Current Research Journal of Biological Sciences 4(5): 570-577, 2012 ISSN: 2041-0778 © Maxwell Scientific Organization, 2012 Submitted: May 24, 2012 Accepted: June 23, 2012 Published: September 20, 2012 Molecular Study of nifH1, nifH2, nifH3, nifU, nifV, VF Genes and Classical Approach Cared out to Identification of Azotobacter chrococcum from Soil Adel Kamal Khider Biology Department, College of Education/Scientific Departments, Salahaddin University, Erbil, Iraq Abstract: The present study aimed to compare classical approach with molecular based method for identification of Azotobacter chrococcum from soil samples. A. chrococcum was isolated from soil source in Erbil city, Iraq. They were cultivated under laboratory conditions using Nitrogen free Azotobacter specific medium. A. chrococcum was present in all soil samples. result shows that A. chrococcum were rod shape, motility occur through the use of peritrichous flagella, cysts-forming, positive to oxidase, catalase and tryptophanase test, unable to liquefy gelatin, with insoluble brown or brown-black pigmentation and darken with age. Utilized starch, sucrose, mannitol and moloanat, but not rhamnose. molecular method based on detection of nifgenes have been successfully applied to describe A. chrococcum isolated from soil. The PCR products for nifH1 1102bp, nifH2 246bp, nifH3 128bp, nifU 930bp, nifV 1146bp and VF gene 594bp were detected on gel electrophoresis, while no bands observed for negative control. The isolated bacteria considered Azotobacte chrococcum belonging to Genus Azotobacter. Keywords: Azotobacter, Azotobacter chrococcum, nif gene, nitrogen fixation, PCR target of this work was the development of a method for screening and preliminary recognition of cultures belonging to genusAzotobacter and identification of A. chrococcum through detection of nifH1, nifH2, nifH3, nif U, nifV and VF genes analysis, in order to individuate the most effective one. This study goal is particularly important because the unequivocal characterization of Azotobacter at the species level is not so easily achieved through classical phenotypic methods, mainly due to considerable variations in many phenotypic traits (Jayarao et al., 1992) and this study conceder the first report for identification of Azotobacter depending on molecular approach in Kurdistan region even in Iraq. INTRODUCTION Azotobacter is a free-living nitrogen-fixing bacterium, which is used as a biofertilizer in the cultivation of most crops. Biological nitrogen fixation is an essential step in the nitrogen cycle in the biosphere and it is a major contributor to the nitrogen available to agricultural crops. Nitrogen fixation can be considered as one of the most interesting microbial activity as it makes the recycling of nitrogen on earth possible and gives a fundamental contribution to nitrogen homeostasis in the biosphere (Aquilantia et al., 2004). Microorganisms catalyze biological nitrogen fixation with the enzyme nitrogenase, which has been highly conserved through evolution (Zehr et al., 2003). Nitrogenases are composed of two proteins that can be purified separately: dinitrogenase and dinitrogenasereductase. Dinitrogenase, also referred to as the MoFe protein or component 1 is a 220 to 240 kDa tetramer of the nifDand nifKgene products that contains two pairs of two complex metalloclusters known as the P cluster and the iron molybdenum cofactor (FeMo-co). Dinitrogenasereductase, also referred to as the Fe protein or component 2, is a 60 kDa dimer of the product of the nif H gene, which contains a single (4Fe-4S) cluster at the subunit interface and two Mg-ATP binding sites, one at each subunit (Rubio and Ludden, 2008). The present study was aimed to compare two strategy for the isolation of Azotobacter from soil. depending on classical phenotypic approach, the other MATERIALS AND METHODS Isolation of bacteria: Isolation strategy of Azotobacter from ten soil samples collected from Erbil city during spring 2011, based on streaking of serial soil dilutions on