA). Relative expression was determined as
arbitrary units, defined as the ratio of mRNA level
to the corresponding b-actin mRNA level after
subtraction of background intensity [value = (intensity; gene of interest intensity; background)/(intensity; b-actin intensity; background)]. Mean values
of three measurements of each band were taken for
analysis.
The Fuller strain of Newcastle disease virus (NDVF1) was used as live vaccine for the induction of in
vivo NO. All day-old chicks in both lines were
immunized occulo-nasally with an 106.5 EID50 dose
of NDV-F1 strain as per standard procedures.
Unvaccinated control birds in each line (20 birds
per line) were also maintained. All chicks from both
lines were bled, along with unvaccinated controls, on
days 14, 28 and 42 post-immunization (dpi). Serum
was separated and inactivated at 56 8C for 30 min and
stored at 20 8C until the completion of selection.
After selection, total serum nitrite and nitrate were
estimated (Sastry et al., 2002) from serum samples of
extreme responders (n = 20) in both lines, along with
controls.
2.5. In vitro NO production assay
2.7. Statistical analysis
Selected 20 extreme responders of the HCMI and
LCMI lines were utilized for in vitro NO production
assay. Monocytes were cultured separately for each
sample, as mentioned earlier (Section 2.4.2). The cellfree supernatant was harvested at different time
intervals (0, 3, 6, 9, 12, 15 and 20 h after induction)
and NO estimation was carried out as per the method
of Sastry et al. (2002). Briefly, 100 ml of sample or
standard was placed in a test-tube to which 400 ml of
0.55 M carbonate buffer (pH 9.0), followed by a small
Electrophoretic band intensities of PCR products
were quantified. Mean iNOS, MIP-1b, IFN-g and IL-2
expression levels were normalized against b-actin
levels and presented in arbitrary units. In vivo and in
vitro nitrite levels were analyzed using least-square
analysis (Harvey, 1975), considering a fixed-effect
model with interaction. Sub-class means for effects
that showed significant differences were compared by
Duncan’s multiple-range test (Duncun, 1955), as
modified by Kramer (1964).
2.6. In vivo NO assay
378
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
3. Results and discussion
DTH is an important in vivo manifestation of T-cell
immunity, whose elicitation depends on several cell
types that contribute to the final local inflammatory
and tissue swelling response (Szczepanik et al., 2003).
Afraz et al. (1994) conducted a two-way selection for
delayed-type hypersensitivity reaction to intradermal
injection of BCG into the wattle of chickens, but there
is a dearth of literature on phytohaemagglutinin-P
(PHA-P), which specifically induces TH cells. In the
present study, PHA-P was used to elicit a cutaneous
hypersensitivity reaction in chickens for the development of divergent lines, i.e. high and low responders to
PHA-P. To our knowledge, this is the first study on
macrophage activity and the genes controlling TH1mediated functions in birds divergently selected for
response to PHA-P.
Divergent selection was performed on a base
population whose overall mean in vivo response to
PHA-P, i.e. foot web index (FWI) was 44.5 0.08%.
In the F1 generation, the overall mean PHA-P
response in HCMI and LCMI lines was 47.16 1.92 and 39.99 1.83%, respectively, which were
significantly different. In the F2 generation, the overall
mean was 80.70 3.57% for the HCMI line and
57.00 3.20% for the LCMI line. The mean FWI of
20 extreme responders from each line was 170.98%
for males and 107.08% for females of HCMI lines.
Corresponding values for males and females of the
LCMI line were 7.8 and 12.8%, respectively. As the
present study was conducted on parent broiler lines,
where the chicken flock remains heterogeneous in
terms of body size, variations in foot web thickness
exist. Consequently, we modified the method of
Corrier and DeLoach (1990) to get the foot web index
as described earlier (Section 2.2). Calculating the
percent increase in foot web thickness from the initial
(0 h) value indicates the fold increase in thickness
from the initial value, which minimizes the error in
response to PHA-P due to variation in the foot web
thickness of birds.
