RESEARCH ARTICLE 1299
Development 133, 1299-1309 doi:10.1242/dev.02295
Essential and opposing roles of zebrafish ␤-catenins in the
formation of dorsal axial structures and neurectoderm
Gianfranco Bellipanni1,*, Máté Varga1,*, Shingo Maegawa1,*, Yoshiyuki Imai2, Christina Kelly1,
Andrea Pomrehn Myers2, Felicia Chu2, William S. Talbot2 and Eric S. Weinberg1,†
In Xenopus, Wnt signals and their transcriptional effector ␤-catenin are required for the development of dorsal axial structures. In
zebrafish, previous loss-of-function studies have not identified an essential role for ␤-catenin in dorsal axis formation, but the
maternal-effect mutation ichabod disrupts ␤-catenin accumulation in dorsal nuclei and leads to a reduction of dorsoanterior
derivatives. We have identified and characterized a second zebrafish ␤-catenin gene, ␤-catenin-2, located on a different linkage
group from the previously studied ␤-catenin-1, but situated close to the ichabod mutation on LG19. Although the ichabod mutation
does not functionally alter the ␤-catenin-2 reading frame, the level of maternal ␤-catenin-2, but not ␤-catenin-1, transcript is
substantially lower in ichabod, compared with wild-type, embryos. Reduction of ␤-catenin-2 function in wild-type embryos by
injection of morpholino antisense oligonucleotides (MOs) specific for this gene (MO2) results in the same ventralized phenotypes as
seen in ichabod embryos, and administration of MO2 to ichabod embryos increases the extent of ventralization. MOs directed
against ␤-catenin-1 (MO1), by contrast, had no ventralizing effect on wild-type embryos. ␤-catenin-2 is thus specifically required for
organizer formation and this function is apparently required maternally, because the ichabod mutation causes a reduction in
maternal transcription of the gene and a reduced level of ␤-catenin-2 protein in the early embryo. A redundant role of ␤-catenins in
suppressing formation of neurectoderm is revealed when both ␤-catenin genes are inhibited. Using a combination of MO1 and
MO2 in wild-type embryos, or by injecting solely MO1 in ichabod embryos, we obtain expression of a wide spectrum of neural
markers in apparently appropriate anteroposterior pattern. We propose that the early, dorsal-promoting function of ␤-catenin-2 is
essential to counteract a later, dorsal- and neurectoderm-repressing function that is shared by both ␤-catenin genes.
INTRODUCTION
Wnt signaling pathways are involved in both formation of the major
dorsal signaling centers in vertebrate embryos (i.e. Nieuwkoop center
and Spemann organizer and cognate structures) (Harland and
Gerhart, 1997; Sokol, 1999; Tao et al., 2005; Schier and Talbot, 2005)
and also, somewhat later in development, in the posteriorizing and
ventralizing signals that derive from more lateral and ventral
embryonic regions (Erter et al., 2001; Lekven et al., 2001). Indeed, a
GFP reporter assay for ␤-catenin-responsive gene activation in the
zebrafish reveals Wnt signaling activity in a localized, presumably
dorsal, domain at dome stage, and in both dorsal and ventrolateral
discrete domains at shield stage (Dorsky et al., 2002). These two
phases of Wnt signaling have been considered (e.g. Kim et al., 2002;
Momoi et al., 2003) as components of sequential activator and
transformer signals that fit Nieuwkoop’s two signal model of neural
induction and patterning (Nieuwkoop et al., 1952; Nieuwkoop and
Nitgevecht, 1954).
Wnt signaling mediated by the transcriptional effector ␤-catenin
plays an essential role in axis formation and neural induction. A
functional ␤-catenin gene is essential for formation of the
Nieuwkoop center and Spemann organizer in amphibians (Heasman
1
Department of Biology, University of Pennsylvania, Philadelphia, PA 19104, USA.
Department of Developmental Biology, Stanford University School of Medicine,
Stanford, CA 94305, USA.
2
*These authors contributed equally to this work
Author for correspondence (e-mail: eweinber@sas.upenn.edu)
†
Accepted 23 January 2006
et al., 1994; Wylie et al., 1996; Heasman, 2000) and for gastrulation
and normal axis formation in the mouse (Haegel et al., 1995;
Huelsken et al., 2000). Accumulation of nuclear ␤-catenin is first
observed on the dorsal side of pregastrula Xenopus (Schneider et al.,
1996; Larabell et al., 1997; Rowning et al., 1997) and zebrafish
(Schneider et al., 1996; Kelly et al., 2000; Dougan et al., 2003)
embryos, consistent with the key role of ␤-catenin in initiating the
activation of dorsalizing genes.
In zebrafish embryos bred from females homozygous for ichabod,
a spontaneous maternal effect mutation resulting in severe
ventralization, ␤-catenin fails to localize to dorsal yolk syncytial layer
(YSL) and blastomere nuclei (Kelly et al., 2000). RNA injection
experiments showed that Wnt pathway components upstream of ␤catenin failed to rescue these embryos, but RNAs for ␤-catenin and
for the downstream nodal-related factor Squint (Znr2/Ndr1) and
homeodomain factor Bozozok (Dharma/Nieuwkoid) can rescue the
embryos to wild-type phenotype (Kelly et al., 2000). These results
indicated that failure to regulate ␤-catenin properly in the zebrafish
embryo results in loss of dorsal axial structures.
The Wnt pathway also promotes posterior and ventral fates and
inhibits formation of anterior neural tissue. wnt8, expressed in the
ventrolateral germ ring (Kelly et al., 1995b), is required for
formation of ventrolateral and posterior mesoderm and spinal cord
and posterior brain (Lekven et al., 2001; Erter et al., 2001; Momoi
et al., 2003; Ramel and Lekven, 2004). Similarly, Xenopus wnt8 is
expressed in the ventrolateral marginal zone (and in a wider vegetal
region) (Christian et al., 1991; Smith and Harland, 1991; Christian
and Moon, 1993) and may have a similar posteriorizing role
(Christian and Moon, 1993; Hoppler et al., 1996; Fredieu et al.,
DEVELOPMENT
KEY WORDS: ␤-Catenin, Axis formation, Neural induction, Dorsoventral patterning, Anteroposterior patterning, Organizer, Zebrafish,
ctnnb1, ctnnb2
1300 RESEARCH ARTICLE
MATERIALS AND METHODS
Fish husbandry
Embryos of the brass strain of zebrafish (originally obtained from EkkWill
Waterlife Resources, Gibbonston, FL), selected as ‘wild-type’ embryos
because their delayed onset of pigmentation is advantageous for
hybridization, were raised under standard conditions at 28.5°C (Westerfield,
1993). ichabod p1 embryos were obtained by breeding homozygous ichabod
females with brass males. Only ichabod females that reproducibly gave
severely ventralized phenotypes were used in this work. Throughout this
report, we will use the expression ‘ichabod embryos’ to mean those embryos
derived from homozygous ichabod mothers.
DNA constructs and phylogenetic analysis
Sequence searches of the zebrafish EST database identified ESTs that
defined fragments of a second ␤-catenin gene in zebrafish, which we term
␤-catenin-2. Sequences from these ESTs were used to identify a PCR-based
polymorphism (primers: 5⬘-CCTACCTGGATTCAGGGATTC-3⬘ and 5⬘ATGAGCAGAGTCGAACTGGGT-3⬘) for genetic mapping and to obtain a
full-length cDNA clone by screening an embryonic cDNA library. The
sequence of the ␤-catenin-2 cDNA has been deposited in GenBank
(Accession Number AF329680). ␤-catenin-2 was mapped to the telomeric
region of LG 19 by scoring the polymorphism in the Heat Shock mapping
panel (Woods et al., 2000; Woods et al., 2005).
The following clones were used to prepare antisense probes for
hybridization and/or sense RNAs for embryo injection: ␤-catenin-1 (Kelly
et al., 1995a), ␤-catenin-2, krox20 (Oxtoby and Jowett, 1993), emx1
(Morita et al., 1995), hoxb6b (previously named hoxa7) (Prince et al.,
1998), islet-1 (Inoue et al., 1994), myoD (Weinberg et al., 1996),
bozozok/nieuwkoid/dharma (Koos and Ho, 1998), squint/znr2/ndr1 (Erter
et al., 1998; Rebagliati et al., 1998), chordin (Miller-Bertoglio et al., 1997)
and goosecoid (Stachel et al., 1993). ␤-catenin-2* RNA contained
nucleotides –100 to +15 of ␤-catenin-1 (Accession Number NM_131059)
substituted for –167 to +3 of ␤-catenin-2 (Accession Number AF329680)
and ␤-catenin-1* RNA contained nucleotides –120 to +3 of ␤-catenin-2
substituted for –195 to +3 of ␤-catenin-1, where +1 is the A of the
initiating ATG codon. The coding sequence of ␤-catenin-1* was identical
to ␤-catenin-1, but the coding sequence of ␤-catenin-2* contained an
additional four amino acids after the initiating methionine.
For phylogenetic analysis, translated cDNA sequences were aligned using
MUSCLE (Edgar, 2004) and based on this alignment, a maximum
parsimony tree of nucleic acid coding sequence was performed using the
protpars program from the PHYLIP package (Felsenstein, 1989). For this
analysis, 1000 bootstrap replicates were performed. Accession Numbers for
the ␤-catenin genes of rat, human, chicken, Pelodiscus sinensis (a turtle),
Xenopus laevis, goldfish and Ciona intestinalis are, respectively,
NM_053357, NM_001904, NM_205081, AB124575, BC082826,
AY336093 and AB031543. Sequences of the two ␤-catenin genes of
Tetraodon and Takifugu were obtained from the data bases of the Tetraodon
(http://www.genoscope.cns.fr/externe/English/Projets/Projet_C/C.html) and
Takifugu (http://fugu.hgmp.mrc.ac.uk/) genome projects.
RNA probe synthesis, hybridization, mRNA synthesis and injection
Antisense RNA probes were synthesized and hybridization procedures were
performed as previously described (Kelly et al., 2000) except that BM purple
alkaline phosphatase substrate (Roche) was used as chromogen. Capped
mRNAs were synthesized using the appropriate mMessage mMachine Kit
(Ambion), following the manufacturer’s protocol. RNAs were stored in
distilled sterile H2O at –80°C, and injection solutions were prepared by
adjusting the RNA concentration to twice that desired and then adding an
equal volume of Dulbecco’s modified phosphate-buffered saline containing
0.5% Phenol Red (Sigma). Approximately 1 nl of RNA solution was
injected through the intact chorion into the yolk at the base of the
blastomeres of one- to four-cell stage embryos, using an agar mold to hold
the embryos.
Morpholino antisense oligonucleotide injections
The following custom-designed morpholino antisense oligonucleotides were
obtained from Gene Tools (Philomath, OR): ␤-catenin-1 MO1, CTGGGTAGCCATGATTTTCTCACAG; ␤-catenin-1 MO1mis, CTcGGaAGCCATcATTTTCaCAgAG; ␤-catenin-1 MO1-2, CTGTGTCAAAAGCTGTATATTCCTG; ␤-catenin-1 MO1-3, CAGCACGTAAAACGCGAATAATGGC; ␤-catenin-2 MO2, CCTTTAGCCTGAGCGACTTCCAAAC; ␤catenin-2 MO2mis, CgTTTaGCCTcAGCGACTTgCAtAC; and ␤-catenin-2
MO2-2, GTGTCTTGTAAGCAGTGAATCCACC. The morpholino
oligonucleotides were diluted and injected as described above for the RNAs.
RT-PCR
Total RNA was isolated from 20 whole embryos using TRIzol reagent
(Invitrogen). Oligo-dT-primed cDNA was synthesized and RT-PCR
reactions were performed using SuperScript First-Strand Synthesis System
for RT-PCR (Invitrogen) from 14 ␮g of total RNA, following the
manufacturer’s protocol. Separate reactions were set up with primer pairs
derived from ␤-catenin-1, ␤-catenin-2 and ef1␣ using 25 cycles at an
annealing temperature of 55°C (in the semi-quantitative range). The
following primers were used for the amplifications: ␤-catenin-1, 5⬘-CGCACACATTCACTCTCAGC-3⬘ and 5⬘-TGGGTAGCCATGATTTTCTCA3⬘; ␤-catenin-2, 5⬘-ACGCTCAGGATCTGATGGAC-3⬘ and 5⬘-AGGCACTTTCTGAACCTCCA-3⬘; ef1␣, 5⬘-ACCGGCCATCTGATCTACAA-3⬘
and 5⬘-CAATGGTGATACCACGCTCA-3⬘.
RESULTS
Identification of a second zebrafish ␤-catenin
gene
Sequence searches identified zebrafish ESTs (e.g. AI657717) that
represented fragments of a second ␤-catenin gene in the zebrafish
genome, which we term ␤-catenin-2. A full-length cDNA clone
(GenBank Accession Number AF329680) was isolated by screening
a zebrafish embryo cDNA library with probes derived from these EST
sequences. The ␤-catenin-2 open reading frame (ORF) is predicted to
encode a protein of 778 amino acids. The nucleotide sequence of the
protein coding region is 82% identical to the previously characterized
zebrafish ␤-catenin gene (Kelly et al., 1995a), hereafter named ␤catenin-1. No significant homology was found in the 5⬘ UTR and 3⬘
UTR when comparing the ␤-catenin-1 and ␤-catenin-2 cDNAs. The
␤-catenin 1 and 2 proteins are 92.9% identical and 96.4% similar.
DEVELOPMENT
1997). Ventralizing and posteriorizing Wnt signals also appear to be
dependent on ␤-catenin (Dorsky et al., 2002; Weidinger et al., 2005)
and thus, may be impaired in embryos with ␤-catenin deficiencies.
We report here that the zebrafish genome contains a second
␤-catenin gene, ␤-catenin-2 (ctnnb2 – Zebrafish Information
Network). Considering that both the formation of the organizer and
the somewhat later posteriorizing and ventralizing effects of Wnt
signaling are both mediated by ␤-catenin, it was of interest to explore
the degree of redundancy of function of the two ␤-catenins in this
organism. Moreover, we report that ␤-catenin-2 maps close to the
ichabod mutation and that maternal expression of ␤-catenin-2 is
impaired in ichabod mutant embryos, and we provide evidence that
␤-catenin-2 is the sole ␤-catenin gene required for formation of the
dorsal organizer in the zebrafish. When only ␤-catenin-1 (ctnnb1 –
Zebrafish Information Network) function was inhibited, we observed
no early patterning defects, indicating that this factor was not solely
required for Wnt signaling activities that control the extent and nature
of posterior and ventral tissue formation. Inhibiting the expression of
both ␤-catenin genes, however, resulted in an unexpected phenotype
in which neurectoderm of both anterior and posterior identity develop
with at least some appropriate anteroposterior patterning. Thus, the
two ␤-catenin genes normally act with functional redundancy to
restrict formation of neurectoderm. In the absence of both ␤-catenin1 and ␤-catenin-2 function, the embryo fails to form a recognizable
organizer, but as a consequence of the loss of repressive effects on
neurectoderm formation, the embryo is still capable of expressing
both posterior and anterior neural makers.
Development 133 (7)
Most of the protein is highly conserved, with 96.1% identity from
amino acids 1-686. Only the C-terminal 92 amino acids (#687-778),
comprising part of the C-terminal activation domain, showed marked
divergence, and even here the sequence identity was 70.2% (Fig. 1A).
Although these proteins are highly conserved, zebrafish ␤-catenin-2
is more diverged from zebrafish ␤-catenin-1 than the latter is from any
of the tetrapod ␤-catenins. Maximum parsimony phylogenetic
analysis of nucleotide sequences shows that zebrafish ␤-catenin-1 is
part of a highly conserved branch that includes human, mouse,
Xenopus, goldfish and pufferfish ␤-catenins, with zebrafish ␤-catenin2 and a second ␤-catenin gene (not clearly orthologous) of pufferfish
(both Fugu and Tetraodon) branching off somewhat earlier (Fig. 1B).
All of these vertebrate ␤-catenins are more related to one another than
to ascidian, D. melanogaster or C. elegans ␤-catenins, or to vertebrate
plakoglobins (data not shown).
We mapped ␤-catenin-2 near the telomere of LG19 (this work)
(Woods et al., 2005), whereas ␤-catenin-1 had already been mapped
to LG16 (Postlethwait et al., 1998). Although the phenotype of the
ichabod mutation was consistent with a loss of function of a ␤catenin gene, we had ruled out the involvement of ␤-catenin-1, the
only known zebrafish ␤-catenin gene at the time of the initial
characterization of this mutant, because the mutation mapped to
LG19 (Kelly et al., 2000). The finding of a second ␤-catenin gene
on the same region as ichabod prompted us to re-examine whether
the ichabod phenotype was a consequence of a loss of function of ␤catenin-2.
The ichabod mutation maps near ␤-catenin-2 but
does not functionally change its ORF
Map crosses were set up between ichabod homozygous females and
brass males and the resulting fertilized eggs were injected with ␤catenin-2 RNA, which allowed rescue of these embryos to fertile
adult fish. These heterozygotes were mated with each other and the
F2 generation raised to adulthood. DNA was prepared from the adult
RESEARCH ARTICLE 1301
female ichabod homozygotes (identified from the ichabod
phenotype of their F3 offspring embryos), and tested for linkage of
simple sequence repeat markers by standard techniques (Talbot and
Schier, 1999). As shown in Fig. 2A, ichabod is located near the
telomere of LG19, 1.1 cM distal to a CA repeat marker (CA85.6-3,
a marker polymorphic for the map cross, found from genomic
sequence to be closely linked to the non-polymorphic z26695
marker), and close to the position of ␤-catenin-2, which had been
mapped to the same region in a separate map cross (Woods et al.,
2000; Woods et al., 2005). We found that six markers distal to
CA85.6-3, extending to a genetic distance of 10 cM from this
marker, failed to show any recombination with the ichabod locus.
One of these markers was a CA repeat marker (CA91.6-1) located
within the 3⬘ UTR of ␤-catenin-2. Because these results suggested
a suppression of recombination in the telomeric region of ichabod
LG19, we retested recombination frequencies of a number of
markers from this region in an independent map cross (Fig. 2B).
These markers were found to recombine with each other, as expected
from their previously reported map positions (Shimoda et al., 1999)
(http://zebrafish.mgh.harvard.edu/zebrafish/index.htm). Thus, it
appears that the ichabod chromosome contains a region of
suppressed recombination, perhaps owing to an inversion or other
chromosomal rearrangement, in proximity to both the ichabod locus
and the ␤-catenin-2 gene. It is interesting in this regard that the
cycb16 mutation, a deletion of the cyclops region near the telomere
of LG12, also suppresses recombination on that chromosome
(Talbot et al., 1998).
Sequence comparison of RT-PCR ␤-catenin-2 products from
wild-type and ichabod homozygous fish revealed one amino acid
change in the conceptually translated sequence. This change, a
valine to methionine at position 450, however, does not diminish the
ability of injected ␤-catenin-2 RNA to rescue the ventral phenotypes
of ichabod embryos, as efficient rescue was obtained in two separate
experiments.
Fig. 1. Comparison of sequence of zebrafish ␤-catenin-2 with other ␤-catenins. (A) ClustalW-generated sequence alignment of the least
conserved regions of Xenopus ␤-catenin (Accession Number AAA49670), goldfish ␤-catenin (AAP94282.1), zebrafish ␤-catenin-1 (AAC59732.1),
zebrafish ␤-catenin-2 (AAM53438.1), and computationally predicted ␤-catenin-1 and ␤-catenin-2 proteins from Fugu and Tetraodon (using
Ensembl genomic data sets). Of the 55 amino acid differences between the two zebrafish ␤-catenins, five changes are at positions 105-109 and 28
are in the N-terminal end of the protein (the same region that shows high levels of divergence in the predicted pufferfish ␤-catenin-2 proteins).
Based on sequences in these two regions, zebrafish ␤-catenin-1 clearly forms a closely related group with the Xenopus and goldfish ␤-catenins, and
with pufferfish ␤-catenin-1, whereas zebrafish and pufferfish ␤-catenin-2 are more distantly related. (B) Maximum parsimony analysis of vertebrate
and Ciona ␤-catenin cDNA nucleotide coding sequences. Numbers indicate the hits supporting the branching pattern from 1000 bootstraps.
DEVELOPMENT
Zebrafish ␤-catenins
Development 133 (7)
Fig. 2. ichabod maps near the ␤-catenin-2 locus in the telomeric
region of LG19. (A) Linkage map of the distal region of LG19 obtained
from a map cross of an ichabod female and brass male (see text for
description). Map positions (in cM) are obtained from the latest update
of the integrated map of the zebrafish genome (see Day et al. at
http://zfin.org). Two markers were tested for map position 91.5 cM
(z68894/z24777) and for map position 91.6 (z1799/CA91.6-1) and
single markers were tested at other map positions. Recombination
frequencies (recombinants/meiosis tested) between ichabod and each
of the markers are shown below the map. In addition to testing SSLP
markers from the MGH microsatellite map (‘Z’ markers), we tested two
additional markers: (1) CA85.6-3, a polymorphic CA-repeat marker
located 1.5 kb from the non-polymorphic marker, Z26695, previously
mapped to position 85.6 cM on LG19; and (2) CA(91.6)-1, a
polymorphic CA-repeat marker found within the 3⬘UTR of ␤-catenin-2
cDNA [an EST for ␤-catenin-2, fc16f05/mgc:65770 had previously been
mapped to 91.6 on the heat shock meiotic panel by Ian Woods and
William Talbot (unpublished)]. The closest marker showing
recombination with ichabod was CA(85.6)-3, located 1.1 cM away. No
recombinants were obtained between ichabod and z68894, z24777,
CA(91.6)-1, z1799, z25291 and z61401, even though these markers
were spread over a region extending almost 10 cM from CA(85.6)-3.
(B) Linkage map of SSLP markers determined from a completely
independent map cross (generated from a WIK ⫻
OregonAB/TübingenWT cross). To test if the map positions in the nonrecombinant region of the map cross shown in A were correct, we
determined recombination frequencies using markers that spanned this
region. As is indicated, in contrast to the ichabod map cross, we did
observe recombination in this region of LG19 (except between markers
z14236 and z25291).
Fig. 3. Maternal ␤-catenin-2 transcript is reduced in ichabod
embryos. (A) RT-PCR assay of RNA expression levels in wild-type and
ichabod embryos. For each stage shown, oligo dT-primed cDNA was
used as a template for three separate PCR amplifications using primers
for ␤-catenin-1, ␤-catenin-2 and ef1␣. Maternal ␤-catenin-2 transcript
was reduced in ichabod embryos, but reduction of maternal ␤-catenin1 transcript or zygotic transcripts of either gene was not observed. (BM) Whole-mount in situ hybridization showing ubiquitous expression of
both ␤-catenin genes and low expression of maternal ␤-catenin-2.
One-cell stage (top row: B,E,H,K), sphere stage (middle row: C,F,I,L) and
90% epiboly (bottom row: D,G,J,M) wild-type (B-D, H-J) and ichabod
(E-G, K-M) embryos were tested for expression of ␤-catenin-1 (B-G) and
␤-catenin-2 (H-M). Embryos in D,J are shown in lateral view with dorsal
towards the right.
Maternal expression of ␤-catenin-2, but not
␤-catenin-1, is decreased in ichabod embryos
The mapping data, and the possibility that the ichabod mutation
involves a chromosomal rearrangement near ␤-catenin-2, prompted
us to test whether ichabod embryos had decreased levels of ␤catenin-2 transcript. We examined this by RT-PCR and by
hybridization. Semi-quantitative RT-PCR (Fig. 3A) revealed no
differences in ␤-catenin-1 transcript levels between wild-type and
ichabod embryos at all stages examined, from the one-cell stage to
24 hpf. By contrast, ␤-catenin-2 transcript levels were markedly
reduced in ichabod embryos from the one-cell stage to 50% epiboly.
At bud stage, the level of ␤-catenin-2 RNA was only slightly lower
in mutant embryos and by 24 hpf, the levels of this transcript were
about the same in the two types of embryos. These results indicate
that ichabod embryos exhibit a specific deficit in maternal (but not
zygotic) expression of ␤-catenin-2.
In situ hybridization also revealed that ␤-catenin-2 mRNA is
reduced in ichabod mutant embryos at early stages (Fig. 3B-M). In
wild-type embryos, ␤-catenin-1 and ␤-catenin-2 transcripts were
observed at the one-cell stage (Fig. 3B,H) and ubiquitously at sphere
(Fig. 3C,I) and 90% epiboly stages (Fig. 3D,J). At the 90% epiboly
stage, there was somewhat more pronounced expression of both
genes in the dorsal midline. In ichabod embryos, there was little
difference in expression of ␤-catenin-1 at the two early stages (Fig.
3E,F), and at 90% epiboly, expression in the animal half of the
embryo was reduced and expression in the vegetal half of the
embryo was more intense (Fig. 3G). The results were very different
with ␤-catenin-2 expression at the one-cell and sphere stage
embryos (Fig. 3K,L), which revealed a very low expression of this
gene in ichabod embryos. By 90% epiboly (Fig. 3M), some ␤catenin-2 transcript can be detected, mainly in the vegetal half of the
embryo. These findings support the idea that ichabod embryos are
defective in maternal expression of ␤-catenin-2. Results from
microarray hybridization experiments also were consistent with
these findings. Using a Sigma-Compugen oligonucleotide
microarray and RNA targets prepared from wild-type or ichabod
embryos at 30% epiboly, we found that ␤-catenin-2 showed 3.7-fold
downregulation in the mutant embryos (W. Wang, S.M. and E.S.W.
DEVELOPMENT
1302 RESEARCH ARTICLE
unpublished). As will be described later, indirect assays using
western immunoblotting show that pre-gastrula ichabod embryos
are deficient in ␤-catenin-2, but not ␤-catenin-1, protein. Thus, four
lines of evidence all reveal a deficit in maternal expression of ␤catenin-2 in ichabod embryos, but indicate no downregulation of
zygotic expression of this gene or of maternal or zygotic expression
of ␤-catenin-1 in mutant embryos.
␤-Catenin-2, but not ␤-catenin-1, is required for
organizer formation
To determine if ␤-catenin-2 is essential for development of dorsal
axial structures, we injected morpholino antisense oligonucleotides
(MOs) into one- to two-cell stage wild-type embryos. Injection of
an MO directed against the translation initiation region of ␤-catenin2 (MO2) phenocopied ichabod (Fig. 4D-H), whereas an MO
directed against the translation initiation region of ␤-catenin-1
(MO1) had no ventralizing effect (Fig. 4A-C). After injection,
embryos were allowed to develop to 24 hpf and then scored for
degree of ventralization using a slight modification of previously
defined criteria (Kelly et al., 2000). C1-C4 embryos all lack
notochord and have increasing amounts of neural tube. C1 embryos
(e.g. Fig. 4F) lack an embryonic axis, have a protruding tail-like
structure, often with multiple tail fins, and a protruding mass of
necrotic cells on the opposite end of the embryo. C1a embryos have
spinal cord tissue, often reduced in length and girth, but do not form
more anterior neural structures. C2 embryos have spinal cord,
hindbrain and midbrain, but do not have forebrain or eyes (e.g. Fig.
4E). C3 embryos have defects in forebrain and/or eye development
but have an intact neural tube posterior to the forebrain. C4 embryos
have a normal appearing neural tube but lack notochord. C5 ichabod
embryos, which are very rare, appear to be normal at 24 hpf, but do
not survive. ichabod embryos are usually C1, C1a and C2, but as the
expressivity of the mutation is somewhat variable, some crosses also
yield substantial numbers of C3 embryos and, more rarely, C4 and
C5 embryos.
Wild-type embryos injected with MO2 show all of the ventralized
phenotypes found in progeny of female ichabod homozygotes (Fig.
4D-F,H). A second MO, MO2-2, designed against a non-
RESEARCH ARTICLE 1303
overlapping region of ␤-catenin-2, gave similar distributions of
ventralized embryos, when injected into wild-type embryos,
whereas a mismatched MO, MO-2mis, with five base pair
differences, had no effect (Fig. 4G). Injection of MO2 into ichabod
embryos resulted in a shift of distribution of phenotypes to the more
severely ventralized classes (Fig. 4I), suggesting that some ␤catenin-2 function remains in ichabod embryos and that this
function is further reduced by the MO. In contrast to the results
obtained with ␤-catenin-2 MOs, no ventralizing effect was seen in
embryos injected with MOs designed against ␤-catenin-1 (e.g. Fig.
4A-C), even at high concentrations that caused bent tails and head
necrosis (Fig. 4C). These phenotypes caused by high concentrations
of MO1 were not rescued by injection of ␤-catenin-1* mRNA (in
which the 5⬘-UTR of ␤-catenin-1 RNA was altered so that it was no
longer complementary to the sequence of MO1, see Materials and
methods), indicating that they were probably not due to specific
interactions of the MO with ␤-catenin-1 mRNA (data not shown).
Injection into wild-type embryos of one or another of two additional
non-overlapping MOs (MO1-2, MO1-3), designed against the 5⬘
UTR of ␤-catenin-1, also failed to yield ventralized phenotypes.
To test whether the MO effects observed at 24 hpf were a
consequence of the disruption of early signaling centers, we
examined expression of the early dorsal markers, bozozok (boz) and
squint (sqt), in wild-type embryos injected with specific and control
MOs (Fig. 5). Both of these markers are absent from dorsal
blastomeres of severely ventralized batches of ichabod embryos at
sphere stage (Kelly et al., 2000). Injection of MO2, but not MO1, is
effective in eliminating boz expression from wild-type sphere stage
embryos (Fig. 5B,C). MO2 also decreases sqt expression in these
embryos, although some transcript is still produced, but MO1 has no
effect on expression of this gene (Fig. 5F,G). Thus, reducing
expression of maternal ␤-catenin-2, but not ␤-catenin-1, in wildtype embryos eliminates or reduces the expression of very early
markers of the dorsal organizer. Although injection of MO2
ventralizes wild-type embryos, it does not result in the majority of
embryos showing the most severe phenotypes (Fig. 4H), and thus,
the failure to obtain complete inhibition of expression of early dorsal
markers (e.g. sqt) in MO2-injected embryos is not unexpected. boz,
Fig. 4. Injection of morpholino antisense
oligonucleotides (MOs) directed against the
translational initiation site of ␤-catenin-2 can
phenocopy the ichabod mutation, whereas MOs
against ␤-catenin-1 have no ventralizing effect.
(A-C) Effect of injection of MO1 into wild-type embryos.
Injection of 1 mM MO1 often results in a slight necrosis
in the head (B) and 3 mM MO1 causes more severe
necrosis and bent shortened tails (C), but in neither case
were the embryos ventralized. A wild-type embryo at
the same stage is shown for comparison (A).
(D-G) Effect of injection of MO2 into wild-type embryos.
Examples of Class 2 (E) and Class 1 (F) embryos
obtained by injecting wild-type embryos with 3 mM
MO2 are compared with a wild-type embryo (D) and an
embryo injected with 3 mM MO2mis (G). (H) The effects
of injection of 3 mM MO2 can be rescued by coinjection of ␤-catenin-2* RNA (␤-catenin-2 RNA with an
altered ribosome binding region that will not bind to
MO2). Injection of 3 mM MO2 alone yielded a
distribution of ventralized phenotypes (red bars). Injection of ␤-catenin-2* RNA alone had no ventralizing effect (compare green and yellow bars).
Co-injection of MO2 and the RNA yielded mostly wild-type-appearing embryos, with only a few embryos exhibiting weak ventralization (blue bars).
In this experiment, we classified non-ventralized embryos into two classes, wild-type and C5, with C5 embryos exhibiting kinky notochords.
(I) Injection of MO2 into ichabod embryos shifted the phenotypic distribution to more-severe ventralized classes.
DEVELOPMENT
Zebrafish ␤-catenins
Fig. 5. ␤-catenin-2, but not ␤-catenin-1, is required for normal
expression of the early dorsal markers bozozok and squint. Wildtype embryos were injected with 3 mM MO1 (B,E) or 3 mM MO2 (C,F)
and compared with uninjected embryos (A,D) for bozozok (A-C) and
squint (D-F) expression at 30% epiboly stage. bozozok expression is
inhibited by MO2 and squint expression is partially inhibited by MO2;
MO1 injection has no effect on expression of these two markers.
however, is extremely sensitive to levels of ␤-catenin-2 but is
completely insensitive to inhibition of ␤-catenin-1 expression. These
results strongly support a specific requirement for ␤-catenin-2 in the
early dorsal signaling center.
In addition to obtaining similar phenotypes with multiple MOs
and the use of mismatched MO controls, we performed a number of
additional tests to show that the MOs specifically act on their target
transcripts. MO1 and MO2 were each shown to specifically inhibit
the translation of their cognate lacZ fusion targets when the RNA
targets and MO were injected together into wild-type embryos (data
not shown). More importantly, we were able to rescue the
ventralizing effects of MO2 on wild-type embryos (Fig. 4H). For this
experiment, the 5⬘-UTR of ␤-catenin-2 RNA was altered so that it
was no longer complementary to the sequence of MO2 (see
Materials and methods). Injection of this RNA (␤-cat-2* RNA) into
ichabod embryos was effective in rescuing these embryos (data not
shown). When this RNA was co-injected with MO2 into wild-type
embryos, we observed effective rescue of the ventralized phenotype
obtained with MO2 alone in the very same batch of embryos (Fig.
4H). Injection of the ␤-cat-2* RNA, alone, did not alter the wildtype phenotype. Additional controls, to show that the MO1 and
MO2 that were used in these experiments were effective in
decreasing the level of expressed ␤-catenin proteins, will be
described in the next section along with results indicating that there
is a deficiency in the amount of ␤-catenin-2 protein in pre-gastrula
ichabod embryos.
Expression of the two ␤-catenin proteins in wildtype and ichabod embryos
The two ␤-catenin zebrafish proteins are of identical size and are
very highly conserved in sequence. Although it would be extremely
useful to obtain antibodies that could distinguish the two ␤-catenins,
we have thus far been unsuccessful in raising antibodies against the
specific C-terminal peptides. However, we were able to employ an
indirect immunological approach to identify the contribution of each
of the ␤-catenins to total cellular ␤-catenin protein in wild-type and
ichabod embryos. To achieve this, we used a pan-␤-catenin antibody
on western blots to compare levels of ␤-catenin in embryos injected
with specific MOs against each ␤-catenin transcript or with control
Development 133 (7)
mismatched MOs (see Fig. S1 in the supplementary material). By
comparing the effects of the MO treatment, it is possible to
determine the relative amounts of ␤-catenin derived from the two
types of ␤-catenin RNA. In wild-type and ichabod embryos at 100%
epiboly, MO2 or MO1 treatment each decreases the amount of ␤catenin and a combination of MO1 and MO2 reduces the level of ␤catenin even further. We conclude that at this developmental stage
when most of the ␤-catenin transcript is presumably zygotically
derived, the two ␤-catenins are expressed in both types of embryos.
At 30% epiboly, the MO treatments gave different results for wildtype and ichabod embryos. In wild-type embryos, the results of MO
treatment at 30% and 100% epiboly are essentially the same.
Treatment of ichabod embryos at 30% epiboly, however, shows that
MO2 has no effect on ␤-catenin protein levels, whereas MO1 greatly
reduced the protein and, importantly, no further reduction is
observed when the two MOs are injected together. We conclude that
ichabod embryos produce little or no ␤-catenin-2 protein from
maternal transcripts, although maternal expression of ␤-catenin-1 is
normal. These results reinforce the conclusion that the ichabod
mutation causes a specific downregulation of maternal expression
of ␤-catenin-2.
The two ␤-catenins function redundantly to
repress neurectoderm
To test if ␤-catenin-1 and ␤-catenin-2 might have overlapping
functions in early embryonic patterning, we analyzed the phenotype
of embryos in which expression of both ␤-catenin genes is inhibited.
We carried out these studies in two ways: first, by injecting MO1 into
ichabod embryos; and second, by injecting MO1 and MO2 into
wild-type embryos (Fig. 6). Both types of embryos exhibited a new
phenotype, which we termed ‘ciuffo’ (a tuft or quiff of hair, in
Italian) because of the appearance of a protrusion of the embryo
away from the yolk (Fig. 6B,D). Examination of expression of a
series of mesodermal and neurectodermal markers revealed that
instead of a ventralized phenotype that might have been expected if
both ␤-catenins functioned redundantly to promote dorsalization,
the ‘ciuffo’ embryos were dorsalized and expressed all
neurectodermal markers that were tested. To determine whether this
dorsalizing and neuralizing effect of injection of MO1 into ichabod
embryos was due to the specific inhibition of ␤-catenin-1 transcript,
we performed an RNA rescue experiment (Fig. 6E-H). Typical
severe ichabod embryos (Fig. 7E) were mostly converted into
‘ciuffo’ embryos by injection of MO1 (Fig. 6F), but reverted back to
C1, C1a and C2 ventralized embryos when MO1 and ␤-catenin-1*
RNA were co-injected (Fig. 6H). When just the RNA was injected,
full and partial rescue of the ichabod phenotype was obtained (Fig.
6G), a result expected from our finding that injection of all ␤-catenin
RNAs tested, including Xenopus ␤-catenin RNA (Kelly et al., 2000),
can induce organizer and rescue ichabod. The main conclusion of
this experiment, however, is that the ‘ciuffo’ phenotype can be
rescued, indicating that the phenotype is not a result of a non-specific
effect of MO1 on a non-␤-catenin transcript.
We tested for expression of emx1 (Fig. 6L-N), krox20 (Fig. 7I-K)
and hoxb6b (Fig. 6O-Q) to determine if ‘ciuffo’ embryos were able
to express a wide range of anterior and posterior neurectodermal
markers. Whereas emx1 and krox20 were not expressed in the severe
ichabod embryos used for these experiments (Fig. 6J,M), they are
expressed at localized regions of the protrusion in ‘ciuffo’ embryos
(Fig. 6K,N), which developed as a result of injection of MO1 into
ichabod embryos of the same breeding. Most ichabod embryos also
fail to express hoxb6b (Fig. 6P), although expression is observed by
hybridization in a small number of 24 hpf embryos (not illustrated)
DEVELOPMENT
1304 RESEARCH ARTICLE
Zebrafish ␤-catenins
RESEARCH ARTICLE 1305
Fig. 6. A new phenotype (‘ciuffo’)
results from loss of function of both
␤-catenin genes. (A-D) The ‘ciuffo’
phenotype is apparent in ichabod
embryos injected with 3 mM MO1 (B)
and wild-type embryos injected with 3
mM MO1 and 3 mM MO2 (D).
Uninjected ichabod (A) and wild-type (C)
embryos are shown for comparison.
(E-H) Co-injection of ␤-catenin-1* RNA
(␤-catenin-1 RNA with an altered
ribosome binding region that will not
bind to MO1) into ichabod embryos can
suppress the ‘ciuffo’ phenotype produced
by MO1 injection. In comparison with
uninjected ichabod embryos, which
develop to C1 phenotypes (E), injection of
1 mM MO1 transforms approximately
two-thirds of the embryos into ‘ciuffo’
phenotypes (F), injection of the RNA
alone causes rescue to wild-type and less
ventralized C2-C4 phenotypes (G), but
co-injection of both MO1 and RNA results
in embryos with the original severe C1
phenotype and with C1a phenotype (H).
Each of these panels shows a group of
representative embryos of one of four
repeats of this experiment, which all gave
consistent results. (I-Z) Hindbrain and
anterior neural markers and neuronal
markers are not expressed in ichabod
embryos (J,M,S) but are expressed in 3
mM MO1-injected ichabod (‘ciuffo’)
embryos (K,N,T). The posterior neural
marker hox6b6 is expressed in some
ichabod embryos (P) and in ‘ciuffo’
embryos (Q). Wild-type embryos are shown as positive controls (I,L,O,R). The following probes were used: krox20 (I-K), emx1 (L-N), hoxb6b (O-Q)
and islet1 (R-T). All three types of embryos express myoD (U-Z), although the expression is radialized in both ichabod (V) and ‘ciuffo’ (Z) embryos
compared with wild type (U). Embryos in A-H and L-N are at 24 hpf and those in I-K,O-V are at 22 hpf. For I-Z, probes are indicated in the lower left
corner and type of embryo in the lower right corner of each panel.
6Z). ntl, although expressed during gastrula stages in ichabod
embryos (Kelly et al., 2000) and ‘ciuffo’ embryos (data not shown)
as a pan-mesodermal marker, is not expressed in ‘ciuffo’ gastrulae
in any notochord-like structure or at post-gastrula stages. We also
found that ‘ciuffo’ embryos fail to express sonic hedgehog, another
notochord marker. Thus, loss of function of ␤-catenin-1 in embryos
already deficient in ␤-catenin-2 leads to a restoration of
neurectoderm, but not notochord. It is noteworthy that none of these
effects observed in ‘ciuffo’ embryos occurs merely by inhibiting
expression of ␤-catenin-1 in wild-type embryos, indicating a genetic
redundancy of the two ␤-catenins in repression of neurectoderm.
␤-Catenin-1 and ␤-catenin-2 function redundantly
to repress expression of chordin and goosecoid
To better understand how loss of function of both ␤-catenin genes
can give rise to a wide range of anterior and posterior neural
markers, we examined the expression in ‘ciuffo’ embryos of genes
normally expressed in dorsal regions at gastrula and pregastrula
stages (Fig. 7). At 30% epiboly, the prospective organizer
expresses high levels of boz, sqt, goosecoid (gsc) and chordin
(chd) (Fig. 5A,D; Fig. 7A,D,G,M), while ichabod embryos do not
express boz, gsc and chd, and express sqt circumferentially around
the germ ring without any sign of a dorsal expression domain (Fig.
7B,E,H,N) (Kelly et al., 2000). In ‘ciuffo’ embryos produced by
DEVELOPMENT
and confirmed by RT-PCR (data not shown). This low level of
expression is consistent with the finding that ichabod mutants do
express earlier posterior neurectodermal markers (Kudoh et al.,
2004). hoxb6b is expressed in all ‘ciuffo’ embryos (e.g. Fig. 6Q) and
RT-PCR indicates a much greater amount of this transcript is present
than in ichabod embryos. Thus, even for the most posterior marker
tested, the absence of expression of the two ␤-catenins resulted in an
increase in transcript levels. Interestingly, the more posterior the
marker, the further its expression site was from the yolk. This
pattern, as well as the double ring of krox20 expression (found in
some, but not all embryos stained for this marker), indicated that the
‘ciuffo’ protrusion had some degree of appropriate anteroposterior
patterning, although the morphology of the embryo was abnormal.
We also tested for expression of the neuronal markers, islet1 (Fig.
6R-T), tlxA (Andermann and Weinberg, 2001) (data not shown) and
HuC (data not shown). None of these genes was expressed in
severely mutant ichabod embryos (e.g. Fig. 6S), but each was
expressed in the ‘ciuffo’ embryos obtained after MO1 injection.
Thus, the neurectoderm that is formed by reducing expression of the
two ␤-catenins does generate neurons, although they are not
organized in a recognizably patterned way. We also assayed the
expression of a number of mesodermal markers. Notably, myoD,
which is expressed in concentric rings at the posterior end of ichabod
embryos (Fig. 6V), is also expressed in the ‘ciuffo’ protrusion (Fig.
1306 RESEARCH ARTICLE
Development 133 (7)
normally expressed only dorsally is observed only in the absence
of the two ␤-catenins. Interestingly, ectopic chd expression has
also been observed in embryos expressing a dominant-negative
form of Tcf3, which would be expected to inhibit the function of
both ␤-catenins (Pelegri and Maischein, 1998). The ectopic
expression of chd in the germ ring ventrolateral domain would be
expected to result in inhibition of BMP signaling, thus explaining
the precocious expression of neural markers in ‘ciuffo’ embryos.
MO1 treatment of ichabod embryos, there is no indication of
dorsal expression of any of these markers at 30% epiboly, with
results identical to ichabod embryos for boz, sqt and chd, and a
faint radial symmetric expression of gsc around the germ ring
(Fig. 7C,F,I,O). At 50% epiboly, this germ ring expression of gsc
becomes more intense and a similar expression of chd is now
observed (Fig. 7J,R). By this stage, for all three types of embryos,
boz expression disappeared and sqt expression was greatly
decreased (data not shown). We also tested for expression of fgf3
and fgf8, and their patterns of expression in the three types of
embryos were identical to sqt at these stages. We conclude that a
defined organizer does not form in ‘ciuffo’ embryos, as there is no
expression of boz and no dorsal expression of sqt, chd, fgf3 and
fgf8. Although radial germ ring expression was observed for sqt,
fgf3 and fgf8 in ‘ciuffo’ embryos, the pattern was unchanged
qualitatively and quantitatively from that of ichabod embryos.
The late onset of gsc and chd expression around the germ ring,
however, indicates that ␤-catenin-1 and ␤-catenin-2 normally
function redundantly to repress expression of these genes in this
domain. None of the genes tested was ectopically expressed when
wild-type embryos were treated with MO1 (data not shown).
Thus, the ventrolateral ectopic expression of a subset of genes
Maternal expression of ␤-catenin-2 is required for
organizer formation
The results presented here clearly show that both zebrafish ␤-catenin
genes are expressed maternally and zygotically in wild-type
embryos. Although mRNA from both genes is expressed
ubiquitously, we have uncovered a specific role of ␤-catenin-2 in
organizer formation and early dorsal signaling. Wild-type embryos
treated with MO2, or embryos bred from homozygous ichabod
mothers both show a decrease in ␤-catenin-2 transcripts and protein
(Fig. 3, Fig. 6), fail to express markers of the organizer and anterior
neurectoderm (Fig. 5, Fig. 7J,M), and exhibit similar ventralized
phenotypes (Fig. 6). MOs directed against ␤-catenin-1 have no
ventralizing effects on wild-type embryos and do not enhance the
ventralization of ichabod embryos.
The specific requirement for ␤-catenin-2 for organizer formation
was unexpected. Both ␤-catenin transcripts are expressed
ubiquitously at stages prior to and during organizer formation.
Moreover, our experiments revealed that both proteins were
expressed from maternal transcripts in wild-type embryos. However,
as we have not yet had success in raising antibodies that can
specifically recognize each of the two proteins, we were not able to
DEVELOPMENT
Fig. 7. ␤-Catenin-1 and ␤-catenin-2 function redundantly to
repress expression of chordin and goosecoid, but not bozozok or
squint. Wild-type (A,D,G,J,M,P), ichabod (B,E,H,K,N,Q) or MO1injected ichabod (C,F,I,L,O,R) embryos were assayed for expression of
boz (A-C), sqt (D-F), gsc (G-L) or chd (M-R) at 30% epiboly (A-I,M-O) or
50% epiboly (J-L,P-R). MO1-injected and non-injected ichabod embryos
of the same embryo clutch were compared for each marker. All
embryos are shown in animal pole views.
DISCUSSION
ichabod embryos lack maternal expression of ␤catenin-2
ichabod, a spontaneous maternal effect mutation affecting organizer
formation was found to disrupt Wnt pathway signaling and lead to
a failure to localize ␤-catenin in dorsal YSL and blastomere nuclei
(Kelly et al., 2000). Our more recent discovery of a second ␤-catenin
gene, ␤-catenin-2, led us to consider that the phenotypes of ichabod
mutant embryos were a result of failure of proper regulation of this
gene. ichabod was found to map close to the position of ␤-catenin2 in the telomeric region of LG19. Very suggestive of a chromosome
rearrangement in this region of the ichabod chromosome was the
failure to observe any recombination between markers extending
from LG19 map positions 91.5 to 95.4 cM. Still ongoing fluorescent
hybridization studies with interphase nuclei clearly show a different
order of markers in this region of the ichabod chromosome
compared with wild-type chromosomes (S.M., M. Nimmakayalu,
B. Emanuel and E.S.W., unpublished). RT-PCR and whole mount
hybridization experiments presented above show that ichabod
mutant embryos are defective in maternal, but not zygotic,
expression of ␤-catenin-2. Treatment of ichabod embryos with MO2
results in a shift of phenotypes to more severely ventralized classes
(Fig. 4I), suggesting that ichabod is a hypomorphic ␤-catenin-2
mutant, which is shifted towards a null phenotype by further
depletion of the protein product. Moreover, evidence from western
blots of MO2- and MO1-treated embryos also indicated that ␤catenin-2 (but not ␤-catenin-1) protein levels are low in pre-gastrula
ichabod embryos. As MO ␤-catenin-2 loss-of-function phenotypes
are clearly the same as the ventralized ichabod phenotypes, we
suggest that the ichabod mutation is a regulatory mutation affecting
the maternal expression of ␤-catenin-2.
determine whether both proteins are present in the dorsal region of
the embryo where ␤-catenin acts to establish DV asymmetry. At
least three formal possibilities exist to explain the requirement for
␤-catenin-2. First, the level of ␤-catenin-1 protein in dorsal
territories may not be sufficient to compensate functionally for the
loss of ␤-catenin-2. Second, the protein itself may be under posttranslational control resulting in rapid inactivation of ␤-catenin-1 on
the dorsal side of the embryo. Third, the ␤-catenin 1 and 2 proteins
might have different activities (e.g. different transactivation domains
or different requirements for co-factors), such that endogenous levels
of ␤-catenin-1 are not able to activate early dorsal gene expression
even though it can do so when overexpressed. A model in which ␤catenin-2 promotes organizer formation by sequestering
components that otherwise would facilitate degradation of ␤catenin-1 is unlikely because MO1 depletion of ␤-catenin-1 in wildtype embryos does not ventralize and, in ichabod embryos, fails to
increase the severity of ventralization. Most of the differences
between the two ␤-catenins are found in the C-terminal 92 amino
acids, corresponding to the major region of a transactivation domain
known to interact with CBP and p300 (Hecht et al., 2000; Takemaru
and Moon, 2000). This region also can interact with the armadillo
repeat region of the protein (Cox et al., 1999; Piedra et al., 2001) and
has been implicated in regulating selective binding to cadherin or
Tcf proteins (Gottardi and Gumbiner, 2004). However, to explain
the lack of sufficiency of ␤-catenin-1 for organizer formation, such
differences between the two ␤-catenins would also have to explain
why both ␤-catenins appear to be absent in dorsal nuclei of ichabod
embryos (Kelly et al., 2000).
We performed two types of experiments to judge if there were
indeed functional differences between the two ␤-catenins in the
context of organizer formation. First, we determined if expression
of either ␤-catenin from injected RNA was more efficient in
rescuing ichabod embryos. The results showed that the two ␤catenin RNAs were equally efficient in rescue, with a precipitous
decline in the ability to rescue when the concentration of injected
RNA for each of the two ␤-catenins was reduced from 10 ng/␮l to 5
ng/␮l. We also carried out an experiment in which tagged forms of
each ␤-catenin were expressed from RNAs co-injected into ichabod
embryos, and the subcellular and embryonic localization of the two
proteins were then determined at the 500-cell stage using antibodies
against the tagged epitopes (GFP-␤-catenin-1 and myc-␤-catenin2) (data not shown). Our initial results showed that ␤-catenin-2 had
a nuclear localization in a small group of marginal cells on one side
of the embryo. However, tagged ␤-catenin-1 protein was also found
in the very same nuclei, offering no support for a difference in
subcellular distribution between the two ␤-catenins as the basis for
the requirement for ␤-catenin-2 for organizer formation. As each of
the ␤-catenins is capable of localizing in blastoderm marginal nuclei,
it is not surprising that rescue of ichabod embryos is achieved by
injection of either ␤-catenin, but we still do not know the basis of the
specific requirement for endogenous ␤-catenin-2 for organizer
formation.
Zebrafish ␤-catenins redundantly inhibit
neurectoderm
In contrast to formation of the dorsal axial structures, loss of function
of one or the other of the two zebrafish ␤-catenins does not appear
to affect the role of the Wnt pathway in posteriorization and
ventralization of neurectoderm and mesoderm (Lekven et al., 2001;
Erter et al., 2001; Momoi et al., 2003; Ramel and Lekven, 2004). We
found that reduction of ␤-catenin-2 expression alone results in
ventralization, not dorsalization, and reduction of ␤-catenin-1
RESEARCH ARTICLE 1307
expression alone has no effect on dorsoventral or anteroposterior
patterning. However, when expression of both ␤-catenins is
inhibited, we found a robust formation of neurectodermal tissue in
comparison with wild-type embryos treated with MO2 or with
ichabod embryos, which only occasionally express posterior neural
markers in their tail-like appendage. Although the neurectoderm
formed when both ␤-catenins are inhibited is not organized into a
normal neural tube, a substantial amount of tissue expressing both
anterior and posterior neurectodermal markers is incorporated into
a large protrusion extending out from the yolk (e.g. Fig. 7K,N,Q).
The neurectoderm of these ‘ciuffo’ embryos is able to form neurons
(Fig. 7T) and appears to express neural markers in correct
anteroposterior order. In the absence of organizer and ␤-catenin-2
expression, ␤-catenin-1 expression alone is able to repress the
expression of all neural markers tested. When ␤-catenin-2
expression is unperturbed, inhibition of ␤-catenin-1 does not lead to
an expansion of neural tissue or patterning defects. Thus, only when
expression of both ␤-catenin genes is inhibited do we find a derepression of neural markers.
It is very likely that this activation of neural marker expression is
due to an impairment of Wnt pathway signaling normally involved
in posteriorization and ventralization. A posteriorizing activity of
zebrafish ventrolateral germring tissue has been demonstrated by
transplantation studies (Woo and Fraser, 1997), and wnt8, which is
expressed in this region of the embryo (Kelly et al., 1995b), is
required for formation of ventrolateral and posterior mesoderm and
spinal cord and posterior brain (Lekven et al., 2001; Erter et al.,
2001; Momoi et al., 2003; Ramel and Lekven, 2004). The
posteriorizing effect of zebrafish Wnt signaling, at least in part,
functions by negating the repression of posterior neural factors by
Tcf3a (Kim et al., 2000; Dorsky et al., 2003). Other important targets
of ventroposteriorizing Wnt signals include the vox/vent/ved, related
homeodomain transcriptional repressors that restrict dorsal gene
expression to the proper territories, and cdx4, which regulates the
action of posterior Hox genes (Kawahara et al., 2000a; Kawahara et
al., 2000b; Imai et al., 2001; Ramel and Lekven, 2004; Shimizu et
al., 2005).
In zebrafish embryos lacking expression of both ␤-catenins, we
hypothesize that the dorsolateral Wnt8 signals that normally
posteriorize the neurectoderm are not transduced. Indeed, we find
that ichabod embryos treated with MOs targeted against both
translated forms of wnt8 (Lekven et al., 2001) develop the ‘ciuffo’
phenotype and, moreover, such embryos, as well as wild-type
embryos injected with both MOs, express large amounts of
chordin transcript around the germ ring (M.V., S.M. and E.S.W.,
unpublished) (Ramel and Lekven, 2004). Our finding that MO1
treatment of ichabod embryos also results in germ ring chordin
expression (Fig. 7R) suggests that chordin repression by Wnt8
and vox/vent/ved is mediated by both ␤-catenin-1 and -2 (M.V.,
S.M. and E.S.W., unpublished). A true dorsal signaling center is
not established in these embryos as boz fails to be expressed, and
otherwise dorsal markers are expressed later than they normally
would be, consistent with a response to the later Wnt8 signaling.
Although some ichabod embryos express hoxb6b in their tail
extension [an observation consistent with expression of earlier
posterior neural markers in ichabod embryos (Kudoh et al.,
2004)], the amount of transcript of this factor is also markedly
increased in MO1-treated ichabod embryos. Thus, not only do the
two ␤-catenins act to posteriorize and ventralize the embryo, but
they also act to repress formation of neurectoderm. In a normal
embryo, such repression may act to restrict the amount of
organizer-induced neurectoderm formation.
DEVELOPMENT
Zebrafish ␤-catenins
Neurectoderm patterning in the absence of an
organizer
The studies presented above add to an array of evidence indicating
that AP patterning of the neurectoderm can occur in embryos
lacking organizer tissue. Ectoderm of embryos lacking expression
of both ␤-catenins forms neurectoderm that expresses posterior,
hindbrain and forebrain markers in apparently correct AP order.
Wnt/␤-catenin signaling is thus not required in the early embryo for
either neural induction or for at least some degree of proper AP
patterning. A similar conclusion has recently been reached by
simultaneous elimination of the Spemann organizer and BMP
signaling in Xenopus (Reversade et al., 2005). In this case, BMP
signaling was eliminated by MO treatment against three different
BMP ligands. In the zebrafish, as shown above, the depletion of the
two ␤-catenins results in ectopic expression of chordin, which would
in effect reduce or eliminate BMP signaling in the absence of
organizer. A significant difference between the two organisms is that
elimination of the single ␤-catenin in Xenopus does not result in
chordin expression (Reversade et al., 2005), and totally eliminates
neural induction (Heasman et al., 1994; Heasman et al., 2000),
whereas in zebrafish both ␤-catenins appear to be required to prevent
chordin expression in ventrolateral regions of the germ ring. In both
organisms, however, it is now clear that extensive neurectoderm can
be formed with a degree of proper AP pattern in the absence of ␤catenin and organizer. Further study of this condition may provide
insight into factors that could underlie the anteroposterior pattern of
the neurectoderm in the absence of both Wnt/␤-catenin and BMP
signaling.
We thank Joshua Bradner, Jiangyan He, Richard Gill, Jr and Carol Hu for fish
care and general laboratory assistance. We gratefully acknowledge Lucía
Peixoto for help with the phylogenetic analysis. This work was supported by
NIH grants HD39272 (to E.S.W.) and RR12349 (to W.S.T.).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/7/1299/DC1
References
Andermann, P. and Weinberg, E. S. (2001). Expression of zTlxA, a Hox-11-like
gene, in early differentiating neurons and cranial sensory ganglia of the
zebrafish embryo. Dev. Dyn. 222, 595-610.
Christian, J. L. and Moon, R. T. (1993). Interactions between Xwnt-8 and
Spemann organizer signaling pathways generate dorsoventral pattern in the
embryonic mesoderm of Xenopus. Genes Dev. 7, 13-28.
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R. T. (1991).
Xwnt-8, a Xenopus Wnt-1/int-1-related gene responsive to mesoderm-inducing
growth factors, may play a role in ventral mesodermal patterning during
embryogenesis. Development 111, 1045-1055.
Cox, R. T., Pai, L.-M., Kirkpatrick, C., Stein, J. and Peifer, M. (1999). Roles of
the C-terminus of armadillo in wingless signaling in Drosophila. Genetics 153,
319-332.
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T. (2002). A transgenic Lef1/␤catenin-dependent reporter is expressed in spatially restricted domains
throughout zebrafish development. Dev. Biol. 241, 229-237.
Dorsky, R. I., Itoh, M., Moon, R. T. and Chitnis, A. (2003). Two tcf3 genes
cooperate to pattern the zebrafish brain. Development 130, 1937-1947.
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and Talbot, W. S.
(2003). The role of the zebrafish nodal-related genes squint and cyclops in
patterning of mesendoderm. Development 130, 1837-1851.
Edgar, R. C. (2004). MUSCLE: a multiple sequence alignment method with
reduced time and space complexity. BMC Bioinformatics 5, 1-19.
Erter, C. E., Solnica-Krezel, L. and Wright, C. V. E. (1998). The zebrafish nodalrelated 2 encodes and early mesendodermal inducer signaling from the
extraembryonic yolk syncytial layer. Dev. Biol. 204, 361-372.
Erter, C. E., Wilm, T. P., Basler, N., Wright, C. V. E. and Solnica-Krezel, L.
(2001). Wnt8 is required in lateral mesendodermal precursors for neural
posteriorization in vivo. Development 128, 3571-3583.
Felsenstein, J. (1989). PHYLIP–Phylogeny Inference Package (Version 3.2).
Cladistics 5, 164-166.
Fridieu, J. R., Cui, Y., Maier, D., Danilchik, M. V. and Christian, J. L. (1997).
Development 133 (7)
Xwnt-8 and lithium can act upon either dorsal mesodermal or neuroectodermal
cells to cause a loss of forebrain in Xenopus embryos. Dev. Biol. 186, 100-114.
Gottardi, C. J. and Gumbiner, B. M. (2004). Distinct molecular forms of ␤-catenin
are targeted to adhesive or transcriptional complexes. J. Cell Biol. 167, 339-349.
Haelgel, H., Larue, L., Ohsugi, M., Federov, L., Herrenknecht, K. and Kemler,
R. (1995). Lack of beta-catenin affects mouse development at gastrulation.
Development 121, 3529-3537.
Harland, R. and Gerhart, J. (1997). Formation and function of Spemann’s
organizer. Annu. Rev. Cell Dev. Biol. 13, 611-667.
Heasman, J., Crawford, A., Goldstone, K., Garner-Harnick, P., Gumbiner, B.,
McCrea, P., Kintner, C., Noro, C. Y. and Wylie, C. (1994). Overexpression of
cadherins and underexpression of bet-catenin inhibit dorsal mesoderm induction
in early Xenopus embryos. Cell 79, 791-803.
Heasman, J., Kofron, M. and Wylie, C. (2000). ␤-catenin signaling activity
dissected in the early Xenopus embryo: a novel antisense approach. Dev. Biol.
222, 124-134.
Hecht, A., Vleminckx, K., Stemmler, M. P., van Roy, F. and Kemler, R. (2000).
The p300/CBP acetyltransferases function as transcriptional coactivators of ␤catenin in vertebrates. EMBO J. 19, 1839-1850.
Hoppler, S., Brown, J. D. and Moon, R. T. (1996). Expressiion of a dominantnegative Wnt blocks induction of MyoD in Xenopus embryos. Genes Dev. 10,
2805-2817.
Huelsken, J., Vogel, R., Brinkmann, V., Eerdman, B., Birchmeier, C. and
Birchmeier, W. (2000). Requirement for ␤-catenin in anterior-posterior axis
formation in mice. J. Cell Biol. 148, 567-578.
Imai, Y., Gates, M. A., Melby, A. E., Kimelman, D., Schier, A. F. and Talbot, W.
S. (2001). The homeobox genes vox and vent are redundant repressors of dorsal
fates in zebrafish. Development 128, 2407-2420.
Inoue, A., Takahashi, M., Hatta, K., Hotta, Y. and Okamoto, H. (1994).
Developmental regulation of islet-1 mRNA expression during neuronal
differentiation in embryonic zebrafish. Dev. Dyn. 199, 1-11.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B. (2000a).
Antagonistic role of vega1 and bozozok/dharma homeobox genes in organizer
formation. Proc. Natl. Acad. Sci. USA 97, 12121-12126.
Kawahara, A., Wilm, T., Solnica-Krezel, L. and Dawid, I. B. (2000b). Functional
interaction of vega2 and goosecoid homeobox genes in zebrafish. Genesis 28,
58-67.
Kelly, C., Chin, A. J., Leatherman, J. L., Kozlowski, D. J. and Weinberg, E. S.
(2000). Maternally controlled ␤-catenin-mediated signaling is required for
organizer formation in the zebrafish. Development 127, 3899-3911.
Kelly, G. M., Erezyilmaz, D. F. and Moon, R. T. (1995a). Induction of a
secondary embryonic axis in zebrafish occurs following the overexpression of
␤-catenin. Mech. Dev. 53, 261-273.
Kelly, G. M., Greenstein, P., Erezyilmaz, D. F. and Moon, R. T. (1995b).
Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct
developmental pathways. Development 121, 1787-1799.
Kim, C.-H., Oda, T., Itoh, M., Jiang, D., Artinger, K. B., Chandrasekharappa,
S. C., Driever, W. and Chitins, A. B. (2000). Repressor activity of Headless/Tcf3
is essential for vertebrate head formation. Nature 407, 913-916.
Kim, S.-H., Shin, J., Park, H.-C., Yeo, S.-Y., Hong, S.-K., Han, S., Rhee, M.,
Kim, C.-H., Chitnis, A. B. and Huh, T.-L. (2002). Specification of an anterior
neuroectoderm patterning by Frizzled8a-mediated Wnt8b signaling during late
gastrulation in zebrafish. Development 129, 4443-4455.
Koos, D. S. and Ho, R. K. (1998). The nieuwkoid/dharma homeobox gene is
essential for bmp2b repression in the zebrafish pregastrula. Dev. Biol. 215, 190207.
Kudoh, T., Concha, M. L., Houart, C., Dawid, I. B. and Wilson, S. W. (2004).
Combinatorial Fgf and Bmp signaling patterns the gastrula ectoderm into
prospective neural and epidermal domains. Development 131, 3581-3592.
Larabell, C. A., Torres, M., Rowning, R. A., Yost, C., Miller, J. R., Wu, M.,
Kimelman, D. and Moon, R. T. (1997). Establishment of the dorsoventral axis
in Xenopus embryos is presaged by early asymmetries in beta-catenin that are
modulated by the Wnt signaling pathway. J. Cell Biol. 136, 1123-1136.
Lekven, A. C., Thorpe, C. J., Waxman, J. S. and Moon, R. T. (2001). Zebrafish
wnt8 encodes two Wnt8 proteins on a bicistronic transcript and is required for
mesoderm and neurectoderm patterning. Dev. Cell 1, 103-114.
Miller-Bertoglio, V. E., Fisher, S., Sanchez, A., Mullins, M. C. and Halpern, M.
E. (1997). Differential regulation of chordin expression domains in mutant
zebrafish. Dev. Biol. 192, 537-550.
Momoi, A., Yoda, H., Steinbesser, H., Fagotto, F., Kondoh, H., Kudo, A.,
Driever, W. and Furatani-Seiki, M. (2003). Analysis of Wnt8 for neural
posteriorizing Frizzled 8c and Frizzled 9 as functional factor by identifying
receptors for Wnt8. Mech. Dev. 120, 477-489.
Morita, T., Nitta. H., Kiyama, Y., Mori, H. and Mishina, M. (1995). Differential
expression of 2 zebrafish Emx homoprotein messenger-RNAs in the developing
brain. Neurosci. Lett. 198, 131-134.
Nieuwkoop, P. D. and Nigtevecht, G. V. (1954). Neural activation and
transformation in explants of competent ectoderm under the influence of
fragments of aanterior notochord in urodeles. J. Embryol. Exp. Morphol. 2, 175193.
DEVELOPMENT
1308 RESEARCH ARTICLE
Nieuwkoop, P. D., Botterenbrod, E. C., Kremer, A., Bloesma, F. F. S. N.,
Hoessels, E. L. M. J., Meyer, G. and Verheyen, F. J. (1952). Activation and
organization of the central nervous system in amphibians. J. Exp. Zool. 120, 1-108.
Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish Krox-20 gene (krx-20)
and its expression during hindbrain development. Nucleic Acids Res. 21, 10871095.
Pelegri, F. and Maischen, H.-M. (1998). Function of zebrafish ␤-catenin and TCF3 in dorsoventral patterning. Mech. Dev. 77, 63-74.
Piedra, J., Martínez, D., Castaño, J., Miravet, S., Duñach, M. and de
Herreros, A. G. (2001). Regulation of ␤-catenin structure and activity by
tyrosine phosphorylation. J. Biol. Chem. 276, 20436-20443.
Postlethwait, J. H., Yan, Y. L., Gates, M. A., Horne, S., Amores, A., Brownlie,
A., Donovan, A., Egan, E. S., Force, A., Gong, Z. Y. et al. (1998). Vertebrate
genome evolution and the zebrafish gene map. Nat. Genet. 18, 345-349.
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K. (1998). Zebrafish hox genes:
genomic organization and modified collinear expression patterns in the trunk.
Development 125, 407-420.
Ramel, M. C. and Lekven, A. C. (2004). Repression of the vertebrate organizer by
Wnt8 is mediated by Vent and Vox. Development 131, 3991-4000.
Rebagliati, M. R., Toyama, R., Fricke, C., Haffter, P. and Dawid, I. B. (1998).
Zebrafish nodal-related genes are implicated in axial patterning and establishing
left-right asymmetry. Dev. Biol. 199, 261-272.
Reversade, B., Kuroda, H., Lee, H., Mays, A. and De Robertis, E. M. (2005).
Depletion of Bmp2, Bmp4, Bmp7 and Spemann organizer signals induces
massive brain formation in Xenopus embryos. Development 132, 3381-3392.
Rowning, B. A., Wells, J., Wu, M., Gerhart, J. C., Moon, R. T. and Larabell, C.
A. (1997). Microtubule-mediated transport of organelles and localization of
beta-catenin to the future dorsal side of Xenopus eggs. Proc. Natl. Acad. Sci.
USA 94, 1224-1229.
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in
zebrafish. Annu. Rev, Genet. 15, 561-613.
Schneider, S., Steinbesser, H., Warga, R. M. and Hausen, P. (1996). ␤-catenin
translocation into nuclei demarcates the dorsalizing centers in frog and fish
embryos. Mech. Dev. 57, 191-198.
Shimizu, T., Bae, Y. K., Muraoka, O. and Hibi, M. (2005). Interaction of Wnt
and caudal-related genes in zebrafish posterior body formation. Dev. Biol. 279,
125-141.
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S.,
Jackson, D., de Sauvage, F., Jacob, H. and Fishman, M. C. (1999). Zebrafish
genetic map with 2000 microsatellite markers. Genomics 58, 219-232.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in
RESEARCH ARTICLE 1309
Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,
753-765.
Sokol, S. Y. (1999). Wnt signaling and dorsoventral axis specification in
vertebrates. Curr. Opin. Genet. Develop. 9, 405-410.
Stachel, S. E., Grunwald, D. J. and Myers, P. Z. (1993). Lithium perturbation and
goosecoid expression identify a dorsal specification pathway in the pregastrula
zebrafish. Development 117, 1261-1274.
Takemaru, K.-I. and Moon, R. T. (2000). The transcriptional coactivator CBP
interacts with ␤-catenin to activate gene expression. J. Cell Biol. 149, 249-254.
Talbot, W. S., Egan, E. S., Gates, M. A., Walker, C., Ullmann, B., Neuhauss, S.
C. F., Kimmel, C. B. and Postlethwait, J. H. (1998). Genetic analysis of
chromosomal rearrangements in the cyclops region of the zebrafish genome.
Genetics 148, 373-380.
Talbot, W. S. and Schier, A. F. (1999). Positional cloning of mutated zebrafish
genes. Meth. Cell Biol. 60, 259-286.
Tao, Q. H., Yakota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D., Asashima, M.,
Wylie, C. C., Lin, X. H. and Heasman, J. (2005). Maternal Wnt11 activates the
canonical wnt signaling pathway required for axis formation in Xenopus
embryos. Cell 120, 857-871.
Weidinger, G., Thorpe, C. J., Wuennenberg-Stapleton, K., Ngai, J. and
Moon, R. T. (2005). The Sp1-related transcription factors sp5 and sp5-like act
downstream of Wnt/␤-catenin signaling in mesoderm and neuroectoderm
patterning. Curr. Biol. 15, 489-500.
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A., Murakami, T.,
Andermann, P., Doerre, O. G., Grunwald, D. J. and Riggleman, B. (1996).
Developmental regulation of zebrafish MyoD in wild-type, no tail and spadetail
embryos. Development 122, 271-280.
Westerfield, M. (1993). The Zebrafish Book: A Guide for the Laboratory Use of
Zebrafish (Brachydanio rerio). Eugene, OR: University of Oregon Press.
Woo, K. and Fraser, S. E. (1997). Specification of the zebrafish nervous system by
nonaxial signals. Science 277, 254-257.
Woods, I. G., Kelly, P. D., Chu, F., Ngo Hazelett, P., Yan, Y.-L., Huang, H.,
Postlethwait, J. H. and Talbot, W. S. (2000). A comparative map of the
zebrafish genome. Genome Res. 10, 1903-1914.
Woods, I. G., Wilson, C., Friedlander, B., Chang, P., Reyes, D. K., Nix, R.,
Kelly, P. D., Chu, F., Postlethwait, J. H. and Talbot, W. S. (2005). The
zebrafish gene map defines ancestral vertebrate chromosomes. Genome Res.
15, 1307-1314.
Wylie, C., Kofron, M., Payne, C., Anderson, R., Hosobuchi, M., Joseph, E.
and Heasman, J. (1996). Maternal beta-catenin establishes a ‘dorsal signal’ in
early Xenopus embryos. Development 122, 2987-2996.
DEVELOPMENT
Zebrafish ␤-catenins