plates containing Nitrogen Free Jensen,s Medium (NFJM) (Difco USA), followed method of Becking (1981). The isolates were purified by streaking on (NFJM) agar plates. The bacterial isolates were characterized, using Nfree Jensen,s medium, Potato dextrose agar (Oxoid England) and Ashbey,s Medium (ASHM) (Alpha India). Gram-staining characteristics and cell morphologies were determined by standard methods (Gerhard et al., 1981). Motility was observed in wet mount using phase contrast microscope. Preliminary physiological characterization such as catalase test, oxidase, Indol, gelatenase, tryptophananase test and 570 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 Table 1: The forwards and the reverse primers used Primer Sequence (5'-3') nifH1-F(cagacacgaagaagccgggc) nifH1-R(gaccagcagcttgttgttga) nifH2-F(cgccggcgcagtgtttgcgg) nifH2-R(cactcgttgcagctgtcggc) nifH3-F(cgatgactgaagactgaacgag) nifH3-R(aaggtgcggtcaggagagaa) nifU-F(atgtgggattattcggaaaaa) nifU-R(tcagcctccatctgccgtggg) nifV-F(gatggctagggtgatcatcgacga) nifV-R(gccattcctcctgccgccagttcg) FV-F(tacagtagcggaaggttagggt) FV-R(tcagccgccgaccttgatgccg) Nucleotide 20 20 20 20 22 20 21 22 24 24 22 22 Table 2: Some cultural, morphological and biochemical characteristics of isolated Azotobacter Insoluble Soluble Sample Cell shape pigment pigment Flagella Catalase A A1 Rod Cinnamon Peritrichous + A2 Rod Brownblack Peritrichous + A3 Rod Brownblack Peritrichous + B B1 Coccobacili Redviolet Peritrichous + B2 Coccobacili Redviolet Peritrichous + B3 Ovoid Yellowgeenish Peritrichous + B4 Rod Brown Peritrichous + C C1 Rod Brown Peritrichous + C2 Rod Brown Peritrichous + C3 Ovoidrod Yellowgrenish Peritrichous + D D1 Coccobacili Redviolet Peritrichous + D2 Coccobacili Greenish Peritrichous + D3 Coccobacili Brown Peritrichous + D4 Rod Greenish Peritrichous + E E1 Rod Cinnamon Peritrichous + E2 Rod Cinnamon Peritrichous + E3 Coccobacili Redviolet Peritrichous + F F1 Ovoidrod Yellowgrenish Peritrichous + F2 Ovoidrod Yellowgrenish Peritrichous + F3 Rod Peritrichous + G G1 Ovoid Redviolet Peritrichous + G2 Coccobacili Yellowgrenish Peritrichous + G3 Ocobaili Brown Peritrichous + G4 Rod Brown Peritrichous + H H1 Ovoid Yellowgrenish Peritrichous + H2 Rod Brownblack Peritrichous + H3 Coccobacili Yellowgrenish Peritrichous + I I1 Ovoid Yellowgrenish Peritrichous + I2 Rod Brown Peritrichous + I3 Rod Brown Peritrichous + J J1 Rod Cinnamon Peritrichous + J2 Rod Brownblack Peritrichous + J3 Rod Yellowgrenish Peritrichous + Reference Setubal et al. (2009) Setubal et al. (2009) Setubal et al. (2009) Setubal et al. (2009) Setubal et al. (2009) Setubal et al. (2009) Oxidase + + + + + + + + + + + + + + + + - Gelatenase + + + + + + + + + + + + + + + + + Treptophanase + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + A-J: Soil samples; A1-J3: Isolated N2-fixing bacteria carbohydrate assimilation test (glucose, malonate, starch, sucrose, rhaminose, inositol and mannitol) according to Atlas et al. (1995) and Forbes et al. (2002). Maintanus of the isolates: Long-term storage of the purified isolates was at 20oC in broth medium with 30% (w/v) glycerol. Short term storage for further characterization was on (NFJM) plates at 4oC (Delves et al., 1996). DNA extraction: Genomic DNA was extracted and purified from bacterial cells using the QI Aamp DNA Mini Kit (Jayashreet et al., 2007). PCR amplification of nitrogenase genes nifH1, nifH2, nifH3, nifU, nifV and FV genes for A. chrococcum was performed. Genes sequence were obtained from NCBI site and were designed in OPERON diagnostic ltd, Germany. The primer length and melting temperature were designed with coordination between forward and reverse primers. The melting and annealing temperature were calculated following (Womble, 2000). Primers Amplification was completed using the protocol and reagents followed of (Rajeswari and Kasthuri, 2009). The programmed temperature sequence was 96ºC followed by 55ºC for one minute and 72ºC for 1 min, the temperature 571 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 