Nitric oxide (NO) has recently emerged as one of
the most effective immunoeffector molecule against a
broad spectrum of protozoa, fungi, bacteria and
viruses, as well as having anticancer properties
(Stuehr and Nathan, 1989; Liew et al., 1990; Xie
and Nathan, 1994). NO is produced by oxidation of L-
arginine by nitric oxide synthase (NOS). Macrophages
and, to some extent, leucocytes were implicated as the
major sources of inducible NOS (McCall et al., 1989;
Moncada et al., 1991). NO induction assay has shown
to be a simple, specific and reliable method to evaluate
macrophage activity or CMI response (Karaca et al.,
1996). Therefore, to appraise macrophage activity in
both HCMI and LCMI lines, total nitrate and nitrite
was assayed in serum after immunization with
Newcastle disease virus (NDV), which triggers both
CMI and humoral immune responses (Zinkernagel,
1994). Fig. 1 shows the kinetics of in vivo serum nitrite
and nitrate production from both lines at different time
intervals after stimulation with NDV antigen. In the
HCMI line, a significant increase in NO production
was observed from 14 to 42 dpi (32.94 1.9 to
41.02 1.9 mM), whereas, in the LCMI line, NO
production was found to be 20.48 1.9 mM on
14 dpi, which increased to 33.93 1.9 mM on
28 dpi. Thereafter, a decline was observed on 42 dpi
(27.03 1.9 mM). Comparison of both lines for in
vivo NO production at different time intervals
revealed significant differences between the lines at
14 and 42 dpi, although the levels at 28 dpi were
almost similar for both lines.
In vitro production of NO was also estimated at
different time intervals of induction with LPS to study
Fig. 1. In vivo serum nitric oxide production (mM) of HCMI and
LCMI lines induced with NDV-F1 vaccine (106.5 EID50) at various
dpi with uninduced controls. Graphics represent the mean of the
total nitrite and nitrate accumulation for each sample obtained at
various time intervals (mean S.D., n = 20).
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
the kinetics of in vitro NO production. Fig. 2 shows the
kinetics of in vitro nitrate production by monocytes
from both lines at different time intervals, after
stimulation with LPS. The HCMI line produced NO
immediately after induction and a significant peak
production (35.2 3.5 mM/106 cells) was observed at
9 h, which later declined and reached zero level at
15 h. In contrast, the LCMI line showed no significant
variation in NO production at different time intervals.
Comparison of cumulative NO production in both
lines revealed significant differences between the lines
at all time intervals studied, and at 20 h the cumulative
Fig. 2. In vitro nitric oxide production (mM/106 cells) in monocytes
of HCMI and LCMI lines treated with LPS (1 mg/ml) at various time
intervals (panel A) and cumulative production (panel B). Graphics
represent the mean of the total nitrite and nitrate accumulation for
each sample obtained at various time intervals (mean S.E.,
n = 20).
379
values for NO production in the HCMI and LCMI
lines were 97.2 4.8 and 44.0 4.8 mM/106 cells,
respectively.
In the present study, the high-responder line to
PHA-P was found to an immediate and high producer
of NO on in vivo stimulation to specific antigen
(NDV), as well as in vitro stimulation to LPS. Present
observations suggest a positive correlation between
PHA-P response and NO production. Whereas, Fathi
et al. (2003) reported a better PHA-P response in
hypo-responders lines (GB1and GB2) for iNOS
production, whereas iNOS hyper-responder K strain
chicks were consistently low responders to PHA-P
challenge. Nevertheless, they had a positive correlation between iNOS production and lymphoproliferative responses to Con-A (T-cell-mediated response).
They suggested that the reasons for the observed
variation between the in vivo and in vitro response to
T-cell mitogens could be due to microenvironmental
differences or that the effector target cells for the
mitogen may be different. However, in our study, a
significant difference was observed between the lines
for IFN-g promoter polymorphism for the TspEI site.
The HCMI line mostly revealed the genotype with a
168-bp fragment. On the other hand, this genotype was
not predominant in the LCMI line, whereas the IFN-g
exon region was completely conserved in both lines
(data not shown). This difference in promoter region
may regulate IFN-g gene expression and, thereby,
other IFN-g-mediated immune functions as well
(Zhou et al., 2001). Genetic background or different
selection criteria might be the reason for the observed
differences in the results of various studies.
