www.sciencemag.org/cgi/content/full/320/5878/928/DC1
Supporting Online Material for
Hidden Neotropical Diversity: Greater Than the Sum of Its Parts
Marty A. Condon,* Sonja J. Scheffer, Matthew L. Lewis, Susan M. Swensen
*To whom correspondence should be addressed. E-mail: mcondon@cornellcollege.edu
Published 16 May 2008, Science 320, 928 (2008)
DOI: 10.1126/science.1155832
This PDF file includes:
Materials and Methods
Figs. S1 to S10
Tables S1 and S2
Appendices S1 and S2
Hidden Neotropical Diversity: Greater Than The Sum Of Its Parts
ON-LINE SUPPLEMENTARY TEXT AND FIGURES
Marty A. Condon1, Sonja J. Scheffer2, Matthew L. Lewis2, and Susan M. Swensen3
Materials and Methods:
Taxonomy
Blepharoneura is a member of the Blepharoneurinae, considered to be one of the
oldest lineages in the Tephritidae (S1). The genus includes two species groups: the
poecilosoma species group and the femoralis species group (S2). Morphological evidence
supports the monophyly of the poecilosoma group (S1). Prior to preliminary genetic
studies of Blepharoneura (S3), only four species corresponding to the poecilosoma group
of Blepharoneura were accepted as morphologically distinct species, even though
specimens from throughout the Neotropics had been examined (S4).
Host Plants, Collecting, and Rearing
We chose sites in diverse biogeographic zones (Table S1). We searched for
potential host material (flowers or fruit) of any species of Cucurbitaceae along trails or
roadsides where vines were most abundant and accessible. Most host species were rare
(fewer than four clumps of flowering or fruiting branches per 10km x 10m transect).
Only five of the 24 host species were locally common (> 4 clusters of flowering or fruit
branches per 10km x 10m transect): Gurania spinulosa, G. costaricensis, Echinopepon
racemosus, Cyclanthera brachybotrys, and one cultivated host: Cucurbita spp. This
assessment of abundance is site and season dependent. For example, cultivated species of
cucurbits are rare (or absent) in forests, but common in gardens. Even the most common
species of Gurania can be “rare” at some times of the year. A two-year phenological
study of Gurania spinulosa along a 1.8 km transect in Guatopo National Park, Venezuela
(site V-34) revealed distinct seasonal patterns in flowering and dramatic fluctuations in
sex ratios (Fig. S2). We suspect that G. spinulosa (and other species) show similar
seasonal patterns at other sites. For example, in Peru, G. spinulosa is common along
transect P31 (Fig. 1, Table S1) in January, but rare (no flowers or fruit found) along the
same transect in June. Thus, our assessment of hosts as “common” versus “rare” is from
levels of abundance at sites where we were able to find and collect host material.
We used 12m long collecting poles to reach flowers and fruit in the canopy and
we collected all accessible potential host material. We also searched on the ground and
collected flowers and fruit fallen from inaccessible branches. We placed individual
flowers (identified by gender and maturation stage) and fruit in labeled containers and
checked daily for emergence of larvae. Each puparium was placed in an individually
labeled container for rearing. Flies were reared to adulthood in containment facilities.
Some adults from common hosts were used for behavioral assays of courtship displays
and videotaped. Courtship behaviors were used in selection of specimens for sequencing
(see Samples).
Samples and DNA Extraction
We included samples of specimens from all plant species and plant parts from
which flies emerged. If possible, we sampled at least four specimens from each tissue of
a particular host species. Because most of these species of flies are morphologically
cryptic, we cannot detect most species prior to genetic analysis; however, we made an
effort to include any specimens with distinctive behavioral or ecological attributes (e.g.,
flies with distinctive courtship displays, flies from different elevation zones). We also
included any specimens with conspicuously different morphological characters: long
oviscape (sp.14, sp.15); striped wings (sp.16); distinctive wing-spot pattern in males (sp.
9, a sexually dimorphic species). Only reared flies were included in analyses of nuclear
genes; however, we included some specimens swept from the surfaces of host plants, as
well as flies provided by other collectors (Table S1) in samples used for mtDNA COI
analysis (Figs. 1, S2-S7). Specimens from all but two hosts had been stored in -80o
freezers. The only flies reared from two rare hosts (Psiguria warscewiczii and Gurania
insolita), were collected ~20 years ago and stored as pinned specimens. We were unable
to obtain nuclear sequences from those specimens.
Extraction, PCR amplification and sequencing
We used the insect protocol B of the DNeasy Tissue Kit (Qiagen, Valencia, CA,
USA) to extract total nucleic acids from two legs of each fly. PCR amplifications were
carried out with a Mastercycler Gradient thermocycler (Eppendorf Scientific, Inc.,
Westbury, NY, USA) with the following ‘touch-down’ program: initial denaturation for 2
min at 92oC , 12 ‘touch down’ cycles from 58 to 46oC (10 s at 92oC , 10 s at 58-46oC, 1.5
min at 72oC), 27 cycles at 10 s at 92oC, 10 s at 45oC, 1.5 min at 7oC, and a final extension
for 10 min at 72oC. Primers used for PCR and DNA sequencing are listed in Table S2.
We obtained sequences from one mitochondrial gene (mtCOI: cytochrome c oxidase
subunit I, which is commonly called cytochrome oxidase I) and two nuclear genes (EF1α: elongation factor 1 alpha, and CAD). CAD is a large gene, also known as rudimentary,
which includes three domains: carbamoylphosphate synthetase (CPS), aspartate
transcarbamylase (ATC), and dihydroorotase (DHO). We obtained sequences from a
portion of the CPS domain. Mitochondrial COI sequence data were collected from all
individuals in the study. As a limited test of mitochondrial delimitation of species, we
obtained nuclear gene sequence data (EF1-α, 996bp and CAD, 686bp) from all 58
specimens reared from cucurbits at a single site in the Napo region of Eastern Ecuador
(site E19, Table S1). We chose to focus our nuclear analysis on this locality because the
mitochondrial results from flies reared from three host species suggested a large number
of likely species (ten Blepharoneura species) with considerable overlap in host use in
local sympatry (i.e., along a single transect). Thus, this site appeared, a priori, to be
suitable for a test of the mitochondrial results.
Sequencing reactions were carried out with Big Dye Sequencing kits (Applied
Biosystems, Foster City, CA) and analyzed on an ABI 3100 automated DNA sequencer.
Contigs were assembled for each gene region with the software package Sequencher
(Gene Codes Corp., Ann Arbor, MI). For EF1-α and CAD, the few ambiguous or
heterozygous sites were coded as ambiguous. All final contigs used in the study have
been deposited in GenBank (Accession nos. EF531751-EF531769, EF531789-EF531828,
EF531890-EF531891, EU601764-EU602309, EU623470). Contigs were assembled and
aligned with Sequencher (Gene Codes Corp., Ann Arbor, MI). Alignment of all three
gene regions (mtCOI: 693bp, 419 specimens; EF1-α: 996bp, 60 specimens; CAD: 686bp,
60 specimens) was accomplished by eye. Genetic diversity levels were determined by
calculating absolute and corrected P distances in PAUP* 4.0 (S5).
Phylogenetic analysis of sequences
Neighbor-joining (NJ) analyses were conducted in PAUP* 4.0b10 (S5) with
uncorrected “p” distances and treating gaps as missing data. The percent bootstrap values
were generated by analyzing 1000 pseudoreplicated datasets (with random input order of
specimens for each replicate) with the neighbor-joining method in PAUP*. Outgroups for
NJ analyses of the mtCOI dataset were three species from the femoralis group of
Blepharoneura. The mtCOI dataset was analyzed both in its entirety (Figs. S3-S8) and in
subsets comprising reared specimens from specific collection localities (Fig. 1, Table S1).
