International Research Journal of Plant Science (ISSN: 2141-5447) Vol. 4(9) pp. 275-279, October, 2013
DOI: http:/dx.doi.org/10.14303/irjps.2013.054
Available online http://www.interesjournals.org/IRJPS
Copyright © 2013 International Research Journals
Full Length Research Paper
Characterization of grape cultivars through
ESTP
Haiko Enok Sawazaki1, Mara Fernandes Moura1, Adriana Renata Verdi2,
Claudio Luiz Messias3.
1 APTA- Instituto Agronômico de Campinas, C. P. 28, CEP13012-970, Campinas, SP
2 APTA- Instituto de Economia Agrícola, São Paulo, SP
3 UNICAMP- FEAGRI, Campinas, SP
*Corresponding Author E-mail: henok@iac.sp.gov.br Tel: 55-19-32021780
ABSTRACT
Grapevine cultivars developed by the Instituto Agronômico de Campinas, known as Máximo IAC 138-22,
IAC Rainha and IAC Madalena were characterized to provide a distinct genetic profile to assist in
creating a typical wine. The characterization was made by means of the methodology Expressed
Sequence Tag Polymorphism (ESTP). Of thirteen PCR primers derived from EST of grapes initially
chosen nine DNA fragments were amplified with quality, for sequencing and only three sequences
showed different alleles corresponding to nine single nucleotide polymorphism (SNP). Although, the
SNP frequency of about 1.2 per locus, observed in this study was low, through the analysis of the
sequences were detected restriction sites specific for the differentiation of IAC 138-22 Máximo, IAC
Rainha and IAC Madalena.
Keywords: EST polymorphism, sequencing, Vitis sp
INTRODUCTION
The fingerprinting of a genome of grapevine used for
wine manufacturing is not only important for the genetic
characterization and evaluation of the quality and
potential of the germplasm, but also to the patent of a
typical wine. That is, the genetic characterization is
important to establish a genetic and molecular profile
characteristic of the grape cultivar, mainly for cultivars
that have not yet been genetically characterized as the
grape IAC 138-22 Máximo developed in 1946 by Dr.
Santos Neto at Instituto Agronômico de Campinas
through hybridization between the European Syrah
variety and a hybrid of Vitis vinifera developed in France
named Seibel, and others national cultivars like IAC
Rainha and IAC Madalena. In order to characterize grape
cultivars, it was tried to establish a specific fingerprinting
for each cultivar, by the PCR analysis called Expressed
Sequence Tag polymorphism (ESTP), together with the
restriction of specific sites. ESTP Markers can be easily
tested by PCR and are known to be more conserved than
the microsatellite, so, can be more easily transferred
among species (Echt and May-Marquardt, 1997).
The ESTP polymorphism provided by single
nucleotide polymorphism (SNP) due to single base
substitution and/or insertion-deletion mutation (indels),
represent the most frequent genetic differences between
members of populations (Salmaso et al., 2004). Velasco
et al. (2007), sequenced the genome of V. vinifera Pinot
Noir and found that the SNP frequency had an average
value of 4.0 per kilobase across the grape genetic map,
with several regions showing SNP frequency peaks
276 Int. Res. J. Plant Sci.
Figure1. PCR profile of grape cultivars: (A) IAC 138-22 Maximo; (B) IAC Madalena; (C) IAC Rainha, using
the primers, 28, 75,126, 136, 373, 521, 811, 850, 1413 (Troggio et al., 2007); NC= negative control, P =
standard (1kb plus DNA Ladder).
between 5 and 7.5 per 1 kb. Several primers derived from
EST-candidate genes are already available in the IASMA
Genomics (http://genomics.research.iasma.it/iasma/).
MATERIAL AND METHODS
94°C, 1 min at 54°C and 1 min at 72°C and a final
elongation step of 5 min at 72°C were used. The
amplified products were analyzed on agarose gel 1.5%.
To detect a specific restriction site, analysis "in silico"
was
previouslyperformed
(http.//www.restrictionmapper.org/).