Kean et al. (1994) had also observed that chicken
lines selected for high-immune responsiveness had
significantly higher wing web responses to PHA-P
injection after five generations of selection compared to
other chicken lines selected for low immunoresponsiveness. Moreover, high immunoresponsive or disease-resistant birds have been shown to elicit higher NO
production (Djeraba et al., 2002). The present study
demonstrated that divergent selection, based on PHA-P
response, i.e. T-lymphocyte-mediated response (Corrier, 1990), also exhibited significant differences in NO
production between the lines, with higher values in the
HCMI compared to the LCMI line. This could be due to
the fact that CD4+ T-cells are a key mediator in eliciting
this type of response (Terrence et al., 2002) and its
380
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
important role in regulating macrophage activity
(Goldsby et al., 2003). The results of this and others
studies suggest that phenotypic differences between
lines for the production of NO eventually reflect the
functional status of monocytes/macrophages as a
measure of immunity (Djeraba et al., 2002).
An initial study was conducted with PBMC after
induction with LPS to determine cytokine mRNA
expression at different time intervals, which led
subsequent studies. RT-PCR methodology was followed, as described earlier for this study (Section 2.4.4).
In this initial experiment, b-actin was used as the control
housekeeping gene and, in all the cases, the primer pairs
were same as those listed in Table 1. Detectable levels of
IL-2 and IFN-g expression were found 1 h after
induction and expression persisted up to 6 h, whereas,
iNOS and MIP-1b mRNA transcripts were expressed
from 1 to 9 h post-induction (data not shown). No
quantification was done during these studies.
Based on information from preliminary studies, an
experiment was designed to detect temporal expression patterns of cytokines at different time intervals of
Fig. 3. RT-PCR analysis of (lane 2) MIP-1b (lane 3) iNOS and gene expression on monocytes of HCMI line. Graphics represent the mean of the
normalized OD for each mRNA band obtained by densitometric analysis (mean S.E., n = 6). Normalization was done dividing each OD value
by the value of (lane 1) b-actin band in the same sample. All PCR reactions were performed on exponential phase conditions. Photographs show a
representative example of the PCR product of each gene in each hour after induction (A, 3 h; B, 6 h and C, 9 h). Lane M shows molecular weight
marker (Gene Ruler, MBI Fermentas).
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
induction with LPS (Dil and Qureshi, 2002). Firstly, in
monocyte cultures, mRNA expression levels of iNOS
and MIP-1b were quantified semi-quantitatively at 3,
6 and 9 h. Secondly, IFN-g and IL-2 mRNA
expression levels in PBMC cultures at 0.5, 1, 2, 3,
4, 5 and 6 h post-induction were similarly quantified.
Levels of mRNA were expressed as the fold change
above the b-actin expression in both cultures. PCR
products displayed expected sizes on agarose gel
(iNOS: 371 bp, MIP-1b: 322 bp, IFN-g: 495 bp, IL-2:
432 bp, b-actin: 350 bp).
381
Figs. 3 and 4 depict the level of expression of iNOS
and MIP-1b, respectively. In the HCMI line, iNOS
expression level was significantly higher after 3 h of in
vitro induction; then it gradually decreases towards
base value. Whereas in LCMI, expression at 3 h was
significantly less, but at later stages (up to 9 h of
expression) it was higher than that in the HCMI line.
Although iNOS mRNA expression is higher in the
LCMI line after 6 and 9 h, interestingly, in vitro NO
production was low at all times compared to the high
line, never reaching a peak and maintained almost a
Fig. 4. RT-PCR analysis of (lane 2) MIP-1b (lane 3) iNOS and gene expression on monocytes of LCMI line. Graphics represent the mean of the
normalized OD for each mRNA band obtained by densitometric analysis (mean S.E., n = 6). Normalization was done dividing each OD value
by the value of (lane 1) b-actin band in the same sample. All PCR reactions were performed on exponential phase conditions. Photographs show a
representative example of the PCR product of each gene in each hour after induction (A, 3 h; B, 6 h and C, 9 h). Lane M shows molecular weight
marker (Gene Ruler, MBI Fermentas).