sequence was run for 30 cycles, the final product extension was conducted at 72ºC for 6 min followed by 4ºC temperature hold. The primers were used acquired from Operon Biotechnologies, Germany. The forwards and the reverse primers are showing in Table 1. Gel electrophoresis: DNA amplification was checked by electrophoresis of each PCR product in a 1.5% (w/v) agarose gel, in TBE buffer for 1 h at 3.2 V/cm. Gels were stained in ethidium bromide for 15 min and thereafter washed for 5 min. DNA fragments were visualised at 312 nm with a UV-transilluminator Image Master VDS (Amersham Biosciences) (Helmut et al., 2004). RESULTS Totally 10 samples were collected in Erbil city, during April 2011, the intervals of approximately 7 days. All the samples were showing the presence of Azotobacter. These samples were processed through the commonly used procedures such as selective media for isolation N2-fixing bacteria i.e., ASHM. Gram’s staining, Phase contrast observation for motility, Catalase test, carbohydrate hydrolysis test and for identification of free-living diazotrophic organism i.eAzotobacter from the above samples and that can be processed, result shows that Azotobacter sp., are motile, gram negative, oxidase, tryptophanase, catalase and starch hydrolysis positive Table 2. The colony morphology of Azotobacter strains were varying during the isolation in the selective media NFJM, they were very clear, large, mucoid, watery due drops like initially. The mother culture was sub cultured in the same media, 27 colonies were obtained, the colony morphology differs slightly i.e., small and circular, convex in nature. The utilization of different sugars by individual isolates and the subsequent production of gas and acid are generally used as a diagnostic indicator to distinguish Azotobacter at species level Table 3. According to the mentioned characteristics, Azotobacter isolates were identified as A. chrococcum. A. chrococcum were rod shape, motility occur through the use of peritrichous flagella, cysts-forming, positive to oxidase, catalase and tryptophanase test, unable to liquefy gelatin, with insoluble brown or brown-black pigmentation and darken with age, utilized manittol, molonate and not rhaminose A3, B1, B2, C2, C3, D1, D2, E1, F2, F3, G2, H2, H3, I1, I3 and J2 colonies of different soil samples Table 2 and 3. Moreover the molecular method based on detection of nif genes (nitrogenase genes) have been successfully applied. The DNA was isolated from Azotobacter spp. cultures. Their banding pattern of DNA on agarose gel Table 3: Utilization of Different carbon sources, consequent gas formation and acid production by isolated Azotobacter Carbon sources -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Sucrose Starch Rham nose Glucose Maltose Lactose Mannitol Inositol Malonate Arabi nose ---------------------------------------------------------------------------------------------------------------------------g s a g s a g s a g s a g s a g s a g s a g s a g s a g s Samples A A1 + + + - - + + + + + + + + A2 + + + + + + - - + + + + + + + + + A3 + + + + + + + + + + + + + + + + + + + - B1 + - - + + + + + + - B2 + - - + + + + + - + + B B3 + + + + + - W + + + + + + + + + + B4 + + + + + + + - - + + + + + + + + + + C1 + + - - + + + + + - C C2 + W - - + + + + + + + + + + + C3 + + - - + + + + + + + + + + + D1 + + + + + + + - - + + + + W + + + + + + + + W D D2 + W + + + - - + + + + + + + + + W W W + + D3 + + + + + - W + + + + + + + + + + + - D4 + + - - W W + + + + - E1 + + - - W W + + + + + + + + + E E2 + + - - + + + + + - + + E3 + + - - + + + + + + + + - + + F1 + + + + + - W + + + + + + + + + + + F F2 + + - - + + + + + + + + + + F3 + + + + W - W + + + + + + + + + + + + + + G1 + + + + + + - W + + + + + + + + + + + + G G2 + + - - + + + + + + + + + + + G3 + + - - + + + + + + + - G4 + + - - + + + + + + + + + + H1 + + + W + + - W + + + + + + + + + + + + + H H2 + + + + + + + - - + + + + + + + + W H3 + + - - + + + + + + + + + + + + + + I1 + + + + + + + - + + _ _ + + + + + + + I I2 + + + + + + + - - + + + + + + + + + + + I3 + + + + + + + - - + + + + + + + + + + J1 + + - - + + + + + + + J J2 + + + + + + + + - - + + + + + + + + + + + J3 + + - - + + + + + + + + + + A-J: Soil samples; A1-J3: Isolated N2-fixing bacteria; g: Growth of isolates; s: Gas formation; a: Acid production 572 a + + + + + + + + + + + Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 1 2 3 Fig. 1 : The PCR product of Azotobzcter chrococcum isolated from soil as follows: Lane 1: Negative control; Lane 2: A. hrococcum isolate; Lane 3: DNA marker electrophoresis was compared with that of reference Azotobacter strains, the results showed that there was no significance difference in banding pattern Fig. 1. The PCR production was cared out for all tested isolated cultures in order to check the presence of nifH1, nifH2, nifH3, nifV, nifU and FV genes for A. chrococcum. The PCR products for A. chrococcum were nifH1 1102bp, nifH2 246bp, nifH3 128bp, nifU 930bp, nifV 1146bp and FV gene 594bp Fig. 1 lane 2, these genes were detected on gel electrophoresis, while these bands does not appear in the negative control Fig. 1 lane 1. Therefore according to the classical approach, all cultures that considered A. chrococcum compared with that of molecular based method. DISCUSSION This research work firstly aimed to compare two different methods reported in literature for the isolation of Azotobacter from soil samples, in order to individuate the most effective one. Different criteria have been presented by several researchers to delimit characteristic which can be used as a key for identification of Azotobacter, generally included morphological, cultural and biochemical characteristics, highlighting the points which may be used as the diagnostic indications. Ten soil samples were processed through the colony characteristics, morphology and biochemical testes, using commonly used procedures for isolation N2fixing bacteria and identification Azotobacter species in the soil using ASHM medium. All the samples show presences of free living N2-fixing bacteria, i.e., Azotobacter. Varying in colony morphology of Azotobacter species using selective media due to the ability of such isolates to act as oligonitrophiles (Knowles, 1982), represent one of the major problems in isolating Azotobacter. The colony moephology on ASHM medium is not clearly recognizable and the media that used are not to be selective enough because of presence different N2-fixing bacteria in soil samples. Similarly, the enrichment broth media proved not to be selective enough. In fact the pellicle on the enrichment broth surface was manufactured not only for aerobic N2-fixing bacteria, but also by bacteria unable to 573 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 3721 ACCCGCTTCA TCAGCAGCAC TGGCAACGCC GGTCGCCGGT TTGCGCATCC GGTTGAGGGT 3781 GGCGGCTGCT CCGGTCTGAA ATACAGCCTG AAGCTGGAGG AGGCCGGTGC CGAAGGCGAT 3841 CAGCTGATCG ACTGCGACGG CATCACCCTG CTGGTCGACG ATGCCAGCGC CCCTCTGCTC 3901 AATGGCGTGA CCATGGACTT TGTGGAAAGC ATGGAAGGTA GCGGTTTCAC CTTCGTCAAT 3961 CCGAATGCCA GCAACAGCTG TGGTTGTGGC AAGTCTTTTG CTTGCTGATT AGGCAACCCT 4021 GAGGTCGCCG GCTGGGGCCC CAAAGACTCA CTGGGAGATG AAGCCGACAT GTGGGATTAT 4081 TCGGAAAAAG TCAAAGAGCA TTTTTACAAC CCCAAGAATG CCGGAGCCGT GGAAGGCGCC 4141 AACGCCATCG GCGACGTCGG ATCGCTGAGC TGCGGTGACC GGCTGCGTCT GACCCTGAAG 4201 GTGGATCCGG AAACCGACGT GATCCTGGAT GCCGGCTTCC AGACCTTCGG CTGTGGCTCC 4261 GCCATCGCTT CCTCCTCGGC ACTGACCGAG ATGGTCAAGG GGGCTGACCT GGACGATGCG 4321 CTGAAGATCA GCAACAGGGA CATCGCCCAT TTCCTCGGAC GGCTGCCGCG GGAGAAGATG 4381 CACTGCTCGG TGATGGGCCG CGAACGCCTG CAGGCCGCCG TGGCCAACTA CCGTG6CGAA 4441 GAGCTCAGGA CCGACCACGA GAAGCCGCAG CTGATCTGCA AGTCGTTCGC CATCGACGAA 4501 GTGATGGTCC GCGACACCAT TCGCGCCAAC AAGCTGTCCA CCGTCGAGGA CGTGACCAAA 4561 CACACCAAGC GCGGCGGCGG CTGCTCGGCC TGTCATGAGG GCATCGAGCG CGTGCTGAGC 4621 GAGGAGCTGG CGCCCGTGGC GAGGTCTTCG TCGTGCGCCG ACCAAGGCCA AGAAGAGGTC 4681 AAGGTGCTCG CCCCGAGCCG GCTCCGCTCG TGGCCGAGGA GACTCCGCGC CACGCCGAAG 4741 CTGAGCAACC TGCAGCGCAT CCGCCGCATC GAAACCGTGC TGGCGGCGAT CCGTCCGACC 4801 CTGCAGCGCG