Arch Microbiol (2000) 173 : 49–57
© Springer-Verlag 2000
O R I G I N A L PA P E R
Joan M. Macy · Joanne M. Santini · Björg V. Pauling ·
Andrew H. O’Neill · Lindsay I. Sly
Two new arsenate/sulfate-reducing bacteria:
mechanisms of arsenate reduction
Received: 18 March 1999 / Accepted: 27 September 1999
Abstract Two sulfate-reducing bacteria, which also reduce arsenate, were isolated; both organisms oxidized lactate incompletely to acetate. When using lactate as the
electron donor, one of these organisms, Desulfomicrobium
strain Ben-RB, rapidly reduced (doubling time = 8 h) 5.1
mM arsenate at the same time it reduced sulfate (9.6 mM).
Sulfate reduction was not inhibited by the presence of arsenate. Arsenate could act as the terminal electron acceptor in minimal medium (doubling time = 9 h) in the absence of sulfate. Arsenate was reduced by a membranebound enzyme that is either a c-type cytochrome or is associated with such a cytochrome; benzyl-viologen-dependent arsenate reductase activity was greater in cells grown
with arsenate/sulfate than in cells grown with sulfate only.
The second organism, Desulfovibrio strain Ben-RA, also
grew (doubling time = 8 h) while reducing arsenate (3.1
mM) and sulfate (8.3 mM) concomitantly. No evidence
was found, however, that this organism is able to grow using arsenate as the terminal electron acceptor. Instead, it
appears that arsenate reduction by the Desulfovibrio strain
Ben-RA is catalyzed by an arsenate reductase that is encoded by a chromosomally-borne gene shown to be homologous to the arsC gene of the Escherichia coli plasmid, R773 ars system.
Key words Arsenate reduction · Sulfate reduction ·
Desulfovibrio sp. · Desulfomicrobium sp. · Arsenate
reductase · Cytochrome c · Arsenate resistance
J. M. Macy (Y) · J. M. Santini · B. V. Pauling
Department of Microbiology, La Trobe University,
Bundoora, Victoria 3083, Australia
e-mail: j.macy@latrobe.edu.au,
Tel.: +61-3-94792229, Fax: +61-3-94791222
A. H. O’Neill · L. I. Sly
Centre for Bacterial Diversity and Identification,
Department of Microbiology and Parasitology,
The University of Queensland, Brisbane,
Queensland 4072, Australia
Introduction
A number of bacteria have been isolated that use arsenate
as the terminal electron acceptor. Four of these organisms
(“Geospirillum arsenophilus”, formerly strain MIT-13;
“Geospirillum barnseii”, formerly strain SES-3; a sulfatereducing bacterium “Desulfotomaculum auripigmentum”;
and “Bacillus arsenicoselenatis”) grow using lactate, but
not acetate, as the electron donor (Newman et al. 1997b;
Blum et al. 1998). The only arsenate reducer that is able to
grow using acetate as the electron donor is Chrysiogenes
arsenatis (Macy et al. 1996), and arsenate reduction is catalyzed by a terminal arsenate reductase, Arr (Krafft and
Macy 1998). Recently purified, this enzyme was found to
be a heterodimeric (α1β1) molybdoenzyme that is located
in the periplasmic space of the organism (Krafft and Macy
1998). Arsenate reduction by this organism is thought to
be the terminal step of an electron transport system involved in energy conservation (Krafft and Macy 1998).
The mechanisms of arsenate reduction by “G. arsenophilus”, “G. barnseii”, “D. auripigmentum” and “B. arsenicoselenatis” are unknown.
Only one organism, the sulfate-reducer “D. auripigmentum”, has been found to reduce both arsenate and sulfate (Newman et al. 1997a,b). However, sulfate reduction
only occurred when all arsenate present initially in the
culture had first been reduced to arsenite (Newman et al.
1997a,b). The mechanism of arsenate reduction by “D.
auripigmentum” is not known (Newman et al. 1997b).
Apart from respiratory arsenate reduction, arsenate can
also be reduced by yeast (e.g., Saccharomyces cerevisiae;
Bobrowicz et al. 1997) and various bacteria using a soluble arsenate reductase that is part of an arsenic resistance
system (Silver 1998; Xu et al. 1998). The genes encoding
these arsenic resistance systems (ars), which are widespread in both gram-negative and gram-positive bacteria
(Diorio et al. 1995; Silver 1998), are located on plasmids
(e.g., R773; Kaur and Rosen 1992), transposons (e.g.,
Tn2502; Summers 1992) and chromosomes (e.g., Escherichia coli; Carlin et al. 1995).
50
One of the best-characterized plasmid-borne ars systems is that of the E. coli R factor R773 (Chen et al.
1986), which encodes five genes (arsRDABC). In this system the first two genes, arsR and arsD, encode regulatory
proteins. The arsA gene encodes the ArsA protein (an ATPase) and the arsB gene encodes the membrane-embedded ArsB protein; together the ArsA and ArsB transport
arsenite out of the cell with energy provided by ATP hydrolysis. The last gene, arsC, encodes a soluble arsenate
reductase (ArsC) which reduces arsenate to arsenite. The
arsenate reductase of this system (or other ars systems)
does not appear to be involved in energy conservation
(Silver 1998; Xu et al. 1998).
The arsB gene products of the various ars systems are
generally the most highly conserved (Cai et al. 1998; Silver 1998). The arsC gene products (i.e., arsenate reductases), however, are less conserved (Silver 1998). One of
the best-characterized ArsC proteins which has been purified is that encoded by the arsC gene of R773. This cytoplasmic protein (16 kDa) uses glutathione to reduce arsenate (Gladysheva et al. 1994; Oden et al. 1994).
Only two chromosomally-borne ars systems have been
characterized, those of E. coli (Carlin et al. 1995; Xu et al.
1998) and Pseudomonas aeruginosa (Cai et al. 1998).
Both comprise three genes (arsRBC).
Here we describe two new arsenate/sulfate-reducing
bacteria that, unlike sulfate-reducer “D. auripigmentum”,
reduce arsenate and sulfate concomitantly. The possible
mechanisms used by these bacteria to reduce arsenate are
also explored.