382
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
plateau even after 20 h of induction. A possible
explanation for subsequent low expression levels of
iNOS at 6 and 9 h, and the high concentration of NO in
the supernatant of cultured macrophages of high line,
could be: (i) NO-mediated apoptosis of macrophages
(Albina et al., 1993), as more cell death or apoptosis
was noticed in the high line (data not shown), or (ii)
negative feedback from high NO concentration. As the
inducible nitric oxide synthase enzyme, responsible
for NO production, is transcriptionally regulated
(Hussain and Qureshi, 1998), the results of the NO
production assay and iNOS gene expression indicate
that, in the HCMI line, chicken iNOS gene expression
is immediate and higher in activating macrophages to
produce more NO.
Furthermore, MIP-1b mRNA expression analysis
revealed higher expression in the HCMI line after 3 h
of induction, thereafter it was lower at 6 and 9 h,
compared to the LCMI line. MIP-1b, a potent chemoattractant for macrophages produced by various cell
types, including macrophages, and involved in host
signalling host against pathogens, revealed a similar
expression pattern as observed for iNOS in both lines.
MIP-1b has been found to be a potent chemokine and
effective modulators of adaptive mucosal immunity,
and may also influence TH2 cell activity (Lillard et al.,
2003). Therefore, the differential expression of MIP1b in the chicken lines suggests a possible change in
MIP-1b-mediated functions.
To study the effect of selection on the expression
pattern of TH1-secreted cytokine genes, IFN-g and IL2 mRNA expression was studied. In the HCMI line,
initiation of IFN-g expression (Fig. 5), observed after
1 h, reached the highest value after 2 h and decreased
drastically later, with mild expression levels up to 6 h.
Whereas, in the LCMI line, IFN-g expression started
Fig. 5. RT-PCR analysis of IFN-g (~) and IL-2 (&) gene expression on lymphocytes of HCMI line (panel A), LCMI line (panel B). Graphics
represent the mean of the normalized OD for each mRNA band obtained by densitometric analysis (mean S.E., n = 6). Normalization was
done dividing each OD value by the value of b-actin (—) in the same sample. All PCR reactions were performed on exponential phase
conditions. Photographs show a representative example of the PCR product of each gene in each hour after induction (0.5, 1, 2, 3, 4, 5 and 6 h).
Lane M indicates molecular weight marker (E-Gel, Invitrogen).
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
2 h after induction and the expression pattern was
similar to the HCMI line, but at a lower level. These
results suggested that IFN-g is an early expressing
cytokines, responsible for the immediate and higher
iNOS expression in the HCMI line to induce
macrophages in response to the rapid surge in NO
production. The low expression of IFN-g found from 3
until 6 h in both lines, indicates a possible switchover
to a different cytokine cascade.
Another TH1-secreted cytokine, IL-2, having a
crucial role in T-cell proliferation, had a 2-fold higher
expression level in the LCMI line, compared to the
HCMI line, at all time intervals, whereas the peak time
coincided in both lines, i.e. at 2 h (Fig. 5). Although
IL-2 and IFN-g are both secreted from the same CD4+
TH1 cells, Imanishi (2004) reported an inhibitory
effect of interferon on proliferation and DNA
synthesis of T-cells. Inhibition of IL-2 production
has already been shown to be due to nitric oxide
(Taylor-Robinson, 1997) in regulating TH1 cell
proliferation. As the HCMI line expresses early and
higher IFN-g and NO, the inhibitory effect of both
could be one of the reasons for low expression of IL-2
in the HCMI compared to the LCMI line. Different
genetic regulations could be another reason for the
inverse expression pattern of IL-2 and IFN-g in the
HCMI line (Fan et al., 1993). However, the role of IL-2
is not very clear in DTH-related responses and
requires further study.
The present study revealed that selection for
divergent responses to PHA-P in chickens also
resulted in a divergent effect on TH1 cell activity,
resulting in altered macrophage functions. The NO
assay with macrophages suggested that estimation of
in vitro NO production could be a good indicator of
CMI and immunocompetence of chickens. Moreover,
as conditions during in vitro and in vivo response
differed considerably, the in vivo response on
macrophage function needs to be explored further.