The alignments of EF1-α and CAD were concatenated and analyzed as one dataset with
the same methods as for the analysis of mtCOI. Two species from the femoralis group of
Blepharoneura were used as outgroups for the analyses of sequences of nuclear genes.
We chose NJ methods to reveal clusters or genetically distinct lines useful as the
first step in the delimitation of species. NJ methods are most appropriate for our dataset,
which includes multiple intra-specific populations of individuals differing by few base
pairs. NJ methods are effective and efficient for analysis of large samples of specimens of
unknown numbers of species.
As a first step toward a more complete study of host-related patterns of
diversification in this group of Blepharoneura, we used maximum likelihood methods to
analyze a combined dataset. Maximum likelihood (ML) analyses were conducted with
GARLI version 0.951-1 (S6) with a concatenated dataset comprising three genes, the
mitochondrial-encoded COI, the nuclear-encoded EF1-α and CAD genes. Outgroups
were the same as for NJ analyses. Parameters for the ML analysis were determined by
analyzing the dataset with Modeltest 3.7 (S7). With both the likelihood ratio test and the
Akaike information criterion within Modeltest, the best model for the dataset was
determined to be the GTR + I + G model. Base frequencies (A= 0.2863; C=0.1889;
G=0.1921; T=0.3327), rate matrix (A-C=2.1833; A-G=9.1555; A-T=3.1342; CG=
1.9062; C-T=25.7732; G-T=1.00), proportion of invariable sites (0.4703), and gamma
distribution shape parameter (0.3524) were all determined by Modeltest and used as fixed
values in GARLI. Multiple runs of GARLI were conducted with both random starting
trees and user-specified trees; the topology with the lowest likelihood score was saved.
Branch support was determined by conducting 100 bootstrap replications under the
likelihood criterion in GARLI with the same parameters as the original analyses except
that the number of generations without improving the topology was lowered to 5000
instead of 10000.
Species delimitation
We used a combination of tree topology (i.e., monophyly) and pairwise distances
(> 4%) to delineate species in this study. Cryptic host specific species of tropical insects
have been recognized on the basis of < 0.5% pairwise divergence in mtCOI, with
morphologically distinct species typically differing by 3% (S8), a level of divergence that
has been advocated for species delimitation (S9). Intraspecific divergence in mtDNA can
differ dramatically among insect species, and some species may not exhibit mitochondrial
monophyly (S10). Thus, we chose an approach that would provide a conservative
preliminary delimitation of likely species within Blepharoneura. Analyses of nuclear
sequences from flies from Napo region of Eastern Ecuador were used as a preliminary
test of mitochondrial species limits and corroborated. In no instance did we use
information on host use to aid decisions regarding species limits as information on hostuse would confound our assessment of both diversity and host specificity.
We chose 4% mtCOI divergence as a conservative value for preliminary
delimitation of species. Delimitation of species at divergence levels as high as 6% has
been contradicted by evidence from allozymes (S3) and there was no evidence of gene
flow between sympatric Costa Rican species sp. 25 and sp. 26, which differ by 5.6% bp
(mtCOI). Consequently, a 6% cutoff would fail to reveal species supported by other
evidence. With a greater than 1% pairwise divergence (a value higher than divergence
levels revealed in studies with host use as a criterion for species-delimitation; e.g., S8),
we would have recognized an additional ten species, all of which would be specialists
(i.e., reared from single species of hosts). Until we have more specimens represented
within closely related lineages (some were represented by only one or two specimens),
we are reluctant to treat them as distinct species. Thus, our choice of > 4% mtDNA
divergence is highly conservative and almost certainly underestimates both diversity and
host specificity.
Ideally, species delimitation should be from detailed genetic, morphological,
and/or behavioral studies of well-sampled populations, collected from locations
throughout their geographic distributions. This information should be accompanied by
formal descriptions making the names and associated information available to the
scientific community. However, few tropical insects (other than Heliconius butterflies)
have been sampled so thoroughly or received such careful study. We consider our current
analysis to represent a preliminary step toward documenting the extraordinary diversity
present within Blepharoneura. Because species-level taxonomy is likely to be unstable as
evidence unfolds, we provide cross-references to names associated with lineages of
Blepharoneura (Appendix S2), and host plants (Appendix S1) as advocated by Mallet et
al. (S11).
Specialists versus Generalists
The terms generalist, specialist, and monophagous are defined differently by
authors interested in patterns of host specificity in the tropics. For example, Novotny et
al. (S12) define as a specialist as any species feeding on >1 species in a genus, and
monophagous as species feeding on a single species of plant. In contrast, Dyer et al. (S13)
define as monophagous any species feeding on a single genus (> one species). Because
samples of hyperdiverse tropical groups often include singletons (one specimen per
species) and doubletons (two specimens per species), diet breadth is difficult to quantify
(S14).
We use the term generalist to refer to species of Blepharoneura reared from more
than one species of plant, and specialist to refer to species reared from only one species
of plant. Most species of both seed-feeders and flower-feeders are strict host taxon
specialists (Fig. S10). The proportion of host taxon specialists increases slightly from
80% to 85.5% (47/55) if we use less conservative criteria for species delimitation (>1%
pairwise difference). These proportions do not change significantly if we omit species
represented by single specimens (30/37 species= 81.1%, excluding singletons) or if we
omit both singletons and doubletons (22/30 =73.3%).
Our ability to quantify levels of specialization was limited both by small samples
and by seasonally limited samples. Singletons, for example, were necessarily (but
perhaps erroneously) scored as specialists. Species represented by bigger samples could
be erroneously scored as specialists if alternate sympatric host plants were not found in
flower during collecting trips. Although these sampling issues are problematic, several
lines of evidence suggest that our assessment of species as specialists versus generalists
represents a reasonable first approximation of host use patterns in these species of
Blepharoneura.
Our sample of 52 species includes seven species represented by single reared
specimens. For two of those species (spp.16, 19) we have additional independent
evidence of specialization. In a separate study, we reared 44 specimens reared from two
host species in northern Venezuela of which 15 specimens were reared from Psiguria
racemosa and the rest were reared from Gurania spinulosa. Allozyme analysis (S3)
revealed four sympatric species of Blepharoneura, all 15 specimens reared from P.
racemosa are conspecific (=sp.19), and no representatives of sp.19 were reared from G.
spinulosa, suggesting that sp.19 is a specialist on P. racemosa. Species 16 is a
morphologically distinctive species with striped wings (all other species in our sample
have spotted wings) and we have reared only five specimens of sp.16 over the past 20
years, and all specimens of this apparently rare species of fly have been reared from male
flowers of Gurania makoyana. Four of the seven singleton species (spp.17, 19, 40, 45)
were reared from Psiguria, and three of those four species were members of a clade of
species apparently restricted to Psiguria (Fig. 2: spp. 17-20, 71% bootstrap support),
suggesting that those species share a history of specificity to the genus.
Our sample also includes eight species represented by only two reared individuals
(=doubletons). Again, samples of only two individuals of a species are very small, but
different lines of evidence support our assessment of specialization. For example, one
species (sp. 20) is represented by a single specimen from Peru and a single specimen
from Bolivia. Both specimens were reared from the same rare host (male flowers of
Psiguria ternata) and were not reared from more common hosts. Two species
(spp.14,15), each represented by only two specimens, were morphologically similar to
each other, but their long ovipositors readily distinguish them from other species. These
species were determined to be sister species (99% bootstrap support) and both were
reared only from G. eriantha, but from different sides of the Andes. Their status as sister
species, together with their extreme geographic isolation, suggests that their fidelity to a
single host species is probably real and highly conserved. The status of a fourth
doubleton (sp. 23) as a rare specialist was supported by allozyme studies (S3) as a sample
of 51 specimens reared from flowers of G. costaricensis yielded three individuals all
reared from female flowers found at elevations >600m. A fifth doubleton (sp. 44) feeds
on G. insolita, a host that we have not found in flower at the same time as G. spinulosa.
Yet, sp. 44 was never reared from G. spinulosa, nor were any G. spinulosa flies reared
from G. insolita. Although our samples were small, and we do not yet have good
temporal series of collections from single sites, these observations suggests that
specialists do not act as generalists through time by switching among species with
different peak flowering seasons.
Finally, we note that use of the term generalist to describe any species feeding on
more than a single host species lumps ecologically distinct patterns. For example, sp. 10
(represented by 20 specimens) was counted as a generalist even though 19/20 specimens
were reared from the same host species. In contrast, sp.27 (represented by 40 specimens)
is a taxon-generalist as it was reared multiple times from four species of plants (two in
Central America and two in western Ecuador). Compared to sp.10 and sp. 27, sp. 30
shows remarkable geographic variation in its patterns of host use (Fig.1). In French
Guiana, we reared ten specimens of sp. 30: half from G. acuminata and half from G.
spinulosa. In Peru, all specimens of sp. 30 (N= 4 specimens) were reared from G.
spinulosa, even though our Peruvian sample included 21 flies reared from G. acuminata;
in Bolivia, both specimens of sp. 30 of were from G. acuminata, although the Bolivian
sample included 18 flies from G. spinulosa. Such variation suggests that some species
(e.g., sp. 30) are quite plastic in their patterns of host use.
Figure S1: Gurania and Psiguria have brightly colored flowers, short-lived female
branches, and long-lived male inflorescences. Female branches (A,B) produce few
flowers at nodes on branches flowering for only one or two weeks; male branches
produce multiple long-lived inflorescences, each of which bears many flowers (C-F). A:
Female branch of Gurania spinulosa (site V34); B: Female branch of Psiguria triphylla
(site V34); C: Old male inflorescence of P. triphylla. This inflorescence produced flowers
continuously for at least four months. Each flower opens for only one day, and then
abscises, leaving a scar. One flower per inflorescence usually opens every other day. D:
Male inflorescence of G. spinulosa, with a female Blepharoneura inserting her ovipositor
into a flower (site E19). E: A portion of a male inflorescence of G. eriantha (site E19).
Male inflorescences of G. eriantha are large (~10 cm diameter). F: A young male
inflorescence of G. makoyana (site C14). Site locality data in Table S1.
20
Sex Ratio
15
10
5
0
J
M
J
M
S
N
J
M
J
M
S
N
Number of Branches
120
80
40
0
J
F M A M J
J
A S O N D J
1979
F M A M J
J
A S O N D
1980
Months
Figure S2: Seasonal flowering patterns in Gurania spinulosa along a 1.8km roadside
transect in Guatopo National Park, Venezuela. Top: Monthly sex ratio (#branches
with male flowers:#branches with female flowers) fluctuates inversely with numbers of
plants in flower in a population. Sex ratio based on number of flowers would be more
male-biased. Male branches bear 10 to 20 inflorescences, which typically produce
flowers continuously for one to four months. Female branches typically produce 10-20
flowers for about one week; they stop flowering as fruit develop. Bottom: Solid bars
indicate the number of branches bearing male flowers and open bars indicate the number
of branches bearing female flowers. Site V34 (Table S1) includes this roadside
population. Methods are described in detail in Condon (S20).
Color Key:
Host part:
Seed
Clade V
Host taxon:
Clade W
Guraniinae:
Gurania acuminata
G. costaricensis
G. eriantha
G. eggersii
G. insolita
G. makoyana
G. reticulata
G. spinulosa
G. subumbellata
G. tubulosa
100
100
99
Clade X
100
100
77
100
100
100
Cucurbiteae:
Cayaponia sp.
Cucurbita sp.
Polyclathra sp.
100
100
Sicyeae:
Cyclanthera sp.
Rytidostylis sp.
Echinopepon sp.
100
92
Caught (not reared)
100
100
69
79
100
64
100
B le .1 40 s tem. S ec h. C R
B le .1 41 s tem. S ec h. C R
0 . 0 05 substitutions/
site
B le .7 3 M. G big. B L
B le .7 2 M. G big. B L
B le .3 67 M. G a c um. B O L
B le .3 68 M. G a c um. B O L
B le .3 65 M. G a c um. B O L
B le .3 66 M. G a c um. B O L
B le .3 77 M. G a c um. B O L
75 M. G a c um. B O L
100 BB lele .3
.3 73 M. G a c um. B O L
B le .2 36 M. ga c um.P e ru
B le .2 28 M. ga c um.P e ru
B le .3 62 M. G a c um. B O L
.2 37 21 83 M. ga c um.P e ru
100 BB lele .3
18 M. G a . P
B le .2 29 M. ga c um.P e ru
B le .3 46 M. G S . B O L
B le .3 42 M. G S . B O L
B le .3 40 M. G S . B O L
B le .3 48 M. G S . B O L
B le .3 94 M. P te rn.B O L
93 F . P te rn. B O L
100 BB lele.4.309
f.P re d. P eru
B le .2 87 M. G ret. F G
B le .1 45 M. G ret. F G
B le .2 89 M. G ret. F G
B le .2 90 M. G ret. F G
B le .2 88 M. G ret. F G
B le .1 46 M. G ret. F G
B le .9 0 F . G C H . C R
B le .8 9 F . G C H . C R
B le .4 9 M. G eri. E C js
B le .2 53 F . G e ri. E C js
B le .1 96 M. ge ria n. E c js
B le .1 97 M. ge ria n. E c js
B le .1 98 M. ge ria n. E c js
B le .2 00 F . ge ria n. E c js
B le .7 7 M. G M. C R s tripey
B le .3 28 le k.S e ne c io
B le .3 26 le k.S e ne c io
B le .3 27 le k.S e ne c io
B le .1 39 M. C ay. C R
B le .1 44 M. C ay. C R
B le .3 30 AL N . P R ic o
B le .3 29 AL N . P R ic o
B le .6 2 M. C U C . Mex
B le .7 9 M. P oly.M ex
B le .6 3 M. C U C . C R
B le .1 50 M. C uc .C R
B le .1 49 M. C uc .C R
B le .1 85 c aught. E c js
100
B le .2 26 M. c aygl. P eru
B le .2 25 M. c aygl. P eru
B le .3 33 AL N . P R ic o
B le .5 5 M. P tri. E C
73 Clade Z
100
14
15
Clade Y
82
Psiguria racemosa
P. ternata
P. triphylla
P. warsewiscii
B le .1 95 M. ge ria n. E c js
B le .1 99 M. ge ria n. E c js
B le .2 02 M. ge ria n. E c b
B le .2 01 M. ge ria n. E c b
28
24
22
29
23
13
16
41
46
43
48
42
40 47
B le 41 6 B furc ifer. B O L
B le .7 5 S we pt. C R
B le .7 4 S we pt. C R
Figure S3: Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (base tree). Species are identified by numbers and brackets; colors of
brackets and branch-tips (far-right branch-tip label) indicate host species; colors of inner
(leftmost portion) of branch-tip labels indicate host-part infested by each specimen.
Because the tree is so large, five subclades are identified in this figure: Clade-V (Fig. S4)
through Clade-Z (Fig. S8).
Clade-V
93
96
84
100
100
B le .2 79 M. G S . E C js
B le .2 59 M. G S . E C js
B le .2 81 M. G S . E C js
B le .2 42 M. G S . P eru
B le .2 78 M. G S . E C js
B le .2 43 F . G S . P e ru
B le .2 60 M. G S . E C js
B le .3 24 F . G S . P
B le .3 25 F . G S . P
B le .1 8 M. G S .E c . J S
B le .1 78 c aught. E C js
B le .1 7 M. G S .E c . J S
B le .1 89 c aught. E c js
B le .1 84 c aught. E c js
B le .2 38 M. G S . P eru
B le .1 93 21 83 c aught. E c js
B le .2 82 M. G S . E C js
B le .9 2 M. G S .E C js
B le .1 87 c aught. E c js
B le .1 77 c aught. E C js
B le .1 83 c aught. E c js
B le .2 80 M. G S . E C js
B le .2 57 M. G S . E C js
B le .2 58 M. G S . E C js
B le .3 98 M. G S . B O L
B le .3 39 M. G S . B O L
B le .3 36 M. G S . B O L
B le .2 41 M. G S . P eru
B le .3 97 M. G S . B O L
B le .1 88 c aught. E c js
B le .2 61 M. G S . E C J S
B le .2 62 M. G S . E C js
B le .3 02 M. G ba .F G
B le .3 01 M. G ba .F G
B le .1 57 M. G S . F G
B le .1 63 M. G S . F G
B le .1 60 M. G S . F G
B le .1 16 M. G ba .F G
B le .1 2 M. G S .V e n
B le .3 14 M. G a . P
B le .3 19 M. G a . P
B le .2 30 M. ga c um.P e ru
B le .2 31 21 83 M. ga c um.P e ru
B le .3 15 M. G a . P
B le .3 17 M. G a . P
B le .3 21 F . G a . P
B le .2 74 F . G S . E C js
B le .5 9 F . G S . E c . J S
B le .2 71 F . G S . E C js
B le .2 69 F . G S . E C js
B le .1 9 F . G S . E c js
B le .1 35 F . G S . F G
B le .1 32 F . G S . F G
B le .1 31 F . G S . F G
B le .2 48 F . G S . P e ru
B le .1 55 F . G S . F G
B le .1 29 F . G S . F G
B le .3 49 F . G S . B O L
B le .2 45 F . G S . P e ru
B le .1 26 F . G S . F G
B le .1 30 F . G S . F G
B le .1 4 F . G S . V en
B le .1 3 F . G S . V en
B le .3 03 F . G bb. F G
B le .2 14 F . G S . E c b
B le .2 10 F . G S . E C b
B B M C . 30 M .G M. C R
B le .2 6 M. G M. C R
4
3
10
ble. 2 5 M. G M
100
100
100
100
0 . 005 substitutions/site
85
99
B B M C . 12 M .G M. C R
B B M C . 15 M .G M. C R
B B M C . 16 M .G M. C R
B B M C . 14 M .G M. C R
B B M C . 11 M .G M. C R
B B M C . 29 M .G M. C R
B B M C . 28 M .G M. C R
B le .3 32 M. G . 0 3 P A 0 1
B le .3 31 M. G . 0 3 P A 0 1
B le .3 53 F . G a c um.B O L
B le .3 51 F . G a c um.B O L
B le .3 52 F . G a c um.B O L
B le .3 50 F . G a c um.B O L
B le .3 59 F . G a c um.B O L
B le .3 58 F . G a c um.B O L
B le .3 57 F . G a c um.B O L
B le .3 60 F . G a c um.B O L
B le .3 71 M. G a c um. B O L
B le .3 63 M. G a c um. B O L
B le .3 79 M. G a c um. B O L
B le .3 74 M. G a c um. B O L
B le .3 69 M. G a c um. B O L
B le .3 76 M. G a c um. B O L
B le .3 72 M. G a c um. B O L
5
1
B le .3 06 M. G bc . F G
B le .3 05 M. G c b. F G
B le .1 22 M. G bc . F G
B le .1 23 M. G bc . F G
B le .1 19 M. G bb.F G
100
B le .3 13 M. G a . P
B le .3 20 M. G a . P
B le .2 33 F . ga c um. P eru
B le .3 80 M. G a c um. B O L
2
Figure S4. Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (Clade V). Color coding as in Fig. S3. See Fig. S3 for placement in the base
tree. Clade-V is sister to Clade-W.
Clade-W
Clade V
77
B le .9 3 M. G S .E C js
B le .1 74 M. G S . E c js
B le .2 77 M. G S . E C js
B le .1 76 M. G S . E c js
B le .1 75 M. G S . E c js
B le .2 76 M. G S . E C js
B le .5 8 M. G S .E C js
B le .1 86 21 83 c aught. E c js
B le .1 81 c a ught. E C js
B le .1 94 c aught. E c js
B le .1 90 c aught. E c js
B le .1 82 c aught. E c js
B le .2 0 F . G S . E C js
B le .1 69 M. G S . E c js
B le .3 41 M. G S . B O L
B le .3 38 M. G S . B O L
B le .3 44 M. G S . B O L
B le .3 99 M. G S . B O L
B le .3 43 M. G S . B O L
B le .3 37 M. G S . B O L
99
B le .3 96 M. G S . B O L
B le .1 91 c aught. E c js
B le .3 4M. G S . B O L
99
B le .3 47 M. G S . B O L
B le .1 59 M. G S . F G
B le .1 62 M. G S . F G
58 M. G S . F G
100 BB lele .1
.1 27 M. G S . F G
B le .1 66 M. G S . F G
B le .1 61 M. G S . F G
B le .8 4 M. G C H . C R
B le .8 1 M. G C H . C R
B le .8 8 M. G C L .C R
B le .8 3 M. G C H . C R
B le .8 M. G C H .C R
B le .4 M. G C L . C R
B le .9 1 F . G C H . C R
B le .1 01 M. G C L . C R
B le .1 03 M. G C H . C R
100
B le .4 5 M. G C L .C R
B le .1 05 M. G C H . C R
B le .9 6 M. G S .E C rp
B le .2 2 M. G S .E c . R P
96
B le .2 24 M. G S . E c b
B le .2 15 M. G S . E c b
B le .2 18 M. G S . E c b
B le .2 11 F . G S . E C b
100
B le .2 1 M. G S .E C rp
B le .4 06 m. G Tub .C R
B le .2 16 M. G S . E c b
B le .2 21 M. G S . E c b
100
B le .2 13 F . G S . E c b
B le .2 19 M. G S . E c b
B le .2 09 F . G S . E c b
B le .2 12 F . G S . E c b
B le .2 68 M. G S . E C js
B le .1 71 M. G S . E c js
B le .1 80 c aught. E C js
100
B le .1 70 M. G S . E c js
B le .1 79 c aught. E C js
B le .2 72 F . G S . E C js
100
B le .2 73 F . G S . E C js
B le .2 44 F . G S . P e ru
B le .1 56 F . G S . F G
8
7
6
9
12
11
0 . 00 5 substitutions/site
Figure S5. Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (Clade W). Color coding as in Fig. S3. See Fig. S3 for placement in the base
tree. Clade-W is sister to Clade-V (as indicated).
B le .2 F .G C L . C R
B B M C . 9 F . G M .C R
B B M C . 7 F . G M .C R
B B M C . 17 M .G M. C R
B B M C . 27 F . G C L .C R
B B M C . 24 F . G C L .C R
B B M C . 19 F . G C L .C R
B le .4 1 F . new. C R
B B M C . 5 F . G M .C R
B B M C . 23 F . G C L .C R
B B M C . 4 F . G M .C R
B B M C . 22 F . G C L .C R
B B M C . 21 F . G C L .C R
B B M C . 26 F . G C L .C R
B B M C . 18 F . G C L .C R
B le .1 F .G C L . C R
B le .4 2 F . new. C R
B le .3 1 F . G M. C R
B le .3 2 F . G M. C R
B le .3 0 F . G M. C R
B le .2 9 F . G M. C R
B le .1 09 F . G C L . C R
B le .3 6 M. G C L .C R
B B M C . 20 F . G C L .C R
B B M C . 25 F . G C L .C R
B le .3 3 F . G C L . C R
B le .5 0 F . G egg. E C . rp
B le .3 4 F . G C L . C R
B le .4 3 F . G C L . C R
B le .1 08 F . G C L . C R
B le .1 10 F . G C L . C R
B le .3 5 F . G C H . C R
100
B B M C . 8 F . G M .C R
B le .5 2 M. G S .E C rp
B le .5 7 F . G egg. E Crp
B le .5 4 F . G S . E C rp
B le .5 3 M. G S .E C rp
B le .2 3 F . G S . E C rp
B le .2 20 M. G S . E c b
B le .2 22 M. G S . E c b
B le .4 4 M. G C L .C R
B le .3 7 M. G C H . C R
B le .4 6 M. G C H . C R
B le .4 8 M. G C L .C R
B le .9 8 M. G C L .C R
B le .7 M .G C H . C R
B le .9 9 M. G C L .C R
B le .9 F .G C H .C R
B le .1 11 M. G C L . C R
B le .1 0 F . G C H . C R
B le .1 00 M. G C L . C R
B le .8 6 M. G C L .C R
B le .3 9 M. G C L .C R
B le .1 02 M. G C L . C R
B le .8 7 M. G C L .C R
B le .8 5 M. G C L .C R
B le .1 06 M. G C L . C R
B le .1 04 M. G C L . C R
100
B le .3 M. G C L . C R
B le .4 0 M. G C L .C R
B le .4 7 M. G C H . C R
81
B le .3 8 M. G C H . C R
B le .1 12 M. G C L . C R
B le .8 2 M. G C H . C R
B le .1 43 M.G C . C R
100
B le .1 38 M. P tri. CR
B le .1 42 M.G C . C R
B le .3 08 M. G bb.F G
B le .1 17 F . G bb. F G
B le .1 18 F . G bb. F G
B le .3 04 F . G bb. F G
B le .3 07 M. G bb.F G
B le .2 35 F . ga c um. P eru
B le .3 22 F . G a . P
95 B le .2 32 F . ga c um. P eru
B le .2 34 F . ga c um. P eru
. G a c um.B O L
100 B Blele.3.36164F M.
G a c um. B O L 2 1 .3 0
B le .3 70 M. G a c um. B O L
B le .1 65 M. G S . F G
B le .1 53 M. G S . F G
B le .1 1 M. G S .V e n
B le .3 78 M. G a c um. B O L
96
M. G a . P
100 B leB.2le23.3 16
M. G S . E c b
B le .2 17 M. G S . E c b
B le .6 1 M. P tab. Mex
Mex
100 BBlele.6.840M.M.PPtri.tab.
CR
97
B le .7 8 M. P tri. C R
B le .3 12 M. P tri. C R
86 54
B le .4 10 m. P war C R C O
B le .5 6 M. P ra c . V e n
B le .1 37 M. P tri. CR
100
B le .4 08 m. P red. P e ru
B le .3 95 M. P te rn.B O L
Clade Y
Clade-X
27
25
26
21
18
45
19
17
20
0 . 0 05 su bstitutions /site
Figure S6. Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (Clade X). Color coding as in Fig. S3. See Fig. S3 for placement in the base
tree. Clade-X is sister to Clade-Y.
Clade-Y
Clade X
96
100
B le .2 63 F . G S . E C js
B le .2 54 F . G S . E C js
B le .2 64 F . G S . E C js
B le .1 72 M. G S . E c js
B le .2 67 M. G S . E C js
B le .9 4 F . G S . E C js
B le .3 56 F . G a c um.B O L
B le .2 47 M. G S . P eru
B le .2 65 M. G S . E C js
B le .3 54 F . G a c um.B O L
B le .2 66 F . G S . E C js
B le .2 46 F . G S . P e ru
B le .1 73 M. G S . E c js
B le .2 39 M. G S . P eru
B le .2 40 M. G S . P eru
B le .6 0 F . G S . E c . J S
B le .2 55 F . G S . E C js
B le .1 33 F . G S . F G
B le .9 5 F . G S . E C js
B le .1 34 F . G S . F G
B le .1 20 M. G bb.F G
B le .1 64 M. G S . F G
B le .1 54 M. G S . F G
B le .1 28 F . G S . F G
B le .2 49 M. G ye ll. F G
B le .3 09 M. G y. F G
B le .1 15 M. G ba .F G
B le .2 75 M. G S . E C js
B le .2 50 M. G ye ll. F G
30
0 . 0 05 s ubs titutions /s ite
Figure S7. Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (Clade Y). Color coding as in Fig. S3. See Fig. S3 for placement in the base
tree. Clade-Y is sister to Clade-X.
Clade-Z
B le .3 10 S . G y. F G
B le .1 24 S . G y. F G
B le .3 11 S . G y. F G
B le .1 25 S . G y. F G
97
B le .2 85 S . G re t.F G
100 B le .2 83 S . G re t.F G
B le .2 84 S . G re t.F G
B le .2 86 S . G re t.F G
B le .1 51 S . G S .F G
B le .1 52 S . G S .F G
B le .1 36 S . G S .F G
94 B le .1 21 S . G S .F G
05 S . G S .E c b
100 BB lele .2
.2 04 S . G S .E c b
B le .2 06 S . G S .E c b
B le .2 03 S . G S .E c b
B le .2 27 S . G S .P e ru
99 B le .3 23 S . G S .P
B le .1 6 S . G S . V e n
100
B le .1 5 S . G S . V e n
B le .2 51 S . G S .E C js
B le .2 52 S . G S .E C js
100 B le .5 1 S . G S . E C .js
B le .3 92 S . C yc lbr. B O L
B le .3 85 S . C yc lbr. B O L
B le .3 87 S . C yc lbr. B O L
B
le .3 91 S . C yc lbr. B O L
100
B le .3 88 S . C yc lbr. B O L
B le .3 89 S . C yc lbr. B O L
B le .3 86 S . C yc lbr. B O L
B le .3 90 S . C yc lbr. B O L
B le .3 81 S . E ra c . B O L
B le .3 83 S . E ra c . B O L
100
B le .3 82 S . E ra c . B O L
B le .3 84 S . E ra c . B O L
B le .6 6 S . E c h. B L
B le .6 7 S . E c h. B L
100
100
99
72
96
100
100
100
73
100
100
37
38
36
35
B le .6 8 S . C yc l. C R
B le .1 47 S . C yc l.C R
B le .6 9 S . C yc l. C R
B le .5 S . R yt. C R
B le .6 S . R yt. C R
B le .1 48 S . C yc l.C R
B le .7 0 S we pt. C R
B le .6 5 S we pt. Mex
B le .2 07 30 14 S . C ped. E c b
B le .3 00 M. G s ub.F G
B le .2 94 M. G s ub.F G
B le .2 95 M. G s ub.F G
B le .2 96 M. G s ub.F G
B le .2 99 M. G s ub.F G
B le .2 97 M. G s ub.F G
B le .1 67 S . G s ub. F G
B le .2 92 F . G s ub. F G
B le .2 93 M. G s ub.F G
B le .2 98 M. G s ub.F G
B le .1 13 M. G s ub.F G
B le .1 68 S . G s ub. F G
B le .1 14 M. G s ub.F G
B le .2 91 F . G s ub. F G
B le .3 35 AL N . G uya na
B le .4 07 m. G I . P eru C O
B le .4 01 m. G I . P eru
49
32
33
34
31
39
44
0 . 0 05 s ubs titutions /s ite
Figure S8. Neighbor-joining (NJ) tree from an analysis of mtCOI (693bp) of 419
specimens (Clade Z). Color coding as in Fig. S3. See Fig. S3 for placement in the base
tree. Clade-Z is sister to the Guraniinae-flower clade, which comprises the base tree and
Clades V-Y (Figs. S4-S7) as indicated on the base tree (Fig. S3).