ACAAGGGTGA TGTCGAGCTG ATCGATGTCG ACGGCAAGAA CATCTACGTC 4861 AAGCTAACCG GCGCCTGCAC CGGCTGCCAG ATGGCCTCCA TGACCCTTGG CGGCATCCAG 4921 CAGCGCCTGA TCGAGGAACT CGGCGAATTC GTCAAGGTGA TCCCGGTCAG CGCCGGCCCA 4981 CGGCAGATGG AGGTCTGACA TGGCTGACGT CTATCTCGAC AACAACGCCA CCACCCGGGT 5041 GGACGACGAA ATCGTCGAGG CCATGCTGCC GTTCTTCACC GABCAGTTCG GCAACCCCTC 5101 GTCGCTGCAC AGCTTCGGCA ACCAGGTCGG CCTGGCGCTG AAGAGGGCGC GGCAGCAGCG 5161 TGCAGGCGTG CTCGGCGAGC ATGATTCGGA AATCATCTTC ACTTCCTGCG GCACCGAGTC 5221 GGATCACGCG ATCCTCTCGG CGCTCAGCCC AGCCCGAGCG CAAGACCTGA TCACCACCGT 5281 GGTCGAGCAC CCGGCAGTGC TGAGCCTGTG CGACTACCTC GCCAGCGAGG GCTACACCGT 5341 GCACAAGCTG CCGGTGGACA AGAAGGGCCG CCTGBATCTG GACCATTACG CCAGCCTGCT 5401 GAACGACGAC GTCGCCGTGG TGTCGGTGAT GTGGGCCAAC AACGAGACCG GCACCCTGTT 5461 CCCGGTCGAG GAAATGGCAC GCATGBCCGA CGAGGCCGGC ATCATGTTCC ACACCGACGC 5521 CGTGCAGGCC GTGCGCAAGC TGCCGATCGA CCTGAAGAAC TCGTCGATCC ACATGCTCTC 5581 GCTGTCGGGC CACAAGCTGC ATCGCAAGGG CGTCGGCGTG CTCTACCTGC GCCGCGGCAC 5641 CCGCTTCCGT CGCTGCTGCC GCGGCCACCA GGAGCGGCCC GCGGGCGGTA CCGAGAACGC 5701 TGCCTCGATC ATCGCCATGG GCTGGGCCGC CGAGCGCGCG CTGGCCTTCA TGGAGCACGA 5761 GAACACCGAG GTCAAGCGCC TGCGCGACAA GCTGGAGGCC GGCATCCTCG CCGTCGTGCC 5821 GCACGCCTTC GTCACCGGCG ACCCGGACAA CCGCCTGCCC AACACCGCCA ACATCGCGTT 5881 CGAGTACATC GAGGGCGAGG CCATCCTGCT GCTGCTGAAC AAGGTCGGCA TCGCCGCCTC 5941 CAGCGGCTCG GCCTGCACCT CCGGCTCCCT GGAGCCCTCC CACGTGATGC GCGCCATGGA 6001 CATTCCCTAC ACCGCCGCCC ACGGCACCGT GCGTTTCTCC CTGTCGCGCT ACACCACCGA 6061 GGAGGAGATC GACCGGGTGA TCCGCGAGGT GCCGCCGATT GTGGCCCAGC TGCGCAACGT 6121 GTCGCCCTAC TGGAGCGGCA ACGGTCCGGT GGAACATCCG GGCAAGGCCT TCGCGCCGGT 6181 CTACGGCTGA GCCGCCGCCT GCGGGAGCGC ATCCCGCAGG AAACCGCCTC GGGGAGCCCC 6241 GCCCGAGTTG TTGGAGAAAG CCATGGCTAG CGTGATCATC GACGACACCA CCCTGCGTGA 6301 CGGCGAGCAG AGTGCCGGGG TCGCCTTCAA TGCCGACGAG AAGATCGCCA TCCGGCGTGC 6361 GCTCGCCGAG CTGGGCGTAC CGGAGCTGGA GATCGGCATT CCCAGCATGG GCGAGGAGGA 6421 GCGCGAGGTG ATGCGCGCCA TTGCCGGCCT CGGCCTGTCG TCGCGCCTGC TGGCCTGGTG 6481 CCGGCTGTGC GACTTCGACC TCTCGGCCGC GCGCTCCACC GGGGTGACCA TGGTCGACCT 6541 GTCACTGCCG ATCTCCGACC TGATGCTGCG CCACAAGCTC AATCGTGATC GCGACTGGGC 6601 ACTGGGCGAG 6TCGCCCGGC TGGTCAGCGA GGCGCGCATG GCCGGGCTTG AGGTGTGCCT 6661 GGGCTGCGAG GACGCCTCGC GGGCGGATCA GGACTTCATC GTGCGGGTGG GGGCGGTGOC 6721 GCAGGCCGCG CGCCCGCCGC CTGCGTTCGC CGATACCGTC GGGGTGATGG AGCCGTTCGG 6781 CATGCTCGAC CGCTTCCGTT TCCTCCGCCA GCGCCTGGAC GTGGAGCTGG AGGTGCACGC 6841 CCACGACGAC TTCGGGCTGG CCACCGCCAA CACCCTGGCG GCGGTGATGG GCGGGGCGAC 6901 CCACATCAAT ACCACGGTCA ACGGGCTCGG CGAGCGCGCC GCCAACGCCG CGCTGGAAGA 6961 GTGCGTGCTG GCGCTCAAGA ACCTCCACGG CATCGACACC GGCATCGACA CCCGCGGCAT 7021 CCCGGCCATC TCGGCGCTGG TCGAGCGGGC CTCGGGGCGT CAGTGGCCTG GCAGAAGAGC 7081 GTGGTTGGCG CCGGTGTTCA CCCACGAGGC CGGCATCCAC GTCGACGGGC TGCTCAAGCA 7141 CCGGCGCAAC TACGAGGGAC TGAATCCCGA CGAGCTCGGC CGCAGCCACA GCCTGGTGCT 7201 GGGCAAGCAT TCCGGCGCGC ACATGGTGCG CAACAGCTAC CGCGAGCTGG GCATCGAGCT 7261 GGCCGACTGG CAGAGCCAGG CACTGCTCGG CCGCATCCGC GCCTTCTCCA CCCGCACCAA 7321 GCGCAGCCCG CAGGCTGCCG AGCTGGAGGA CTTCTATCGC CAGCTGTGCG AGCAGGGGAC 7381 TGCCGAACTG GCGGCAGGAG GAATGGCATG AGCCTGCTTG CGCAATGGCG TGAAGACATC 7441 CGCTGCGTGT TCGAGCGCGA TCCGGCGGCA CGCACCACCT TCGAGGTGCT GACCACCTAT 7501 CCGGGCTGCA CGCGATCATG CTCTACCGGC TCGC4CCATC GTCTGTGGCG GCCGAATGCG 7561 TTACCTCGCC CGGCTGCTGT CGTTCGCGCG CGCCTGGTGA GCAACGTCGA CATCCATCCC 7621 GGGGCCGTCA TCGGTGCGCG CTTCTTCATC GACCACGGCG CCTGCGTGGT GATCGGCGAG 7681 ACCGCCGAGA TCGGCCGGGA CGTGACTCTC TACCACGGCG TCACCCTGGG CGGCACCACT Analysis of predicted nifU and nifV genes products: Sequence gene No.of aminoacids 4068-4998 nifU (930) bp 310 6261-7407 nifV (1146) bp 382 Fig. 2: Sequence of the chromosomal region contains nifH1 gene, nifH2 gene and nifH3 gene in A. chroococcum. Sequence with under lines is sites for primers nifH1-F, nifH1-R, nifH2-F, nifH2-R, nifH3-F and nifH3-R for amplification fix nitrogen, because of present of a certain content of fixed nitrogen and non-selective carbon sources i.e., the streaking and incubation on NFJM andmannitol medium permit a rapid individuation of slimy and