Expression of IL-2 requires further study to precisely
determine its role in the DTH-like response. The
results on expression kinetics suggest that, while
evaluating in vitro macrophage or T-cell activity, the
early induction period should be considered to access
immunocompetence of chickens, as the cell-count
data, after LPS induction, revealed apoptosis and/or
cytotoxicity due to NO accumulation in the culture
media.
383
In conclusion, genetic selection for response to
PHA-P resulted in differential gene expression
related to immune responses, which could lead to
more resistant birds or birds with an enhanced
immune response. NO production, in response to ND
vaccine, also indicated an association between DTH
reaction and specific resistance to pathogens.
However, the relationship between the DTH-like
reaction and specific resistance to pathogens requires
further clarification (Orme and Cooper, 1999);
nonetheless, the importance of macrophages in both
is apparent.
References
Afraz, F., Yamamoto, Y., Okada, I., 1994. Divergent selection for
delayed-type wattle reaction of domestic fowls to BCG antigen.
Br. Poult. Sci. 35, 47–58.
Albina, J.E., Cui, S., Mateo, R.B., Reichner, J.S., 1993. Nitric oxide
mediated apoptosis in murine peritoneal macrophages. J. Immunol. 150, 5080–5085.
Ara, A., Tiwary, B.K., Ahmed, K.A., Rawat, M., Mishra, S.C.,
Saxena, V.K., Soman, J.P., 2004. Effect of immunosuppressant
anti-bursacyte globulin and anti-thymocyte globulin on host
defense against Salmonella pullorum infection in chicks. Indian
J. Anim. Sci. 74, 1180–1184.
Baba, T., Ando, T., Nukina, M., 1978. Effect of bursectomy and
thymectomy on Pasteurella multocida infection in chickens. J.
Med. Microbiol. 11, 281–288.
Corrier, D.E., 1990. Comparison of phytohemagglutinin-induced
cutaneous hypersensitivity reactions in the interdigital skin of
broiler and layer chicks. Avian Dis. 34, 369–373.
Corrier, D.E., DeLoach, J.R., 1990. Interdigital skin test for evaluation of delayed hypersensitivity and cutaneous basophil hypersensitivity in young chickens. Am. J. Vet. Res. 51, 950–954.
Dil, N., Qureshi, M.A., 2002. Involvement of LPS related receptors
and nuclear factor Kappa-B in differential expression of inducible nitric oxide synthase in chicken macrophages from different genetic backgrounds. Vet. Immunol. Immunopathol. 88,
149–161.
Djeraba, A., Bernarder, N., Dambrine, G., Quere, P., 2000. Nitric
oxide inhibits Marek’s disease virus replication but is not single
decisive factor in interferon gamma mediated viral inhibition.
Virology 277, 223–234.
Djeraba, A., Musset, E., Bernarder, N., Vern, Y.L., Quere, P., 2002.
Similar pattern of iNOS expression. NO production and cytokine
response in genetic and vaccination acquired resistance to
Marek’s disease. Vet. Immunol. Immunopathol. 85, 63–75.
Duncun, D.B., 1955. Multiple range and multiple F-tests. Biometrica 11, 1.
Fan, J., Bass, H.Z., Fahey, J.L., 1993. Elevated IFN-gamma and
decreased IL-2 gene expression are associated with HIV infection. J. Immunol. 151, 5031–5040.
384
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
Fathi, M., Ali, R.A., Qureshi, M.A., 2003. Comparison of immune
responses of inducible nitric oxide synthase (iNOS) hyper- and
hypo-responsive genotypes of chickens. Int. J. Poult. Sci. 2, 280–
286.
Fulton, J.E., 2004. Selection for avian immune response: a commercial breeding company challenge. Poult. Sci. 83, 658–661.
Goldsby, R.A., Kindt, T.J., Osborne, B.A., 2003. Kuby Immunology,
fifth ed. W.H. Freeman, New York.
Harvey, W.R., 1975. Least squares analysis of data with unequal
subclass frequencies. USDA Agric. Res. Services ARS H-4, p.
157.
Heller, E.D., Leitner, G., Friedman, A., Uni, Z., Gutman, M.,
Cahaner, A., 1992. Immunological parameters in meat-type
chicken lines divergently selected by antibody response to
Escherichia coli vaccination. Vet. Immunol. Immunopathol.