51
72
100
B le.257 M.G S .E C js
B le.18 m.G S .E C NAPO
B le.258 M.G S .E C js
B le.92 M.G S .E C js
B le.17 M.G S .E C js
B le.281 M.G S .E C js
B le.259 M.G S .E C js
B le.278 m.G S .E C J S
sp4
B le.280 M.G S .E C js
61
B le.261 M.G S .E C js
B le.282 M.G S .E C js
87 B le.270 m.G S .E C J S
67
B le.260 M.G S .E C js
69
B le.262 M.G S .E C js
100
B le.279 m.G S .E C J S
B le195 m.G eri.E C .J S
sp14
B le199 m.G eri.E C .J S
100
B le.176 M.G S .E C js
B le.169 M.G S .E C js
B le.93 M.G S .E C js
B le.58 M.G S .E C
B le.20 f.G S .E C js
sp8
53
B le.175 M.G S .E C js
80
B le.174 M.G S .E C js
B le.277 M.G S .E C js
87
B le.276 M.G S .E C js
89
B le.271 F .G S .E C js
65 B le.59 F .G S .E Cjs
sp10
100
B le.269 F .G S .E C js
B le.272 F .G S .E C js
60
sp11
B le.273 F .G S .E C js
100
B le198 m.G eri.E C .J S
B le196 m.G eri.E C .J S
B le197 m.G eri.E C .J S
sp13
60 B le200 f.G eri.E C J S
B le.49 m.G E R I.E C J S
100
B le253 f.G eri.E C J S
B le.171 M.G S .E C js
92
58
sp12
B le.170 M.G S .E C js
100 B le.268 M.G S .E C js
B le.60 F .G S .E C
B le.275 f.GS .E C J S
B le.265 M.G S .E C js
B le.267 M.G S .E C js
B le.172 M.G S .E C js
B le.173 M.G S .E C js
B le.255 F .G S .E C js
sp30
B le.94 F .G S .E C js
B le.95 F .G S .E C js
B le.254 F .G S .E C js
B le.256 f.GS .E C J S
77
B le.264 F .G S .E C js
B le.266 F .G S .E C js
100
B le.263 F .G S .E C js
B le.51 S .G S .E C
sp38
B le.252 S .G S .E C js
B le.251 s .G S .E C J S
100
sp40
B le.55 M.P tri.E C js
out1
B le.141 s tem.S ech.C R
B le.416 B.furcifer
OUT2
0.001 s ubs titutions /s ite
Figure S9: Neighbor joining tree of two nuclear genes (EF1- α, 996bp; CAD, 686 bp)
from 58 specimens reared from three species of hosts at a single site. Colors are the
same as in Fig. 1. Bootstrap values >50 are indicated in bold black type, <50 smaller red
type. Groupings are consistent with Fig. 1 from the same specimens (Table S1).
Number of Species of Blepharoneura
35
30
25
20
15
10
5
0
1 2 3 4
Number of Hosts
Figure S10. Most species of Blepharoneura are reared from single species of hosts.
The species reared from three host species probably represents three host specific species
(see sp. 37 in Clade Z, Fig. S8). The species (sp. 27 in Clade X, Fig. S6) reared from four
host plant species infested only two hosts at any given site: two Central American species
(Gurania costaricensis and G. makoyana), and two South American species (G. eggersii
and G. spinulosa).
Tables and Appendices
Table S1: Collection localities. Most localities represent transects: stretches of trails or roadsides < 20km long, varying less than
400m in elevation; a few localities represent collections from single point locations. Species of Blepharoneura (identified by numbers
from figs. S3-S8) are listed along with their host species. Keys to nomenclature are provided in appendices (host plants- appendix S1;
flies- appendix S2). Biogeographic terminology for the Caribbean subregion (Mexico to northern South America) is from Morrone
(S15); biogeographic terminology for the Amazonian subregion is from Hall & Harvey (S16). PN= Parque Nacional. Of the 419
sequenced specimens, 405 were collected and reared by Condon (with help from students and collaborators); 14 specimens were
provided by A.L. Norrbom (ALN).
COUNTRY:
Biogeographic Province
State: Transect Name;
Elevation (m); Distance (km)
Transect Location
Host Species- Fly species
ID
Site ID
Cochabamba: Villa Tunari; 300340m; 1km
17° 0'4.98"S
65°26'17.10"W
Gurania acuminata- spp. 1, 30
G. spinulosa- spp. 8, 10
Psiguria ternata- sp.22
B1
G. acuminata-spp. 1, 21, 28
B2
G. acuminata- spp.1,2,28
P. ternata- spp. 20, 22
B3
Cyclanthera brachybotrys-sp.36
B4
BOLIVIA
Inambari (S16)
16°59'44.76"S
65°25'39.01"W
Inambari (S16)
Sta. Cruz: nr. P.N. Amboro-Rio
Moile;
300m; 5km
17°21'53.40"S
64° 6'10.80"W
17°23'49.92"S
64° 7'54.30"W
Inambari (S16)
Sta. Cruz: Buena Vista; 320340m; 8km
17°26'25.38"S
63°42'27.18"W
17°29'37.86"S
63°39'35.10"W
Inambari (S16)
Sta. Cruz: nr. P.N. Amboro-cloud
18° 3'30.42"S
Inambari (S16)
Inambari (S16)
forest; 2190m; <1km
63°54'35.94"W
Sta. Cruz: roadside Mairano- P.N.
Amboro; 1360m;
<1km
Sta. Cruz: Bella Vista; 12601440m; 6km
18° 6'55.86"S
63°57'1.56"W
Echinopepon racemosus –sp.35
B5
18°11'13.26"S
63°43'14.16"W
E. racemosus –sp.35
G. spinulosa- spp. 4,8,24
B6
18°13'40.38"S
63°40'49.44"W
Inambari (S16)
La Paz: Florida roadside; 1600m
(single point)
16°22'56"S
67°44'42”W
E. racemosus-sp.35
B7
Inambari (S16)
La Paz: Rio Merke, 3 km W of
Mapiri; 900m (single point)
ALN: Ble66, Ble67
15°18'47"S
68°14'24"W
G. acuminata- sp.28
B8
Inambari (S16)
La Paz: Mapiri, Arroyo Tuhiri;
508m (single point)
ALN: Ble72, Ble73
15°17'26”S
68°15’46W
Malaise trap- Out3
B9
ALN: Ble416
COSTA RICA
Western Panamanian Isthmus
(S15)
Western Panamanian Isthmus
(S15)
Eastern Central America (S15)
Puntarenas: Las Alturas; 1500m;
~2km
8°57’ N
82°50’W
P. triphylla- sp.17, 26
C10
Sn. José: Sn. Isidro;
880m; <1km
Sn. José: Sn. Gerardo de Dota;
2100-2200m; 1km
9°18'35.49"N
83°42'6.55"W
9°32'43.56"N
83°48'50.28"W
G. costaricensis- sp.26
C11
Cayaponia sp.- sp.41
Cyclanthera langaei- sp.31,33
Sechium pittieri- Out1
C12
9°33'11.52"N
83°48'25.42"W
Eastern Central America (S15)
Heredia: El Plastico-Rara Avis;