glistering Azotobacter like colonies. The important observations that the isolates classified as 574 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 ORIGIN 1 cagacacgaagaagccgggcccgtgacatgcccgccatggactgctgctccgtcgccgca 61 cgccacttcctgcaccagccggcatgaaccccggtaccacatgggaacggatcgccgcgg 121 cgttactaccggtacgccgccagcccgggacgacgcagatcgctgccgtccgactcccga 181 cacatgccatatgcagcatgaaatatcgctgaaaacatattactggtttttttatccaaa 241 aaacaaacaacatatgaaattcacatcttgatggcaccacccttgctccatcccctgcga 301 caccagtcaaacgccacgaatcaatggaggttccaagatggcattgcgtcagtgtgcaat 361 ttacggcaagggtggtatcggcaagtccaccaccacccagaacctggtcgccgcgctcgc 421 cgaggccggcaagaaggtgatgatcgtcggttgcgacccgaaagccgactccacccgcct 481 gatcctgcattccaaggcccagaacaccgtcatggagatggccgcatccgccggctcggg 541 tgaagacctcgagctggaagacgtgctgcagatcggctacggcggcgtcaagtgcgtcga 601 gtccggcggccctgagccgggcgtcggctgcgcgggccgtggcgtgatcaccgcgatcaa 661 cttcctggaagaggaaggcgcctacagcgacgacctggacttcgtgttctacgacgtgct 721 gggcgacgtggtgtgcggcggcttcgccatgccgatccgcgagaacaaggcccaggaaat 781 ctacatcgtctgctccggcgagatgatggccatgtacgccgccaacaacatcgccaaggg 841 catcgtgaagtacgcccactccggcagcgtgcgtctgggcgggctgatctgcaacagccg 901 caagaccgaccgcgaagacgagctgatcatggccctggccgcgaagatcggcacccagat 961 gatccactttgtgccgcgcgacaacgtcgtgcagcacgccgaaatccgccgcatgaccgt 1021 gatcgaatacgatccgaaagccaagcaggccgacgagtaccgtgccctggcccagaagat 1081 cctcaacaacaagctgctggtcatcccgaacccggcgagcatggaggacctcgaagagct 1141 gctgatggagttcggcatcatggaagccgaagacgagtccatcgtcggcaaggccggcgc 1201 cgagggctgatcccgccggcgcagtgtttgcggaggagcgtgcgtcgcgggctgtccgga 1261 atggcttctcgcggccggcacgccgccctcccttttgaatcgccccgaattctccaacct 1321 caggagctgaccctatggccatggccatcgacggctacgaatgcaccgtctgcggcgact 1381 gcaagccggtctgcccgaccggctcgatcgtcctccagggcggtatctacgtgatcgacg 1441 ccgacagctgcaacgagtgcgccgacctgggcgagccacgctgtctcggcgtctgccccg 1501 tggacttctgcatccagccgctcgatgactgaagactgaacgagccgcacccgcttgccg 1561 gcgacagagcatcccgccgctctgccaccggaccaccaaacggcgatcgctttcctcagg 1621 tcgccgttttttctctcctgaccgcacctt Analysis of predicted nifH1, nifH2 and nifH3 genes products: Sequence gene No. of amino acids 1-1102 nifH1 (1102) bp 367 1213-1459 nifH2 (246) bp 82 1522-1550 nifH3 (128) bp 42 Fig. 3: Sequence of the chromosomal region contains nifH1 gene, nifH2 gene and nifH3 gene in A. chroococcum. Sequence with under lines are sites for primers nifH1-F, nifH1-R, nifH2-F, nifH2-R, nifH3-F and nifH3-R for amplification A. chrococcum, when utilized lactose and produce of gas but did not formed acid. While some other species gas producing and acid forming. Utilization of xylose by A. chrococcum and A. beijrenickii were accompanied by both acid production and gas formation. A. paspali produce gas but not forming acid. Maltose pointed positive indication for both acid and gas formation if utilized by A. chrococcum and A. paspali. A. vinelandii utilize maltose, were produce gas without acid formation and A. beijerinckii were forming acid without gas production and all isolates were capable of utilizing glucose, in A. chrococcum and A. paspsli glucose utilization accompanied with gas production and acid formation, while A. vinelandii were positive for acid formation and negative to gas production, A. beijrenickii were gas positive and acid negative. Concerning the utilization along with gas formation and acid production of other sugars showed that the isolates belonging to the same Azotobacter sp., were differ in gas formation and acid production. Same results have also reported by other researchers (Parson, 2003; Tejera et al., 2005). A. chrococcum colonies showed good growth on NFJM with insoluble brown or brown black pigmentation and darken with the age reaching maximum intensity after two weeks at 28oC, while behave differently when grown on potato dextrose agar. They produce some times yellow or white pigment, depending on the ability of these isolates to utilize organic acid which may be present in potato (Brenner et al., 2005) and they differ in utilizing other sugars. These features that observed on the isolates are identical with feature of A. chrococcum (Jensen, 