34, 159–172.
Hussain, I., Qureshi, M.A., 1998. The expression and regulation of
inducible nitric oxide synthase gene differ in macrophages from
chickens of different background. Vet. Immunol. Immunopathol.
61, 317–329.
Imanishi, 2004. Basis and clinical applications of interferon. JMAJ
47, 7–12.
Karaca, K., Kim, J.I., Reddy, S.K., Sharma, J.M., 1996. Nitric oxide
inducing factor as a measure of antigen and mitogen–specific Tcell response in chickens. J. Immunol. Methods 192, 97–103.
Kean, R.P., Cahaner, A., Freeman, A.E., Lamont, S.J., 1994. Direct
and correlated response to multi trait divergent selection for
immunocompetences. Poult. Sci. 73, 18–32.
Klesius, P., Johnson, W., Kramer, T., 1977. Delayed wattle reaction
as a measure of cell-mediated immunity in the chicken. Poult.
Sci. 56, 249–256.
Kramer, C.V., 1964. Expression and multiple range test to group
correlated adjusted means. Biometrics 13, 13–18.
Lamont, S.J., 1998. Impact of genetics on disease resistance. Poult.
Sci. 77, 1111–1118.
Lausch, R.N., Monterio, C., Kleinschrodt, W.R., Oakes, J.E., 1987.
Superiority of antibody versus delayed hypersensitivity in clearance of HSV-2 from eye. Invest. Ophth. Vis. Sci. 28, 565–570.
Liew, E.Y., Millot, S., Parkinson, C., Palmer, R.M.J., Moncada, S.,
1990. Macrophage killing of Leishmania parasite in vitro is
mediated by nitric oxide from L-argininin. J. Immunol. 144,
4794–4797.
Lillard Jr., J.W., Singh, U.P., Boyaka, P.N., Singh, S., Taub, D.D.,
McGhee, J.R., 2003. MIP-1 alpha and MIP-1 beta differentially
mediate mucosal and systemic adaptive immunity. Blood 101,
807–814.
Lindenstrom, T., Secombes, C.J., Buchmann, K., 2004. Expression
of immune response genes in rainbow trout skin induced by
Gyrodactylus derjavini infections. Vet. Immunol. Immunopathol. 97, 137–148.
McCall, T.B., Boughton-Smith, N.K., Palmer, R.M.J., Whittle,
B.J.R., Moncada, S., 1989. Synthesis of nitric oxide from Larginine by neutrophils, release and interaction with superoxide
anion. Biochem. J. 261, 293–296.
Moncada, S., Palmer, R.M.J., Higgs, E.A., 1991. Nitric oxide:
physiology, pathophysiology and pharmacology. Pharmacol.
Rev. 43, 109–134.
Oguccioni, M., Loetscher, M., Dewald, B., Baggiolini, M., 1995.
Action of the chemotactic chemokines MCP-1, MCP-2, MCP-3,
RANTES, MIP-1 alpha and MIP-1 beta on human monocytes.
Eur. J. Immunol. 25, 64–68.
Omar, A.R., Schat, K.A., 1996. Syngeneic Marek’s disease virus
(MDV) specific cell mediated immune response against immediate early, late, and unique MDV proteins. Virology 222, 87–99.
Orme, I.M., Cooper, A.M., 1999. Cytokine/chemokine cascades in
immunity to tuberculosis. Immunol. Today 20, 307–312.
Parmentier, H.K., Schrama, J.W., Meijer, F., Nieuwland, M.G.,
1993. Cutaneous hypersensitivity responses in chickens divergently selected for antibody responses to sheep red blood cells.
Poult. Sci. 72, 1679–1692.
Parmentier, H.K., Walraven, M., Nieuwland, M.G., 1998. Antibody
responses and body weights of chicken lines selected for high
and low humoral responsiveness to sheep red blood cells. 2:
Effects of separate application of Freund’s Complete and Incomplete Adjuvant and antigen. Poult. Sci. 77, 256–265.
Pinard-van der Laan, M.H., Soubieux, D., Merat, L., Bouret, D.,
Luneau, G., Dambrine, G., Thoraval, P., 2004. Genetic analysis
of a divergent selection for resistance to Rous sarcomas in
chickens. Genet. Select. Evol. 36, 65–81.
Pitcovski, J., Cahaner, A., Heller, E.D., Zouri, T., Gutter, B.,
Gotfried, Y., Leitner, G., 2001. Immune response and resistance
to infectious bursal disease virus of chicken lines selected for
high or low antibody response to Escherichia coli. Poult. Sci. 80,
879–884.
Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
Sarker, N., Tsudzuki, M., Nishibori, M., Yasue, H., Yamamoto, Y.,
2000. Cell-mediated and humoral immunity and phagocytic
ability in chicken lines divergently selected for serum immunoglobulin M and G levels. Poult. Sci. 79, 1705–1709.
Sastry, K.V.H., Moudgal, R.P., Mohan, J., Tyagi, J.S., Rao, G.S.,
2002. Spectrophotometric determination of serum nitrite and
nitrate by copper–cadmium alloy. Anal. Biochem. 306,
79–82.
Sharma, J.M., 1981. Natural killer cell activity in chicken exposed to
Marek’s disease virus: inhibition of activity in susceptible
chickens and enhancement of activity in resistant and vaccinated
chickens. Avian Dis. 25, 882–893.
Stuehr, D.J., Nathan, C.F., 1989. Nitric oxide: a macrophage product
responsible for cystitis and respiratory inhibition in tumor target
cells. J. Exp. Med. 169, 1543–1555.
Sundaresan, N, R., 2004. Molecular and immunological analysis of
MIP-1b and iNOS genes in immunodivergent broiler lines.
M.V.Sc. thesis. Deemed University, Indian Veterinary Research
Institute, Izatnagar, India.
Szczepanik, M., Akahira-Azuma, M., Bryniarski, K., Tsuji, R.F.,
Kawikova, I., Ptak, W., Kiener, C., Campos, R.A., Philip, W.B.,
2003. B cells mediate required early T-cell recruitment to elicit
protein-induced delayed-type hypersensitivity. J. Immunol. 171,
6225–6235.
Taylor-Robinson, A.W., 1997. Inhibition of IL-2 production by
nitric oxide: a novel self-regulatory mechanism for Th1 cell
proliferation. Immunol. Cell Biol. 75, 167–175.
N.R. Sundaresan et al. / Veterinary Immunology and Immunopathology 108 (2005) 373–385
Tedla, N., Wang, W.H., McNeil, H.P., Di Girolamo, N., Hampartzoumian, T., Wakefield, D., Lolyd, A., 1998. Regulation of T
lymphocyte trafficking in lymph nodes during a immune
response by chemokines macrophage inflammatory protein
(MIP)-1 alpha and MIP-beta. J. Immunol. 161, 5663–5672.
Terrence, M.T., Robin, F., Sara, M.K., John, E.O., Robert, N.L.,
2002. Role for macrophage inflammatory protein 2 (MIP-2),
MIP-1a, and interleukin-1a in the delayed-type hypersensitivity
response to viral antigen. J. Virol. 76, 8050–8057.
Vilcek, J., Oliveira, I.C., 1994. Recent progress in the elucidation of
interferon gamma actions: molecular biology and biological
functions. Int. Arch. Allergy Immunol. 104, 311–316.
385
Villata, F., Zhang, Y., Bibb, K.E., Kappes, J.C., Lima, M.F., 1998.
The cysteine–cysteine family of chemokines RANTES, MIP-1
alpha, and MIP-1 beta induce trypanocidal activity in human
macrophages via nitric oxide. Infect. Immun. 66, 4690–4695.
Xie, Q.W., Nathan, C., 1994. The high out-put nitric oxide pathway:
role and regulation. J. Leukoc. Biol. 56, 576–582.
Zhou, H., Buitenhuis, A.J., Weigend, S., Lamont, S.J., 2001. Candidate gene promoter polymorphisms and antibody response
kinetics in chickens: interferon-gamma, interleukin-2, and
immunoglobulin light chain. Poult. Sci. 80, 1679–1689.
Zinkernagel, R.M., 1994. Some general aspects of immunity to
viruses. Vaccine 12, 1493–1494.