600-880m; 4km
10°18'10.03"N
84° 2'2.90"W
G. costaricensis-spp.7, 23, 25, 27
C13
G. costaricensis-spp.7 , 25, 27
G. makoyana- spp.5,16,27
P. triphylla-spp.18
C14
G. tubulosa- sp.6
C15
P. warscewizcii- sp.45
C16
Rytidostylis gracilis - sp.34
C17
Curcurbita sp.- sp.43
C18
G. eriantha- spp.13,14
G. spinulosa- spp.
4,8,10,11,12,30,38
P. triphylla- sp.40
Caught (not on host)- sp.48
E19
G. eriantha- sp.15
G. spinulosa- spp. 6, 9, 10, 21, 27,
37
Cyclanthera pedata- sp.32
G. eggersii- sp.27
G. spinulosa- spp. 6,27
E20
10°16'13.62"N
84° 2'59.22"W
Eastern Central America (S15)
Eastern Central America (S15)
Eastern Central America (S15)
Heredia: Horquetas-Plastico; 100500m; 9km
Heredia: Braulio Carrillo roadside;
~800m (single point)
Heredia: La Selva; 46m; < 5km
Eastern Central America (S15)
Sn. José: Sn. Pedro Montes de
Oca; 1200m (single point)
Eastern Central America (S15)
Sn. José: Sn. José; 1100m; <5km
ECUADOR
Napo (S16)
10°20'8.62"N
83°57'31.14"W
10°18'10.03"N
84° 2'2.90"W
10°10’N 83°58’W
10°25'52.61"N
84° 0'12.92" W
9°55'49.12"N
84° 3'8.24"W
ALN: Ble5, Ble6
9°55' N
84° 3' W
Napo: Jatun Sacha Biological
Station;
395-465m; 13km
01o05’28”S,
77o34’22”W
Chocó (S15)
Esmeraldas: Bilsa Biological
Station; 411m; ~5km
00o23’N, 79o45’W
Western Ecuador (S15)
Los Rios: Rio Palenque Biological
Station; 200m; 1km
00o30’S, 79o 30’W
Belizon road; 60-127m; 6km
4°20'46.30"N
FRENCH GUIANA
Guiana (S16)
01o03’04”S,
77o 41’04”W
G. spinulosa- spp. 4, 10, 11, 21
E21
F22
52°20'25.60"W
Guiana (S16)
Guiana (S16)
Guiana (S16)
Cacao road; 28-48m; 8km
4°18'42.01"N
52°22'28.66"W
4°34'22.81"N
52°27'57.12"W
Kaw road;
177-274m; 14km
4°34'11.99"N
52°23'50.40"W
4°41'3.90"N
52°18'18.26"W
Regina- St. George; 50-100m;
19km
4°34'40.94"N
52°14'3.92"W
4°14'49.56"N
52° 7'43.56"W
4° 5'51.10"N
52° 2'56.00"W
GUYANA
Guiana (S16)
MEXICO
Mexican Gulf (S15)
Mexican Gulf (S15)
Mexican Gulf (S15)
G. subumbellata- sp.39
G. spinulosa- sp.37
F23
G. spinulosa- spp. 4, 8, 10, 30
F24
G. acuminata- spp. 1, 4, 10, 21,30
G. reticulata- sp.29, 37
G. spinulosa- spp.4, 8, 10, 30
G. subumbellata- sp. 39
F25
Mazaruni-Potaro: Pakaraima
Mts., Mararuni River, just above
ABC Falls; 700m (single point)
60°5’17”N
60°30’57”W
ALN: Ble335
Gurania subumbellata, sp. 39
G26
Veracruz: Coatepec, El Riscal;
1600m (single point)
19o22’N
97°05’W
ALN: Ble.65
17o47’N
96°18’W
Swept- sp.49
M27
Polyclathra cucumerina- sp.43
Psiguria triphylla- sp.18
M28
Cucurbita sp.-sp. 43
M29
Oaxaca: north of Valle Nacional;
500-850m; 5km
Oaxaca: Valle Nacional; 100m
17o49’N
96°19’W
17o50’24.32”N
96°12’59.41”W
PANAMA
Eastern Central America (S15)
PERU
Inambari (S15)
Inambari (S15)
PUERTO RICO
Puerto Rico (S15)
VENEZUELA
Venezuelan Coast (S15)
Panamá: Cerro Azul; 640m (single
point)
9°10’N
79°25’W
ALN: Ble331, Ble332
G. makoyana- sp.5
Madre de Dios: Pto. MaldonadoInfierno; 200m; 7km
12°40'3.48"S
69°13'25.26"W
Cayaponia glandulosa- sp.42
G. acuminata- spp. 2, 3, 21, 28
G. spinulosa- spp. 4, 10, 30, 38
P31
G. insolita- sp.44
Psiguria ternata- spp. 20,22
P32
Madre de Dios: Reserva Nacional
Tambopata (Explorers Inn); 200m;
~6km
12°43'38.98"S
69°13'41.63"W
12°50'12.74"S
69°17'36.36"W
Adjuntas & Ponce: Rte 123 & 135;
Rte 131, km2; Rte135, km82
ALN: sp46 (Ble329,
Ble330); sp47 (Ble333)
Trapped: spp.46, 47
Miranda & Guarico: Parque
Nacional Guatopo; 525-670m;
14km
10° 6'0.00"N
66°29'60.00"W
G. spinulosa- spp. 4, 10, 21, 38
P. racemosa-sp. 19
10° 1'0.00"N
66°25'0.00"W
PA30
PR33
V34
Table S2: Primers used for PCR amplification (*) and DNA sequencing.
Gene
CO1
CAD
EF1a
Primer
TY-J-1460*
C1-J-2183
TL2-N-3014*
54F*
B-360R*
EF40F*
B-EF2R
B-EF3F
EF53R*
Primer sequence 5’-3’
TACAATCTATCGCCTAAACTTCAGCC
CAACATTTATTTTGATTTTTTGG
TCCATTGCACTAATCTGCCATATTA
GTNGTNTTYCARACNGGNATGGT
CCGTGATTTTGSGACGTCAT
GTCGTGATCGGACACGTCGATTCCGG
GATGGCATCAAGAGCATCGATCAGGG
GTTATAACCCAGCAGCTGTTGCTTTCG
GCGAACTTGCAAGCAATGTGAGC
Source
S17
S17
S17
S18
designed for this study
S19
designed for this study
designed for this study
S19
Appendix S1: Host-plants (Cucurbitaceae) and associated species of Blepharoneura. Many cucurbit genera are in need
of thorough systematic revision. Here we apply certain host names broadly (we lump, rather than split species) and list
commonly used synonyms. Names of tribes are based on recent molecular phylogeny (S21). Blepharoneura species reared
from each host are identified by number as designated in figs. S1-S6; those species reared from >1 host species
(“generalists”) are indicated in red type.
Host Tribe
Host Species
Blepharoneura species (Total)
Number of Specialist
spp: Generalist spp.
Coniandreae
Subtribe: Guraniinae
Gurania acuminata Cogn.
syn: G. bignoniacea (Poepp. &
Endl.) C. Jeffrey, G. ulei Cogn.
G. costaricensis Cogn.
G. eggersii Sprague & Hutchinson
G. eriantha (Poepp. & Endl.)
Cogn.
Syn: G. speciosa (Poepp. & Endl.)
Cogn.
G. insolita Cogn.
G. makoyana (Lemaire) Cogn.
G. reticulata Cogn.
G. spinulosa Cogn. [= G. lobata
(L.) Pruski]
G. subumbellata (Miq.) Cogn.
G. tubulosa Cogn.
Psiguria racemosa C. Jeffrey
P. ternata (M.J. Roem) C. Jeffrey
P. triphylla (Miq.) C. Jeffrey
syn: Anguria tabascensis Donn.
(Mexico)
P. warscewiczii Hook.
Cayaponia glandulosa (Poepp. &
Endl.) Cogn.
Cayaponia sp.
Cucurbita pepo L.
1, 2, 3, 4, 10, 21, 28, 30, 37 (N=9 spp)
4:5
7, 23, 25, 26, 27 (N=5 spp)
27 (N=1 sp)
13, 14, 15 (N=3 spp)
3:2
0:1
3:0
44 (N=1 sp)
5, 16, 27 (N= 3 spp)
29 (N=1 sp)
4, 6, 8, 9, 10, 11, 12, 21, 24, 27, 30, 37
38 (N=13 spp)
39 (N=1 sp)
6 (N=1 sp)
19 (N=1 sp)
20, 22 (N=2 spp)
17, 18, 26, 40 (N=4 spp)
1:0
2:1
1:1
6:7
1:0
0:1
1:0
2:0
3:1
45 (N=1 sp)
42 (N=1 sp)
1:0
1:0
41 (N=1 sp)
43 (N=1 sp)
1:0
0:1
Cucurbitaeae
Sicyeae
Polyclathra cucumerina Bertol.
Cyclanthera brachybotrys (Poepp.
& Endl.) Cogn.
C. langei Cogn.
C. pedata (L.) Schrad.
Echinopepon racemosus (Steud.)
C. Jeffrey
Rytidostylis gracilis Hook & Arn.
Sechium pittieri (Cogn.) C. Jeffrey
43 (N=1 sp)
36 (N=1 sp)
0:1
1:0
31, 33 (N=2 spp)
32 (N=1 sp)
35 (N=1 sp)
2:0
1:0
1:0
34 (N=1 sp)
Out1
1:0
Stem feeder (outgroup host)
Appendix S2: Published names for lineages of Blepharoneura. Some lineages we identify by number (Figs. 1,2, S3-S8)
are also associated with published formal names or monikers. Symbols (♀♂) in monikers refer to the gender of host-flower
infested. Three widespread species (sp. 4, sp.10, sp. 38) include formally named lineages; however, descriptions associated
with those names do not accurately characterize allopatric populations that differ genetically, morphologically, and
behaviorally. Monophyletic allopatric lineages or sympatric host specific lineages could represent separate species. Our
conservative treatment of Blepharoneura only recognizes as species monophyletic lineages with mtDNA COI sequences
differing by > 4% bp. As a result, we lump divergent sympatric host specific lineages (e.g., sp. 37; Clade Z, Fig. S8) as well
as monophyletic allopatric lineages differing by < 4% bp. This appendix provides critical cross-reference to names and
monikers used in other publications.
Blepharoneura
Species ID (Figs.
S3-S8)
4
Allopatric Lineages
Names or Monikers
Additional Characters
Venezuela & Trinidad
♂G.s (S3); B. atomaria (Fabricius) (S2)
Allozymes (S3); morphology &
behavior (S2, S22)
4
Eastern Ecuador
Clade A (S22)
7
8
Costa Rica
Eastern Ecuador
♂G.c(H) (S3)
Clade B (S22)
mtDNA-COI, morphology (S22);
behavior (S23)
Allozymes, morphology (S3)
mtDNA-COI, morphology,
behavior (S23)
10
Venezuela
10
11
12
Eastern Ecuador
Eastern Ecuador
Eastern Ecuador
♀G.s (S3); B. perkinsi Condon &
Norrbom (S2)
Clade F (S23)
Clade E (S23)
Clade D (S23)
19
23
25
27
30
Venezuela
Costa Rica
Costa Rica
Costa Rica
Napo, Ecuador
♂P.rac (S3)
♀G.c (H) (S3)
♂G.c(L) (S3)
♀G.c(L) (S3)
Clade C (S23)
34
34
38
Costa Rica
Guatemala
Venezuela
38
43
Eastern Ecuador
Mexico, Costa Rica,
Venezuela
Bolivia
Ryt fruit (S3)
B. poecilosoma Shiner (S22)
G.s seed (S3); B. manchesteri Condon &
Norrbom (S2)
Seed feeder (S23)
Cuc ♂ (S3); B. diva Giglio-Tos (S22)
OUT2
B. furcifer Hendel
Allozymes (S3); morphology (S2)
mtDNA-COI, morphology (S23)
mtDNA-COI, morphology (S23)
mtDNA-COI, morphology,
behavior (S23)
Allozymes, morphology (S3)
Allozymes, morphology (S3)
Allozymes, morphology (S3)
Allozymes, morphology (S3)
mtDNA-COI, morphology,
behavior (S23)
Allozymes (S3)
morphology (S21)
Allozymes (S3); morphology &
behavior (S22)
mtDNA-COI (S23)
Allozymes (S3), morphology (S22)
Hidden Neotropical Diversity: Greater Than The Sum Of Its Parts
ON-LINE SUPPLEMENTARY TEXT AND FIGURES
Marty A. Condon1, Sonja J. Scheffer2, Matthew L. Lewis2, and Susan M. Swensen3
Supplemental References
S1. A. L. Norrbom, M. A. Condon, in Fruit flies (Tephritidae): Phylogeny and Evolution
of Behavior, M. Aluja, A. L. Norrbom, Eds. (CRC Press, Boca Raton, FL, 1999), pp.
135- 155.
S2. M. A. Condon, A. L. Norrbom, Syst. Entomol. 19, 279-304 (1994).
S3. M. A. Condon, G. J. Steck, Biol. J. Linn. Soc. 60, 443-466 (1997).
S4. R. H. Foote, in A Catalogue of the Diptera of the Americas South of the United
States, P. E. Vanzolini, N. Papavero, Eds. (Departamento de Zoologia, Secretaria da
Agricultura, São Paulo. Fasc. 57: 1-91 (1967).
S5. D. L. Swofford, PAUP*: Phylogenetic Analysis Using Parsimony (*and other
methods). Version 4. (Sinauer Associates, Sunderland, MA, 2002).
S6. D. J. Zwickl, Ph.D. dissertation, The University of Texas at Austin (2006).
S7. D. Posada, K. A. Crandall, Bioinformatics 14, 817-818 (1998).
S8. P. D. Hebert, E. H. Penton, J. H. Burns, D. H. Janzen, W. Hallwachs, Proc. Natl.
Acad. Sci. U.S.A. 101, 14812-14817 (2004).
S9. P. D. Hebert, A. Cywinska, S. L. Ball, J. R. deWaard, Proc. R. Soc. London Ser. B
270, 313-321 (2003).
S10. D. J. Funk, K. E. Omland, Annu. Rev. Ecol. Evol. Syst. 34, 397-424 (2003).
S11. J. Mallet, N. J. B. Isaac, G. M. Mace, Trends Ecol. Evol. 20, 8-9 (2005).
S12. V. Novotny et al., Nature 448, 692-695 (2007).
S13. L. A. Dyer et al., Nature 448, 696-699 (2007).
S14. R. K. Colwell, J. A. Coddington, Philos. Trans. R. Soc. London Ser. B 345, 101-118
(1994).
S15. J. J. Morrone, Annu. Rev. Entomol. 51, 467-494 (2006).
S16. J. P. Hall, D. J. Harvey, Evolution 56, 1489-1497 (2002).
S17. Simon et al., Ann. Entomol. Soc. Am. 87, 651-701 (1994).
S18. J. K. Moulton, B. M. Wiegmann, Mol. Phylogenet. Evol. 31, 363-378 (2004).
S19. S. J. Scheffer, M. L. Lewis, Ann. Entomol. Soc. Am. 94, 648-653 (2001).
S20. M. A. Condon, Ph.D. dissertation, The University of Texas at Austin (1984).
S21. A. Kocyan, L-B. Zhang, H. Schaefer, S. Renner. Mol. Phylogenet. Evol. 44, 553577 (2007).
S22. M. A. Condon, A. L. Norrbom in Fruit flies (Tephritidae): Phylogeny and Evolution
of Behavior, M. Aluja, A. L. Norrbom, Eds. (CRC Press, Boca Raton, FL, 1999),
pp.157-174.
S23. M. A. Condon et al., Biol. J. Linn. Soc. 93, 779-797 (2008).