1954; Norris and Chapman, 1968; Brenner et al., 2005; Dworkin et al., 2006). Indeed molecular characterization of the isolates showed that all isolates were identified on ASHM and NFJM media. As concerning assignation into species by means of molecular basis, the utilization of used primer complementary to well-conserved regions in the bacterial genome, led to amplification of the nifgenes, (nitrogenase genes) nifH1, nifH2, nifH3, nifV, nifU and 575 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 FV genes for isolates belonging to genus Azotobacter which identified as A. chrococcum by classical approach. The nifH1 gene was 1102 bp, while nifH2 gene was 2461 bp, these two genes were separated by flank of DNA of 111bp. The nifH3 gene 128bp was separated from nifH2 gene by 63 bp. The genes organization and their sequence are show in Fig. 2. The nifU and nifV gene is clustered in a region of A. chroococcumgenome spanning about 3339 bp Fig. 2. The gene nifU which involved in maturation of Fe for Fe-S cluster synthesis and repair was 930 bp long, while nifV gene, which involved maturation of FeMocomplex, was 1146 bp, these two genes were separated by 1263 bp and nifS is located between them. The region of chromosome which contain nifK, nifD, nifM, nifA, nifN, nifB, nifQ, nifZ, nifP, nifF, nifW, nifB, nifL and nifY genes are located between the fragment of chromosome which contain nifH1, nifH2, nifH3 and the fragment contain nifV, nifS and nifU. Because important of region of nifH1, nifH2 and nifH3, nifV and nifU genes on chromosome they were selected for this study, detected by PCR technique in each of A. chroococcum cells Fig. 3. This allowed to compare and better evaluate selectivity of the isolation strategies tested, extending preliminary identification to the major number of species possible. Previous studies by Kirshtein et al. (1991), Ueda et al. (1995), Zehr et al. (2003), Aquilantia et al. (2004), Mary Ann and Virginia (2007) and Hamilton et al. (2011), N-fixing bacteria were investigated by the diversity of nitrogenase genes in different environments, through amplification of nif genes, i.e., nifH, infD, nifV, nifK, nifU which encode nitrogenase complex from cultivated organisms. The two methods compared, although described as selective for Azotobacter, led to the isolation of a large number of soil bacteria unable to fix nitrogen. This lack of selectivity, possibly due to the ability of such isolates to act as oligonitrophiles (Knowles, 1982), represents one of the major problems in isolating Azotobacter. Similarly, the enrichment on ASHM solution proved not to be selective enough. In fact, the pellicle on the broth surface of the enrichment medium was formed not only by aerobic N-fixing bacteria, but also by anaerobic N-fixing microorganisms. Our conclusion in present study is that the utilization of ASHM and NFJM medium has to be reconsidered. Indeed, this medium revealed to be differential more than selective and is usefulness in the individuation of Azotobacteraceae, followed by sugar tests and must be confirm by molecular bases through amplification of nifgenes for extracted DNA. Presence of A. chrococcum in all soil samples in Erbil city may be due to the ability of this species to grow under different environmental conditions and it may be more resistant to unfavorable conditions. Mrakovacki and Milic (2001) found that the abundance of A. chrococcum in different soil is always possible. ACKNOWLEDGMENT We wish to thank Dr. Aras Dashti from Agriculture College, Salahaddin University for her helpful during isolation of Azotobacter, we also wish to thank Dr. Shanga A.K. in Charite Medical Faculty Humboldt University, Berlin, Germany for their cooperation. REFERENCES Aquilantia, L., F. Favillib and F. Clementi, 2004. Comparison of different strategies for isolation and preliminary identification of Azotobzcter from soil samples. Soil. Biol. Biochem., 36: 1475-1483. Atlas, R.M., L.C. Parks and A.E. Brown, 1995. Laboratory Manual of Experimental Microbiology. Mosby-Year