Materials and methods
Growth media and conditions
The anoxic minimal salts medium, described previously for C. arsenatis, was used for enrichment, isolation and cultivation of organisms described here (Macy et al. 1996); however, the reducing
agent used, when indicated, was sodium sulfide (2 mM). Additionally, after isolation and initial studies, it was found that for optimal
growth one isolate, strain Ben-RA, required a 50% lower phosphate concentration (0.1 g/l or 0.7 mM KH2PO4); this medium was
designated minimal medium-A. D,L-Lactate was the only electron
donor used in all experiments; the final concentration used is indicated for each experiment. The electron acceptors used were either
sulfate or arsenate; the final concentrations used are indicated for
each experiment. All incubations were at 28 °C.
For DNA isolation procedures bacteria were grown in the
above medium with sulfate only, until the mid-exponential phase
had been reached. Cells were harvested as for the Preparation of
cell extracts (see below).
Growth experiments
Strain Ben-RA was grown in minimal medium A plus lactate (20
mM) and sulfate (20 mM) and, where indicated, arsenate (10, 15,
20 or 30 mM). Sulfide (2 mM) was included in the medium as reducing agent; otherwise growth did not occur. Strain Ben-RB was
grown in minimal medium plus lactate (20 mM), and, as indicated,
either sulfate (10 mM) or arsenate (5, 10, 15, 20, 30 mM). Cultures
grown overnight under the experimental conditions were inoculated (10%) into the respective growth medium (400 ml). Samples
were taken periodically, and either cell numbers (i.e., direct
counts, using a counting chamber) or optical density (600 nm)
were determined. Portions of the samples were also centrifuged
(15,000 × g; 10 min) to remove cells; the supernatant was frozen
until analyses could be performed.
Analytical methods
Arsenate and sulfate were determined using HPLC, as described
previously (Macy et al. 1989). Arsenite was determined using a
Varian Spectra AA20 atomic absorption spectrophotometer, with a
VGA76 hydride generator (Varian, Melbourne, Victoria, Australia), as described previously (Macy et al. 1996). Lactate and acetate were determined using enzyme test kits (Boehringer Mannheim).
16S rRNA gene sequence determination
Genomic DNA was isolated from strains Ben-RA and Ben-RB by
the method previously described by Rainey et al. (1992).
The 16S rRNA gene was amplified from the genomic DNA of
each strain by the following procedure. Each 100 µl of reaction
mixture contained: 10 µl Tth 10 × reaction buffer (Biotech, Bentley, Western Australia), 0.1 mM dNTPs, 1.5 mM MgCl2, 2 ng
each of 27f and 1492r bacterial primers (Lane 1991), 1–2 µl of genomic DNA template, and sterile deionized water (MilliQ,
France). The initial denaturation step was performed at 95 °C for
5 min in a thermal cycler. The denatured reaction mix was held at
4 °C until the addition of 2.2 U of Tth DNA polymerase (Biotech)
to each tube to start the reaction. The thermal cycling program included 30 cycles of denaturation (94 °C, 1 min), annealing (48 °C,
1 min) and extension (72 °C, 2 min). Final annealing (48 °C, 1 min)
and final extension (72 °C, 5 min) were performed at the end of the
30 cycles. The PCR products were purified by using Wizard PCRPreps DNA Purification System (Promega, Madison, Wis.) as described by the manufacturer.
A PRISM Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) was used to
directly sequence the purified 16S rDNA, as described by the manufacturer. Each sequencing reaction contained: 8 µl of Terminator
Ready Reaction Mix, 100 ng of PCR product, 25 ng of sequencing
primer, and sterile deionized water (MilliQ, France) to a final volume of 20 µl. Sequencing primers (27f, 357f, 530f, 803f, 926f,
1114f, 519r, and 1492r) were used to sequence both DNA strands
(Lane 1991). The reaction mixtures were purified and sequenced
using an Applied Biosystems model 373A DNA sequencer.
Phylogenetic analysis
Enrichment and isolation
Mud obtained from an arsenic-contaminated reed bed in Bendigo,
Australia, was placed in anoxic minimal medium containing lactate (20 mM), sulfate (20 mM) and, as required, arsenate (10 mM).
Sodium sulfide (2 mM) was included as the reducing agent. After
enrichment, organisms were isolated by serially diluting the enrichment, followed by inoculation into minimal medium containing 1.5% purified Oxoid agar (Oxoid, Hants, England), lactate
(20 mM), sulfate (20 mM), arsenate (10 mM) and sulfide (2 mM)
in Hungate roll tubes (Macy et al. 1989). Organisms were purified
using the Hungate anaerobic technique (Hungate 1969).
The near full-length 16S rRNA gene sequences determined for
strain Ben-RA and Ben-RB were aligned with the sequences of E.
coli and reference sequences of members of the δ-Proteobacteria
using the FAST Aligner (V1.02) within the ARB EDIT tool of the
ARB software for the analysis of sequence data (Strunk et al.
1998). The alignment was checked by eye and some corrections
were made manually. Evolutionary similarities and distances were
calculated using the Felsenstein (1993) correction and a phylogenetic tree was constructed using the neighbor-joining method of
Saitou and Nei (1987). Bootstrap analysis of 100 data resamplings
was performed with SEQBOOT and CONSENSE (Felsenstein
51
1993) to determine the statistical confidence of branch points in
the tree.
The following sequences of bacterial strains with strain numbers, where available, were obtained from GenBank and the Ribosomal Database project (RDP; Maidak et al. 1997) for inclusion in
the phylogenetic analyses [respective accession numbers, in parentheses, follow strain numbers]: Bdellovibrio stolpii DSM 50722
(M34125), Desulfobacter postgatei DSM 2034 (M26633), Desulfobacterium autotrophicum DSM 3382 (M34409), Desulfohalobium retbaense DSM 5692 (U48244), Desulfomicrobium apsheronum DSM 5918 (U64865), Desulfomicrobium baculatum
DSM 1743 (M37311), Desulfomicrobium escambiense str. esc1
(U02469), Desulfomicrobium norvegicum NCIB 8310 (M37312),
Desulfomicrobium sp. str. STL8 (X99505), Desulfomonile tiedjei
ATCC 49306 (M26635), Desulfonema limicola str. 2076 (U45990),
“Desulforhopalus vacuolatus” str. ltk10 (L42613), Desulfosarcina
variabilis DSM 2060 (M34407), Desulfovibrio africanus (M37315),
Desulfovibrio desulfuricans ATCC 27774 (M34113), Desulfovibrio gabonensis str. SEBR 2840 (U31080), Desulfovibrio gigas
ATCC 19364 (M34400), Desulfovibrio halophilus str. SL 8903
(U48243), Desulfovibro longus str. SEBR 2582 (X63623), Desulfovibrio salexigens ATCC 14822 (M34401), Desulfovibrio sp. str.
DMB (X86689), Desulfovibrio termitidis str. Hl1(X87409), Desulfovibro vulgaris DSM 644 (M34399), Desulfurella acetivorans
DSM 5264 (X72768), Desulfuromonas acetexigens (U23140),
Escherichia coli (J01695), Geobacter sulfurreducens str. PCA
(U13928), Myxococcus xanthus str. MD207 (M34114), Pelobacter
acetylenicus DSM 2348 (X70955), Syntrophus gentianae str. HQgoe1 (X85132), Syntrophobacter wolinii DSM 2805 (X70905),
and unidentified bacterium strain Äspö 1 (X95570).
Nucleotide sequence accession numbers
The sequences determined in this study for strain Ben-RA and
strain Ben-RB have been deposited in GenBank under the accession numbers AF131234 and AF131233, respectively.
Preparation of cell extracts
Cells of Desulfovibrio strain Ben-RA or Desulfomicrobium strain
Ben-RB were harvested by centrifugation for 20 min at 20,000 × g
(4 °C) and were resuspended in ice-cold 50 mM 2-(N-morpholino)ethanesulfonic acid (Mes) buffer (pH 6.5); 1–2 g cells
(wet weight) were suspended in 10 ml buffer. They were disrupted
by one passage through a French press (1.4 × 108 Pa). Unbroken
cells were removed by centrifugation at 17,000 × g (4 °C) for 10
min. The soluble and membrane fractions of cell extracts from
Desulfomicrobium strain Ben-RB were separated by ultracentrifugation for 2 h at 100,000 × g (4 °C). The pellet (i.e., membrane
fraction) was suspended in 50 mM Mes buffer, pH 6.5 (0 °C); the
volume used was identical to the volume of the soluble fraction
(i.e., supernatant). The buffer pH used is the optimum for the arsenate reductase of C. arsenatis (Krafft and Macy 1998).
Cytochrome spectra
Spectra were obtained using a Cary 1E spectrophotometer (Varian). When rates of cytochrome oxidation were measured, this was
done using anaerobic cuvettes, as for measurement of benzyl-viologen-dependent arsenate reductase activity (see below).
Enzyme assays
Benzyl-viologen-dependent arsenate reductase activity was determined using an anaerobic assay (25 °C) described previously
(Krafft and Macy 1998). Enzyme activity was measured with a
Cary 1E spectrophotometer (Varian) by monitoring the oxidation
of the artificial electron donor, reduced benzyl-viologen (1 mM)
at 546 nm, using arsenate (10 mM) as the electron acceptor (ε =
19.5 cm–1 mM–1). Benzyl-viologen was reduced chemically with
sodium dithionite (0.15 mg/ml). One unit (U) of activity corresponded to the reduction of 1 µmol arsenate·min–1.
When measuring the reduction of arsenate in cell extracts of
strain Ben-RA, cells were grown to late exponential phase
(OD600nm = 0.18–0.2) and harvested as described for the Preparation of cell extracts. To measure arsenate reduction, 2.5 ml cell extract was added to anoxic serum bottles containing 2.5 ml anoxic
Mes buffer (50 mM, pH 6.5) and 5 mM arsenate or 5 mM arsenate
plus 5 mM lactate. Samples were removed periodically, and the
concentration of arsenite formed was determined (see Analytical
methods, above). The rate of arsenate reduction was calculated
from that portion of the curve when the rate of arsenite formation
was linear. Bradford reagent (Bradford 1976) was used to determine protein concentrations. Bovine serum albumin served as the
standard.
Molecular techniques
Standard molecular procedures were performed according to Sambrook et al. (1989). Chromosomal and plasmid DNA was isolated
according to the method of Humphreys et al. (1975) followed by
cesium chloride density centrifugation (Sambrook et al. 1989).
Plasmid pWSU1, which contains the R773 arsenic resistance
operon (arsRDABC; San Francisco et al. 1990), was used as the
source of the ars resistance genes.
PCR amplification was carried out with primers (listed below)
and pWSU1 as the template. The mixtures, overlaid with sterile
mineral oil, were placed in a thermal cycler for 36 cycles under the
following conditions: 92 °C, 3 min (first cycle only); 92 °C, 1 min;
60 °C, 1 min; 72 °C, 2 min; and 72 °C, 5 min (final cycle only). The
PCR products obtained were: arsA (1757 bp), arsB (1282 bp) and
arsC (428 bp). Primers used for PCR amplification of the respective ars genes were: GGACATATGCAATTGTTACAGAATATC
and TTACCCAGCAAGTTGTTTGAGTTTGTCG for amplification of arsA (nt 178–1935); TACTGGCAGGAGCCATTTTTATCC and CAATGTGACAGAGAGACGTAGCGC for amplification of arsB (nt 1988–3270); CTGATATGAGCAACATCACTATTT and ATTTCAGCCGTTTTCCTGCTTCA for amplification of arsC (nt 3281–3709; Chen et al. 1986).
For Southern hybridizations 10 µg of chromosomal DNA and 5
µg of plasmid DNA (or 0.1 µg of pWSU1 serving as the positive
control) were digested with the appropriate restriction enzymes.
The DNA fragments, separated by electrophoresis in 0.7% agarose
gels, were transferred to nylon membranes (Hybond N+; Amersham, Buckinghamshire, England)) and hybridized at either 50 °C
or 55 °C with α-32P-dCTP (4 × 108 cpm) labeled arsA, arsB or
arsC DNA fragments (prepared by the random priming method;
Sambrook et al. 1989). The membranes were washed twice with
2× SSPE; 0.1% SDS (at room temperature) and once with 1×
SSPE; 0.1% SDS (at either 50 °C or 55 °C) and exposed to Kodak
X-ray film.
Results
Isolation of arsenate/sulfate-reducing bacteria
Black mud from an arsenic-contaminated reed bed in
Bendigo, Australia was inoculated into minimal enrichment medium containing lactate and sulfate. Arsenate was
not included in the medium initially, as whenever this was
done C. arsenatis became the predominant organism in
the enrichment (Macy et al. 1996). Following two subcultures of the enrichment, a third subculture was inoculated
into the same minimal enrichment medium containing 10
mM arsenate. Following two additional subcultures in the
52
arsenate-containing enrichment medium, two different
sulfate-reducing bacteria were isolated and purified, using
minimal agar medium plus 10 mM arsenate, according to
Hungate’s anaerobic technique (Hungate 1969; Macy et
al. 1989).
Both organisms were gram-negative. The first organism, designated strain Ben-RA, was a curved rod, motile
with a single polar flagellum. The second organism, designated strain Ben-RB was a straight, motile rod with a
single polar flagellum. Growth on lactate in the absence
of an electron acceptor did not occur.
Phylogenetic characterization
The phylogenetic analysis of almost complete 16S rRNA
gene sequences (>1421 nucleotides) of the two arsenate/
sulfate-reducing isolates showed that the two strains be-
longed to separate lines of descent in the δ-Proteobacteria
(Fig. 1). The analysis of 1334 unambiguous nucleotide positions showed that strain Ben-RA belonged to a strongly
supported branch (98% bootstrap value) of the genus
Desulfovibrio, which contained the species D. desulfuricans, D. termitidis, and D. vulgaris. Members of this
branch were closely related, with sequence similarities in
the range 90.7–99.2%.
The nearest phylogenetic relatives of strain Ben-RA
were D. vulgaris (95.7% sequence similarity) and Desulfovibrio sp. strain DMB (98.4% sequence similarity), a
sulfate-reducing isolate from a two-component anaerobic
mixed culture that degrades dichloromethane (Mägli et al.
1995). At this level of 16S rRNA sequence similarity,
strain Ben-RA does not belong to the species D. vulgaris
or any other described species of Desulfovibrio, and
therefore belongs to a novel species. However, DNA :
DNA hybridization of genomic DNA would be required
to determine if strain Ben-RA and Desulfovibrio sp. strain
DMB belong to the same novel species (Stackebrandt and
Goebel 1994).
Strain Ben-RB, on the other hand, belonged to a
strongly supported branch (100% bootstrap value) containing all the described species of the genus Desulfomicrobium, as well as two other unspeciated isolates. Members of this branch were very closely related to each other,
with sequence similarities in the range 97.3–99.8%. The
nearest phylogenetic relative of strain Ben-RB was the
sulfate-reducing unidentified bacterium strain Äspö 1
(98.7% sequence similarity) isolated from a deep underground bore hole at the Äspö hard rock laboratory in
Sweden and previously shown to have a high sequence
similarity with Desulfomicrobium baculatum (Pedersen et
al. 1996). As with strain Ben-RA, at this level of 16S
rRNA sequence similarity DNA:DNA hydribidization of
genomic DNA would be required to determine to which
species of Desulfomicrobium strain Ben-RB belongs.
Growth of Desulfovibrio strain Ben-RA on lactate
plus sulfate, or lactate plus sulfate and arsenate
Fig. 1 Neighbor-joining tree showing the phylogenetic relationship of arsenate-reducing isolates strain Ben-RA and strain BenRB with species of the genera Desulfovibrio and Desulfomicrobium respectively, and other members of the δ-Proteobacteria. The
sequence of Escherichia coli was used as the outgroup. The analysis included data from 1334 unambiguous nucleotide positions.
Significant bootstrap values from 100 analyses are shown at the
branch points of the tree. The scale bar represents 1 nucleotide
substitution per 100 nucleotides of 16S rRNA sequence
Desulfovibrio strain Ben-RA was found to be highly resistant to arsenate. It could grow in minimal medium containing 20 mM sulfate and 30 mM arsenate, although the
presence of arsenate slowed growth. The doubling time
for growth of strain Ben-RA increased with increasing
concentrations of arsenate; when grown with 20 mM sulfate plus 30 mM arsenate, the doubling time was 27 h
compared with 7 h when only sulfate was present as the
electron acceptor (data not shown).
Upon completion of the experiments described above,
it was found that Desulfovibrio strain Ben-RA grew more
rapidly in the presence of arsenate when the concentration
of phosphate was decreased by 50% (0.1 g/l or 0.7 mM
KH2PO4). For instance, in minimal medium containing 10
mM arsenate the doubling time was slightly shorter, on
average 8 h (compared to 10 h) when the level of phosphate was reduced by 50%. More importantly, cells grew
53
Fig. 2 Growth of Desulfovibrio strain Ben-RA in minimal medium-A with lactate (21.2 mM), sulfate (16.9 mM), arsenate (9.2
mM), sulfide (2 mM). An overnight culture of strain Ben-RA,
grown in the same medium, was inoculated (10%) into the experimental flask at time = 0. G Lactate; R sulfate; M arsenate; m acetate; P optical density (600 nm)
more consistently with this lower level of phosphate (i.e.,
shorter or no lag phase before exponential growth commenced). Therefore, for all remaining experiments the
concentration of phosphate included was reduced to the
50% level (i.e., minimal medium-A).
When grown in minimal medium-A plus sulfate (20
mM) as the electron acceptor, Desulfovibrio strain Ben-RA
grew with a doubling time of 6 h (data not shown). When
grown with arsenate (9.2 mM) and sulfate (16.9 mM), the
doubling time for growth was increased to 8 h; 21 mM
lactate was consumed (with 18 mM acetate formed and
3 mM used for synthesis of cell material), while 8.3 mM
sulfate and 3.1 mM arsenate were reduced (Fig. 2). The
amount of arsenite formed could not be determined quantitatively, as it tended to precipitate as yellow arsenic sulfide (As2S3; Newman et al. 1997a). The formation of 18
mM acetate from lactate would yield 72 mM (18 mM × 4)
reducing equivalents. The reduction of 8.3 mM sulfate
and 3.1 mM arsenate would require a total of 72.6 mM
equivalents [i.e., 66.4 mM (8.3 mM × 8) plus 6.2 mM (3.1
mM × 2, respectively]. The number of reducing equivalents available from lactate oxidation is, therefore, nearly
equivalent to the number required to reduce the sulfate
and arsenate used by the organism.
In the absence of sulfate, arsenate did not support the
growth of this organism, indicating that arsenate reduction
by strain Ben-RA is not associated with energy conservation.
Growth of Desulfomicrobium strain Ben-RB on lactate
plus sulfate, lactate plus arsenate, sulfate and arsenate
Desulfomicrobium strain Ben-RB was also found to be
highly resistant to arsenate. It was able to grow in minimal medium containing 20 mM sulfate and 30 mM arsenate, although the presence of arsenate slowed growth.
Fig. 3 Growth of Desulfomicrobium strain Ben-RB in minimal
medium with lactate (3.8 mM) arsenate (3.5 mM). An overnight
culture of strain Ben-RB, grown in the same medium, was inoculated
(10%) into the experimental flask at time = 0. G Lactate; M arsenate;
p arsenite; m acetate; r number of cells · ml–1
With increasing concentrations of arsenate the doubling
time for growth of strain Ben-RB was increased; when
grown with 20 mM sulfate plus 30 mM arsenate the doubling time was 11 h compared with the 6 h observed when
only sulfate was present as the electron acceptor (data not
shown).
When Desulfomicrobium strain Ben-RB was grown
with sulfate as the electron acceptor, the doubling time
was 6 h (data not shown). Unlike strain Ben-RA, strain
Ben-RB was able to grow in minimal medium with arsenate only as the electron acceptor (doubling time = 9 h; Fig.
3). Only 0.8 mM lactate was consumed (with 0.7 mM acetate formed). The measured concentration of arsenate reduced was 1.2 mM, while the concentration of arsenite
formed was 1.5 mM. Once 1.5 mM arsenite had been
formed, the culture lysed. The formation of 0.7 mM acetate from lactate would yield 2.8 mM reducing equivalents. The reduction of 1.2 mM arsenate (or the formation
of 1.5 mM arsenite) would require a total of 2.4 mM (or
3.0 mM) reducing equivalents. The estimated number of
reducing equivalents available from lactate oxidation is,
therefore, very close to the number required to reduce the
arsenate used by this organism.
When grown (Fig. 4) with both arsenate (8.2 mM) and
sulfate (10.7 mM) present as electron acceptors, growth
was slightly slower than with sulfate only (doubling time
= 8 h as compared to 6 h, respectively). Both sulfate (9.6
mM) and arsenate (5.1 mM) were reduced concomitantly,
while 21 mM lactate was consumed and 18 mM acetate
formed. Sulfate and arsenate reduction ceased when all of
the lactate had been oxidized to acetate. The formation of
18 mM acetate from, lactate would yield 72 mM reducing
equivalents. The reduction of 9.6 mM sulfate and 5.1 mM
arsenate would require a total of 87 mM equivalents. The
number of reducing equivalents available from lactate oxidation is, therefore, fairly close to the number required to
reduce the sulfate and the arsenate used by this organism.
54
Fig. 4 Growth of Desulfomicrobium strain Ben-RB in minimal
medium with lactate (21.2 mM), sulfate (10.7 mM) and arsenate
(8.2 mM). An overnight culture of strain Ben-RB, grown in the
same medium, was inoculated (10%) into the experimental flask at
time = 0. G Lactate; R sulfate; M arsenate; m acetate; P optical
density (600 nm)
Table 1 Arsenate reductase activities (reduced benzyl-viologendependent) in Desulfomicrobium strain Ben-RB and Desulfovibrio
strain Ben-RA. Both strains were grown with sulfate or sulfate
plus arsenate as terminal electron acceptor(s). ND Not determined
Strain
Ben-RB
Ben-RB
Ben-RA
Growth with
electron
acceptor(s)
Sulfate
Sulfate, arsenate
Sulfate, arsenate
Specific
activity cell
extract
[µmol·min–1
(mg protein)–1]
Activity
in membrane
(% of
total)
Activity
in soluble fraction (%
of total)
0.021
0.192
< 0.0002
ND
98.4
ND
ND
1.6
ND
Measurement of arsenate reductase activity
in Desulfovibrio strain Ben-RA
and Desulfomicrobium strain Ben-RB
Enzymatic tests were carried out, using reduced benzylviologen, to determine whether respiratory arsenate reductase activity was present in cell extracts of both Desulfovibrio strain Ben-RA and Desulfomicrobium strain BenRB, grown with both arsenate and sulfate (Table 1). As
can be seen, no activity was detected in strain Ben-RA,
while significant levels of activity were found in strain
Ben-RB. The activity in cell extracts was about ten-fold less
when the organism was grown with sulfate only. Interestingly, only 1.6% of the activity was associated with the soluble fraction (i.e., cytoplasm plus periplasm). Most (98.4%)
of the activity was present in the membrane fraction.
Mechanism of arsenate reduction
by Desulfomicrobium strain Ben-RB
The membrane fraction of strain Ben-RB, which contained the arsenate reductase activity, also contained all of
the cytochromes present in the cell (Fig. 5A); the predom-
Fig. 5 A Reduced–oxidized difference spectrum of the membrane
fraction from Desulfomicrobium strain Ben-RB in 50 mM Mes
(pH 6.5; 0.54 mg protein/ml). The reference cuvette contained airoxidized membrane fraction. The experimental cuvette contained
the membrane fraction in an anoxic cuvette under an atmosphere
of 100% N2 (as for reduced benzyl-viologen-arsenate reductase activity measurements). Cytochromes were reduced with sodium
dithionite (0.1 mg/ml). Thereafter, 10 mM arsenate was added to
the experimental anaerobic cuvette in order to oxidize the cytochromes; sequential scans were done (each scan: 1.1 min). Arrow shows the direction in which the absorbance is changing.
B Reduced–oxidized difference spectrum of the cell extract from
Desulfovibrio strain Ben-RA (1.93 mg protein/ml in 50 mM Mes,
pH 6.5). The reference cuvette contained air-oxidized extract. The
experimental extract was in an anoxic cuvette under an atmosphere
of 100% N2 (as for reduced benzyl-viologen-arsenate reductase activity measurements); cytochromes were reduced with sodium
dithionite (0.1 mg/ml). Following reduction, 10 mM arsenate was
added. Thereafter sequential scans were done (each scan: 1.1 min),
with a total scanning time of 24 min
inant being a cytochrome c551. The soluble fraction did not
contain significant amounts of cytochrome. When, under
anoxic conditions, the membrane cytochromes were reduced with sodium dithionite (Fig. 5A), the addition of arsenate resulted in the reoxidation of the cytochromes.
This was observed with both total cell extracts and the
membrane fraction (Fig. 5A). Presumably, arsenate is reduced in strain Ben-RB via electrons transported from cytochromes (predominantly cytochrome c551) of a membrane-bound electron transport system.
55
Discussion
Fig. 6 Southern hybridization of Desulfovibrio strain Ben-RA
chromosomal DNA with α32P-labeled arsC probe. Lane 1 pWSU1
(contains arsRDABC genes of R773) DNA; lanes 2–4 Desulfovibrio strain Ben-RA chromosomal DNA. The restriction enzymes
used are indicated. The positions of λ (HindIII) digested molecular
weight (MW) markers are shown. See Materials and methods for
details
Mechanism of arsenate reduction
by Desulfovibrio strain Ben-RA
Cell extracts of strain Ben-RA also contained cytochromes, the predominant being of the cytochrome c552
type (Fig. 5B). When, under anoxic conditions, the cytochromes were reduced with sodium dithionite, the addition of arsenate did not result in the reoxidation of the cytochromes (Fig. 5B). Arsenate reduction in strain Ben-RA
did not, therefore, involve cytochrome c552.
This organism was found to have, associated with its
chromosome (and not with a 23 kb plasmid also present in
the cell), a gene homologous to the arsC gene of the E.
coli plasmid R773, as detected by Southern hybridization
(Fig. 6). Interestingly, the sequence similarity did not extend to the arsA (encodes the ATPase) and arsB (encodes
the pump) genes (data not shown). Since no respiratory
arsenate reductase activity was detected, this finding suggests that Desulfovibrio strain Ben-RA reduces arsenate
to arsenite using an arsenate reductase similar to the ArsC
enzyme encoded by the arsC gene of the R773 ars system
(Gladysheva et al. 1994).
The nature of the electron donor that might be involved
in arsenate reduction in strain Ben-RA is not known, as
neither NADH+H nor NADPH+H+ could reduce arsenate
in cell extracts of this sulfate-reducer grown with sulfate/arsenate (data not shown). However, incubation of
cell extracts with arsenate and the electron donor lactate,
resulted in a reduction of arsenate at a significant rate
[0.12 µmol·min–1·(mg protein)–1], as compared to the rate
[0.01 µmol·min–1·(mg protein)–1] when lactate was not
present.
Using Southern analysis, homologues of the arsA,
arsB, or arsC genes of R773 were not detected on either
the chromosome or on a 6.5-kb plasmid of strain Ben-RB.
In this paper are described two newly isolated sulfate-reducing bacteria, Desulfovibrio strain Ben-RA and Desulfomicrobium strain Ben-RB, that reduce both sulfate and
arsenate. This is not the first description of a sulfate-reducing bacterium that can reduce both of these electron
acceptors. Recently, “D. auripigmentum” was isolated and
shown to reduce/respire with both arsenate and sulfate.
However, unlike the two organisms described here, which
could reduce both electron acceptors concomitantly, the
presence of arsenate inhibited the reduction of sulfate by
“D. auripigmentum”; sulfate reduction only occurred
when all arsenate present initially in the culture had first
been reduced to arsenite (Newman et al. 1997a,b). These
differences suggest that for Desulfovibrio strain Ben-RA
and Desulfomicrobium strain Ben-RB, arsenate and sulfate reduction are separate processes. It is unclear how
“D. auripigmentum” reduces arsenate (Newman et al.
1997b).
The rates of growth and arsenate/sulfate reduction by
Desulfovibrio strain Ben-RA and, especially, Desulfomicrobium strain Ben-RB are also higher than those of “D.
auripigmentum” (Newman et al. 1997b). When grown
with sulfate (10 mM) only, the doubling time for Desulfomicrobium strain Ben-RB was 6 h. Doubling time for
growth with arsenate (6 mM) only as the electron acceptor was 9 h. When grown with both sulfate (10 mM) and
arsenate (8 mM), the doubling time was 8 h. The doubling
time for growth of “D. auripigmentum” on either arsenate
or sulfate appeared to be much greater – in the order of 1
or 2 days (Newman et al. 1997a,b).
The mechanisms used by Desulfovibrio strain Ben-RA
and Desulfomicrobium strain Ben-RB for arsenate reduction are quite different. Arsenate reduction in Desulfovibrio
strain Ben-RA does not support growth. Instead, an ArsClike protein, similar to that encoded by the arsC gene of the
E. coli R773 arsenic resistance system, probably reduces
arsenate to arsenite. This is based on the finding that strain
Ben-RA contains a chromosomally-borne arsC-like gene,
as determined by Southern hybridization. The level of sequence similarity between these genes is not known; however it is apparent from the weak hybridisations exhibited
(Fig. 6; lanes 2–4) compared to the positive control (Fig.
6, lane 1) that the degree of sequence similarity is not
high. It is noteworthy that the presence of an arsC-like
gene in Desulfovibrio strain Ben-RA appears to represent
the first example of an arsenic resistance system detected
in strict anaerobes.
Interestingly, no arsA or arsB homologues were detected on the chromosome of Desulfovibrio strain BenRA. The mechanism used by this organism to protect itself
from arsenite is, therefore, not clear. However, it is possible that arsB and arsA homologues were simply not detected by Southern hybridization because they are very different from the analogous genes of the R773 ars system.
The Desulfomicrobium strain Ben-RB does not appear
to have an R773-like ars system. Instead it can respire us-
56
ing arsenate as the terminal electron acceptor, as arsenate
reduction supports the growth of this organism in minimal
medium. It is important to note that growth on lactate
without the presence of an electron acceptor did not occur.
The organism also possesses, when grown in the presence
of arsenate, an active arsenate reductase. The mechanism
used by this organism to protect itself from arsenite is not
known.
The enzyme of Desulfomicrobium strain Ben-RB that
reduces arsenate is located in the membrane fraction. It is
either a cytochrome of the c-type or is associated in the
membrane with such a cytochrome. Thus, the arsenate reductase of the Desulfomicrobium strain Ben-RB is different from the only other known respiratory arsenate reductase, recently purified and characterized, found in C. arsenatis (Krafft and Macy 1998). C. arsenatis is the only
known arsenate-respiring bacterium that grows using acetate as the electron donor/carbon source; other organisms
(e.g., “Geospirillum arsenophilus”, formerly strain MIT13; “Geospirillum barnseii”, formerly strain SES-3 [Lovley and Coates 1997]) are unable to do so (Newman et al.
1997a,b).
The arsenate reductase (Arr) of C. arsenatis is present
in the periplasm of this organism. The enzyme consists of
two subunits, with molecular masses of 87 kDa (ArrA)
and 29 kDa (ArrB), and is a heterodimer (α1β1) with a native molecular mass of 123 kDa. Arr cofactor constituents
include molybdenum, iron, and acid labile sulfur as cofactor constituents. The Km for arsenate is 0.3 mM and the
Vmax is 7013 µmol arsenate reduced·min–1 (mg protein)–1.
Nitrate, sulfate, selenate and fumarate cannot serve as alternative electron acceptors for the arsenate reductase.
The N-terminus of ArrA is similar to that of a number of
prokaryotic molybdenum-containing polypeptides (e.g.,
the formate dehydrogenases H and N of E. coli), and the
N-terminus of the ArrB is similar to iron-sulfur proteins.
If the arsenate reductase of Desulfomicrobium strain
Ben-RB is not simply associated with a c-type cytochrome in the electron transport system, but this cytochrome actually catalyzes the reduction of arsenate,
then the enzyme may be similar to the multiheme c-type
metal reductase cytochromes found in other sulfate-, sulfur- or iron (III)-reducing bacteria. Such metal reductase
activity was first demonstrated for the soluble cytochrome
c3 of Desulfovibrio vulgaris, which was shown to reduce
both chromium (VI) and uranium (VI) (Lovley et al.
1993; Lovley and Phillips 1994). It has since been found
that various multiheme c-type cytochromes of sulfate-reducing bacteria (i.e., those belonging to class III of Ambler’s classification [Lojou et al. 1998a]) all function as
iron (III) reductases (Lojou et al. 1998a). These cytochromes are usually located in the periplasm and include cytochromes such as the cytochrome c7 or c551.5 of
Desulfuromonas acetoxidans (Pereira et al. 1997; Aubert
et al. 1998), cytochrome c3 of Desulfovibrio vulgaris
Hildenborough, octahemic cytochrome c3 (Mr: 26,000) of
Desulfovibrio desulfuricans Norway, tetrahemic cytochrome c3 (Mr: 13,000) of Desulfovibrio desulfuricans
Norway, and cytochrome c3 of Desulfovibrio gigas. In ad-
dition, the cytochrome c7 of D. acetoxidans can reduce
manganese (IV), vanadium (V) and chromium (VI), as
well as elemental sulfur (Aubert et al. 1998; Lojou et al.
1998b). Finally, the cytochrome c552 of Geobacter sulfurreducens also has metal reductase activities; it acts as
an iron (III) reductase for electron transfer to insoluble
iron hydroxides or sulfur, and manganese dioxide (Gaspard et al. 1998; Seeliger et al. 1998).
Unlike the multiheme cytochrome c-type metal reductases described above, which are soluble (usually
periplasmic) proteins, the c-type cytochrome involved in
arsenate reduction by the Desulfomicrobium strain BenRB is in the membrane. It would be interesting to purify
and characterize the membrane-bound arsenate reductase
in order to determine whether it actually is a cytochrome.
If this is the case it would be important to characterize the
cytochrome in order to compare it with the cytochrome ctype periplasmic metal reductases described above, as
well as with the periplasmic arsenate reductase of C. arsenatis.
Acknowledgements This work was supported by an Australian
Research Council Grant A09925054 and two Central Large La
Trobe University grants to J.M.M. We would like to thank T.
Krafft for helpful discussions and assistance with experiments concerned with respiratory arsenate reductase activity, D. Flood for
technical assistance, and R.D. Schnagl for carrying out the electron
microscopy of strains Ben-RA and Ben-RB that permitted the determination of flagellar number and location. We would also like
to thank B. Rosen for providing us with plasmid pWSU1.
References
Aubert C, Lojou E, Bianco P, Rousset M, Durand M-C, Bruschi
M, Dolla A (1998) The Desulfuromonas acetoxidans triheme
cytochrome c7 produced in Desulfovibrio desulfuricans retains
its metal reductase activity. Appl Environ Microbiol 64:13081312
Blum JW, Bindi AB, Buzzelli J, Stolz JF, Oremland RS (1998)
Bacillus arsenicoselenatis sp. nov., and Bacillus selenitireducens sp. nov.: two haloalkaliphiles from Mono Lake, California that respire oxyanions of selenium and arsenic. Arch Microbiol 171:19–30
Bobrowicz P, Wysocki R, Owsianik G, Goffeau A, Ulaszewski S
(1997) Isolation of three contiguous genes, ACR1, ACR2 and
ACR3, involved in resistance to arsenic compounds in the yeast
Saccharomyces cerivisiae. Yeast 13:819–828
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal Biochem 72:248–254
Cai J, Salmon K, DuBow MS (1998) A chromosomal ars operon
homologue of Pseudomonas aeruginosa confers increased resistance to arsenic and antimony in Escherichia coli. Microbiology 144:2705–2713
Carlin A, Shi W, Dey S, Rosen BP (1995) The ars operon of Escherichia coli confers arsenical and antimonical resistance. J Bacteriol 177:981–986
Chen CM, Misra TK, Silver S, Rosen BP (1986) Nucleotide sequence of the structural genes for an anion pump. The plasmid
encoded arsenical resistance operon. J Biol Chem 261:15030–
15038
Diorio C, Cai J, Marmor J, Shinder R, DuBow MS (1995) An
Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in gram-negative bacteria. J Bacteriol 177:2050–2056
57
Felenstein J (1993) PHYLIP (phylogeny inference package), Version 3.5c. Department of Genetics, University of Washington,
Seattle, USA
Gaspard S, Vazquez F, Holliger C (1998) Localization and solubilization of the iron(III) reductase of Geobacter sulfurreducens.
Appl Environ Microbiol 64:3188–3194
Gladysheva TB, Oden KL, Rosen BP (1994) Properties of the arsenate reductase of plasmid R773. Biochemistry 33:7288–7293
Humphreys GO, Willshaw GA, Anderson ES (1975) A simple
method for the preparation of large quantities of pure plasmid
DNA. Biochim Biophys Acta 383:457–463
Hungate RE (1969) A roll tube method for cultivation of strict
anaerobes. In: Norris JR, Ribbons DW (eds) Methods in microbiology, vol 3B. Academic, New York, pp 117–132
Kaur P, Rosen BP (1992) Plasmid-encoded resistance to arsenic
and antimony. Plasmid 27:29–40
Krafft T, Macy JM (1998) Purification and characterization of the
respiratory arsenate reductase of Chrysiogenes arsenatis. Eur J
Biochem 255:647–653
Lane DJ (1991) 16 S/23 S rRNA sequencing. In: Stackebrandt E,
Goodfellow M (eds) Nucleic acid techniques in bacterial systematics. Wiley, Chichester, pp 115–163
Lojou E, Bianco P, Brusch M (1998a) Kinetic studies on the electron transfer between various c-type cytochromes and iron (III)
using a voltametric approach. Electrochimica Acta 43:2005–
2013
Lojou E, Bianco P, Bruschi M (1998b) Kinetic studies on the electron transfer between bacterial c-type cytochromes and metal
oxides. J Electroanal Chem 452:167–177
Lovley DR, Coates JD (1997) Bioremediation of metal contamination. Currt Opin Biotechnol 8:285–289
Lovley DR, Phillips EJP (1994) Reduction of chromate by Desulfovibrio vulgaris and its c3 cytochrome. Appl Environ Microbiol 60:726–728
Lovely DR, Widman PK, Woodward JC, Phillips EJP (1993) Reduction of uranium by cytochrome c3 of Desulfovibrio vulgaris. Appl Environ Microbiol 59:3572–3576
Macy JM, Michel TA, Kirsch DG (1989) Selenate reduction by a
Pseudomonas species: a new mode of anaerobic respiration.
FEMS Microbiol Lett 61:195–198
Macy JM, Nunan K, Hagen KD, Dixon DR, Harbour PJ, Cahill M,
Sly L (1996) Chrysiogenes arsenatis gen. nov., sp. nov., a new
arsenate-respiring bacterium isolated from gold mine wastewater. Int J Syst Bacteriol 46:1153–1157
Mägli A, Rainey FA, Leisinger T (1995) Acetogenesis from
dichloromethane by a two- component mixed culture comprising a novel bacterium. Appl Environ Microbiol 61:2943–2949
Maidak BL, Olsen GL, Larsen N, Overbeek R, McCaughey MJ,
Woese CR (1997) The RDP (Ribosomal Database project). Nucleic Acids Res 25:109–111
Newman DK, Beveridge TJ, Morel FMM (1997a) Precipitation of
arsenic trisulfide by Desulfotomaculum auripigmentum. Appl
Environ Microbiol 63:2022–2028
Newman DK, Kennedy EK, Coates JD, Ahmann D, Ellis DJ, Lovley DR, Morel FMM (1997b) Dissimilatory arsenate and sulfate reduction in Desulfotomaculum auripigmentum sp. nov.
Arch Microbiol 168:380–388
Oden KL, Gladysheva TB, Rosen BP (1994) Arsenate reduction
mediated by the plasmid-encoded ArsC protein is coupled to
glutathione. Mol Microbiol 12:301–306
Pedersen K, Arlinger J, Ekendahl S, Hallbeck L (1996) 16 S rRNA
gene diversity of attached and unattached bacteria in boreholes
along the access tunnel to the Äspö hard rock l laboratory Sweden. FEMS Microbiol Ecol 19:249–262
Pereira IAC, Pacheco I, Liu M-Y, LeGall J, Zavier AV, Teixeira
M (1997) Multiheme cytochromes from the sulfur-reducing
bacterium Desulfuromonas acetoxidans. Eur J Biochem
248:323–328
Rainey FA, Dorsch M, Morgan HW, Stackebrandt E (1992) 16S
rDNA analysis of Spirochaeta thermophila: its phylogenetic
position and implications for the systematics of the order
Spirochaetales. Syst Appl Microbiol 15:197–202
Saitou N, Nei M (1987) The neighbour-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol
4:406–425
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a
laboratory manual, 2nd edn. Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY
San Francisco MJD, Hope CL, Owolabi JB, Tisa LS, Rosen BP
(1990) Identification of the metalloregulatory element of the
plasmid-encoded arsenical resistance operon. Nucleic Acids
Res 18:619–624
Seeliger S, Cord-Ruwisch R, Schink B (1998) A periplasmic and
extracellular c-type cytochrome of Geobacter sulfurreducens
acts as a ferric iron reductase and as an electron carrier to other
acceptors or to partner bacteria. J Bacteriol 180:3686–3691
Silver S (1998) Genes for all metals – a bacterial view of the periodic table. J Indust Microbiol Biotechnol 20:1–12
Stackebrandt E, Goebel BM (1994) Taxonomic note: a place for
DNA-DNA reassociation and 16S rRNA sequence analysis in
the present species definition in bacteriology. Int J Syst Bacteriol 44:846–849
Strunk O, Gross O, Reichel B, May M, Hermann S, Stuckmann N,
Nonhoff B, Ginhart T, Vilbig A, Lenke M, Ludwig T, Bode A,
Schleifer K-H, Ludwig W (1998) ARB: a software environment
for sequence data. http://www.mikro.biolgie.tu-muenchen.de.
Department of Microbiology, Technische Universität München,
Munich, Germany
Summers AO (1992) Untwist and shout: a heavy metal-responsive
regulator. J Bacteriol 174:3097–3101
Xu C, Zhou T, Masayuki K, Rosen BP (1998) Metalloid resistance
mechanisms in prokaryotes. J Biochem 123:16–23