Material
Sequencing
Young leaves from cultivars “IAC 138-22 Máximo”, “IAC
Rainha” and “IAC Madalena” were collected from grapes
growing in the field of Instituto Agronômico de Campinas
and stored at - 80 ° C.
The purification of the amplified fragment of DNA was
made by EXO-SAP system (APPLIED BIOSYSTEMS).
Sequencing was performed with three replicates at least
using Big Dye v. 3.0 (APPLIED BIOSYSTEMS) and the
ABI PRISM 377 sequencer according to laboratory
procedure. The validation of the sequences was
performed with the program Sequencher (GENE CODES
CORPORATION 3.1) and sequences comparisons with
the software Bioedit v.7.05 (Hall, 1999).
DNA extraction
DNA extraction was performed according to the CTAB
method of (Doyle and Doyle, 1991) modified including
phenol purification.
PCR analysis
RESULTS AND DISCUSSION
Initially, eleven primers named as IB02; IIB05; IIIB09;
IIC08; IIIC12; ID04; IE04; IIE02; IF01; IH09; UFGT were
tested by PCR according (Salmaso et al., 2004) and
then, the thirteen primers in Table 1 were used according
PCR was carried out in 25µL volume, consisting of 2050ng of DNA, 2.5µL 10X PCR buffer, 1.0 U Platinum Taq
DNA polymerase (INVITROGEN), 0.2 mM dNTP, 1.5 mM
MgCl2 and 0.4 µM of each specific primer. An activation
step of 5 min at 94°C, followed then by 9 cycles of 30 sec
at 94°C, 1 min from the gradient of 62°C to 54°C and 1
min at 72°C, followed by 30 cycles of 30 seconds at
The first primers (Salmaso et al., 2004) were not able to
amplify fragments using the conditions of 0,2mM of each
primer per reaction. Only by using the second primers
(Troggio et al., 2007) and the condition of 0, 4µM of each
primer, amplification of fragments was observed. The
best fragments amplified by the second primer set were
obtained with the primers, 28; 75; 126; 136; 373; 521;
811; 850 and 1413 (Figure 1). Using Sequencher to
validate the sequences, it was found that the best
sequences were observed with fragments amplified by
the primers, 28, 75, 126, 136, 811, 850 and 1413. The
Sawazaki et al. 277
Table 1. Sequences of primers according Troggio et al., 2007.
Primer
IN0006
FO0011
IN0028
BA0075
IN0126
BA0136
GM0373
IN0391
GR0403
GR0521
RA0811
IN0850
BA1413
Primer Forward (5'-3')
ATGGCTGGCAATCAGGAAGG
ACACCACCTACTCCGACACC
CACCAGTCCCTTACCAGTCT
TAACAGTCGCGAGTCCACAG
CTTACCAATATACGCGCTGC
CTGATGATCCTCTGGTGCCT
AACTGCGTCACATACGAGTCC
ATACCGCTTCCTCTGTCTCG
AGCTGGTACAACAGCAGCCT
AAGGCAGGCAACTGACTGAT
AGTCTGGCTAGGCACATTCG
CAACTCTACCTCCAGCAGCA
AATATCGACGAAGTGGCTCG
Primer Reverse (5'-3')
GCCTTGTTGAGCTCCAACAC
TTCTTCTCGTGATGCTCGTG
CAGTAGAGGAACACAACTGAG
ACCACAACACTCGATCCTCC
CCTTGCTTCTCAGCATTCG
GGCAGAGTGTTCAAGCCATT
TGCTGTTGTTGAGAACCGAG
ACCATTGCCACTGTTGTTGA
GGCACTGAGTCTCGGAGTTC
TCACAACCAACCAAGAGCAC
GACGAAGAAGTGGTGGTGGT
TCCAAGGTTCACTTGAAGGAA
ACAGGTCATGAGAGCAGCAA
Figure 2. Regions observed with BioEdit, of the cultivars, IAC 138-22 Maximo (Mx), IAC Madalena (Md) and
IAC Rainha (Ra), with differences in the sequences of fragments amplified by primers 28, 126 and 136.
comparison of sequences by BioEdit allowed distinguish
cultivars, due to some differences as can be seen in
Figure 2. It was observed that some different sites in the
sequences amplified by primer 28, which correspond to
the regions of the bases, 144th (24th base shown in
Figure 2), 64th (24th base shown in Figure 2) and, 121st
(23rd base in Fig 2) were able to differentiate between
cultivars, IAC Rainha, and IAC 138-22 Máximo. Likewise,
the regions amplified by primer 126, corresponding to
base 85th (25th base in Fig 2) and 119th (33rd and 34th
bases in Fig 2) differentiated the IAC Madalena, of the
cultivars, IAC Rainha, and IAC 138-22 Máximo. This
same primer in the region corresponding to base 764th
(23rd base in Fig 2) distinguished, the IAC 138-22
Máximo of IAC Madalena. The region amplified by
primer136 corresponding to the 107th base (27th base in
Fig 2), discerned the IAC Madalena, of the cultivars, IAC
138-22 Máximo and IAC Rainha.
It was observed that some different sites in the
sequences amplified by primer 28, which correspond to
th
th
regions of the bases, 144 (24 base shown in Fig 2),
th
th
st
rd
64 (24 base shown in Fig 2) and, 121 (base 23 in
Fig 2) were able to differentiate between cultivars, IAC
Rainha, and IAC 138-22 Máximo. Likewise, the sites
th
amplified by primer 126, corresponding to the bases, 85
th
th
rd
th
(25 base in Fig 2), and 119 (bases 33 and 34 in Fig
278 Int. Res. J. Plant Sci.
Table 2. Restriction enzymes to specific regions of fragments amplified with primers 28 and 136 of the
cultivars IAC 138-22 Máximo, IAC Rainha and IAC Madalena.
2) differentiated the IAC Madalena, of the cultivars, IAC
Rainha, and IAC 138-22 Máximo. This same primer in
the region corresponding to base 764th (in base 23 of Fig
2) differed IAC 138-22 Máximo of IAC Madalena. The
region amplified by primer 136, corresponding to base
107th (base 27th of Fig 2), differed IAC Madalena, of the
cultivars, IAC 138-22 Máximo and IAC Rainha. The other
primers, 75, 811, 850, 1413, apparently showed no
differences in the sequences amplified by cultivars.
These results showing eight SNPs in seven loci (28, 126,
136, 75, 811, 850, 1413) gives a frequency of 1.2 which
is greater than that observed by (Troggio et al., (2007)
and (Salmaso et al., 2008). Troggio et al., (2007) through
the construction of a dense genetic map for V. vinifera,
searched for SNPs in 363 single PCR product, finding a
total of 174 polymorphic sequences, or 0.48 SNP per
locus. Salmaso et al., (2008) by screening an
interspecific population originated from a cross between
V. vinifera and a complex hybrid of V. vinifera with
primers derived from EST, which resulted in 259 single
PCR product, found a total of 182 SNPs or 0.7 SNP per
locus.
Considering the total length of seven loci in this study,
approximately 2.500bp, and the frequency of only eight
SNP observed is not so different from that found in
genetic mapping of grapes by Velasco et al. (2007), with
the average value for SNP frequency of 4.0 per kilobase.
On the other hand, is a much smaller value in
comparison with those found by (Salmaso et al., 2004)
and (Lijavetzky et al., 2007). Salmaso et al., (2004),
comparing clones from seven different species of Vitis,
found the highest frequency of a SNP occurring each
78bp. Lijavetzky et al., (2007) sequenced 230 gene
fragments of a group of 11 genotypes of ancient grape
cultivars and wild plants, representing over 1 Mb of DNA,
observing 1573 SNPs (or 6.8 SNPs per locus) with an
average of one SNP every 64 bp.
The lower rate found in this study may be partially
explained by the low number of genomes used. Another
explanation could be that the loci were studied from
monomorphic regions. Troggio et al., (2007) found 28%
of markers derived from EST as monomorphic regions, a
fact explained by the possibility that the coding
sequences are monomorphic, most likely due to a direct
effect of selection in favor of the sequence conservation.
Another explanation is the possibility of false SNPs for
incorrect polymorphism. Pindo et al., (2008), investigating
813 candidate electronic SNPs (eSNPs, distinguishes
true polymorphism computationally) tested in 90 progeny
of Syrah × Pinot Noir cross, found 563 new SNPmarkers, or a frequency 0.69 times smaller.
Looking for specific restriction of the fragments
amplified by primers Troglio et al., (2007) the preliminary
analysis "in silico" showed that only primers, designated
28 and 136 presented differences in restriction sites
(Table 2). With the primer 136, both enzymes StuI and
SduI, differed the IAC Madalena, of the cultivars, IAC
138-22 Máximo and IAC Rainha. Moreover, with the
primer 28, the IAC 138-22 Máximo was differentiated
from IAC Rainha by both enzymes BbvI and TseI. These
results were confirmed when fragments amplified by
primer 136, of the cultivars, IAC Rainha, IAC 138-22
Máximo and IAC Madalena were restricted with the StuI
enzyme, yielding fragments around 130 bp and 120 bp
just for cultivars IAC Rainha and IAC 138-22 Máximo
(with no restriction of amplicon of IAC Madalena). In
Addition, restriction of the fragments amplified by primer
28, using the enzyme BseXI (BbvI), gave two fragments
around 110bp and 310 bp only for IAC 138-22 Máximo,
while IAC Rainha was not cut.
CONCLUSION
Despite the frequency of SNPs observed in this study
was low, around 1.2 per locus, by sequence analysis was
possible to detect specific restriction site for
differentiation of the cultivars, IAC 138-22 Máximo, IAC
Rainha and IAC Madalena.
Sawazaki et al. 279
ACKNOWLEDGMENTS
Thanks to Fundação de Amparo a Pesquisa do Estado
de São Paulo (FAPESP) for financial support.
REFERENCES
Doyle JJ, Doyle JL (1991).Isolation of plant DNA from fresh tissue.
Focus 1: 13-15.
Echt CS, May-Marquardt P (1997).Survey of microsatellite DNA in pine.
Genome 40(1):9-17.
Hall TA (1999). BioEdit: a user-friendly biological sequence alignment
editor and analysis program for windows 95/98/NT. Nucleic Acids.
Symp. Ser. 41:95-98.
Lijavetzky D, Cabezas JA, Ibáñez A, Rodríguez V, Martínez-Zapater JM
(2007).High throughput SNP discovery and genotyping in
grapevine (Vitis vinifera L.) by combining a re-sequencing
approach and SNPlex technology. BMC Genomics.2007; 8: 424.
Pindo M, Vezzulli S, Coppola G, Cartwright DA, Zharkikh A, Velasco R,
Troggio M (2008). SNP high-throughput screening in grapevine
using the SNPlex™ genotyping system. BMC Plant Biol. 8: 12.
Salmaso M, Faes G, Cinzia Segala C, Stefanini M, Salakhutdinov I,
Zyprian E, Toepfer R, Grando MS, Velasco, R (2004). Genome
diversity and gene haplotypes in the grapevine (Vitis vinifera L.) as
revealed by single nucleotide polymorphism. Molecular Breeding
14: 385-395.
Salmaso M, Malacarne G, Troggio M, Faes G, Stefanini M, Grando
MS,·Velasco R (2008) A grapevine (Vitis vinifera L.) genetic map
integrating the position of 139 expressed genes. Theoretical and
Applied Genetic 116:1129-1143.
Troggio M, Malacarne G, Coppola G, Segala C, Cartwright† DA, Pindo
M, Stefanini M, Mank R, Moroldo M, Morgante M, Grando MS,
Velasco R (2007).A dense SNP-based genetic linkage map of
grapevine (Vitis vinifera L.) anchoring Pinot Noir bacterial artificial
chromosome contigs. Genetics 1176:2637-2650.
How to cite this article: Sawazaki HE, Moura MF, Verdi AR,
Messias CL (2013). Characterization of grape cultivars through
ESTP. Int. Res. J. Plant Sci. 4(9):275-279