Book Inc., USA. Becking, J.H., 1981. The familyAzotobacteraceae. In: Ballows, A., H.G. Tru¨per, M. Dworkin, W. Harder and K.H. Schleifer (Eds.), the Procaryotes: A Handbook on Habitats, Isolation and Identification of Bacteria. Springer, Heidelberg, pp: 795-817. Brenner, D.J., N.R. Krieg and J.T. Staley, 2005. Bergey's Manual of Systematic Bacteriology. Garrity, G.M. (Ed.), Springer Science Business Media Inc., 233 Spring Street, New York, USA, Vol. 2. Delves, B., P. Black-Burn, R.J. Evans and Z. Hugenhott, 1996. Application of bacteria. Anatonic Van Leeuwen Hock, 69: 193-202. Dworkin, M., S. Falkow, E. Rosenberg, K. Schleifer and E. Stackebrandt, 2006. The Prokaryotes: A handbook on the Biology of Bacteria. Springer Science+Business Media Inc., New York, USA. Forbes, B.A., D.F. Sahm and A.S. Weissfeld, 2002. Diagnostic Microbiology. 11th Edn., Mosby Inc., USA. Gerhard, P., R.G. Murray, R.N. Costilow, E.W. Nester, W.A. Wood, N.R. Krieg, G. Phillips, 1981. Manual of Method for Gene Ralbacteriology. American Society for Microbiology Washington DC. Hamilton, T.L., L. Marcus, D. Ray, S.B. Eric, C. Patricia, et al., 2011. Transcriptional profiling of nitrogen fixation in Azotobzctervinelandii. J. Bacteriol., 193(17): 4477-4486. Helmut, B.F., W. Widmer, V. Sigler and J. Zeyer, 2004. New molecular screening tools for analysis of freeliving diazotrophs in soil. Appl. Environ. Microbiol., 70: 240-247. Jayarao, B.M., J.R. Dore and S.P. Oliver, 1992. Restriction fragment length polymorphism analysis of 16s ribosomal DNA of Streptococcus and Enterococcus species of biovine origin. J. Clin. Microbiol., 30: 2235-2240. Jayashreet, V.S., A. Karthick and V. Kalaigandhi, 2007. Molecular study of Azotobacternif H Gene by PCR. J. Nen. Microbil., 152: 871-884. 576 Curr. Res. J. Biol. Sci., 4(5): 570-577, 2012 Jensen, H.L., 1954. Azotobacteriaceae. Bact. Rev., 18: 195-214. Knowles, R., 1982. Free Living Dinitrogen-Fixing Bacteria. In: Black, C.A. (Ed.), Methods of Soil Analysis ASA-SSA. Madison, USA, pp: 10071-11077. Kirshtein, J.D., H. Paerl and W.J. Zehr, 1991. Amplification, cloning and sequencing of a nif H segment from aquatic microorganisms and natural communities. Appl. Environ. Microbiol., 57: 2645-2650. Mary Ann, M.E. and A.R. Virginia, 2007. Genomes of Sea Microbes. Oceanogr, 20: 47-55. Mrakovacki, N. and V. Milic, 2001. Use of Azotobacterchroococcum as potentially useful in agricultural application. Ann. Microbiol., 51: 145-158. Norris, J.R. and M. Chapman, 1968. Classification of Azotobacter. In: Gibbs, B.M. and D.A. Shaapton (Eds.), Identification Methods for Microbiologists. Part B Academic Press, London, New York. Parson, H.G., 2003. Further researches on Azotobacter. Can. J. Microbiol., 71: 22-29. Rajeswari, K. and M. Kasthuri, 2009. Molecular characterization of Azotobacterspp.nif H gene isolated from marine source. Aferi. J. Biotechnol., 8(24): 6850-6855. Rubio, L.M. and P.W. Ludden, 2008. Biosynthesis of the iron-molybdenum cofactor of nitrogenase. Annu. Rev. Microbiol., 62: 93-111. Setubal, J.C., P.D. Santos, B.S. Goldman, H. Ertesvåg, G. Espin, et al., 2009. Genome sequence of Azotobactervinelandii, an obligate aerobe specialized to support diverse anaerobic metabolic processes. J. Bacteriol., 191: 4534-4545. Tejera, N., C. Liuch, M.V. Martinz-Toledo and J. Gonzola-Lopez, 2005. Isolation and characterization of Azotobacter and Azospirilliumstrains from the sugarcane rhizosphere. Springer Plant Soil., 270: 223-232. Ueda, T., Y. Suga, N. Yahiro and T. Matsuguchi, 1995. Remarkable N2 fixing bacterial diversity detected in rice roots by molecular evolutionary analysis of nifHgene sequences. J. Bacteriol., 177: 1414-1417. Womble, D.D., 2000. GCG: The Wisconsin package of sequence analysis programs. Methods Mol. Biol., 132: 3-22. Zehr, J.P., B.D. Jenkins, S.M. Shortand and G.F. Steward, 2003. Nitrogenase gene diversity and microbial community structure: A crosssystem comparison. Environ. Microbiol., 5: 539-554. 577
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )