Biochemical and Biophysical Research Communications 395 (2010) 496–501
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
Fab MAbs specific to HA of influenza virus with H5N1 neutralizing activity
selected from immunized chicken phage library
Pannamthip Pitaksajjakul a, Porntippa Lekcharoensuk b, Narin Upragarin b, Carlos F. Barbas III c,
Madiha Salah Ibrahim d, Kazuyoshi Ikuta e, Pongrama Ramasoota a,*
a
Center of Excellence for Antibody Research (CEAR), and Department of Social and Environmental Medicine, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand
Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand
Department of Molecular Biology and The Skaggs Institute for Chemical Biology, The Scripps Research Institute, USA
d
Department of Microbiology, Faculty of Veterinary Medicine, Alexandria University, Egypt
e
Department of Virology, Research Institute for Microbial Diseases, Osaka University, Japan
b
c
a r t i c l e
i n f o
Article history:
Received 6 April 2010
Available online 9 April 2010
Keywords:
H5N1 virus
Phage display technology
Monoclonal antibody production
a b s t r a c t
Hemagglutinin protein (HA) was considered to be the primary target for monoclonal antibody production.
This protein not only plays an important role in viral infections, but can also be used to differentiate H5N1
virus from other influenza A viruses. Hence, for diagnostic and therapeutic applications, it is important to
develop anti-HA monoclonal antibody (MAb) with high sensitivity, specificity, stability, and productivity.
Nine unique Fab MAbs were generated from chimeric chicken/human Fab phage display library constructed
from cDNA derived from chickens immunized with recombinant hemagglutinin protein constructed from
H5N1 avian influenza virus (A/Vietnam/1203/04). The obtained Fab MAbs showed several characteristics
for further optimization and development—three clones were highly specific to only H5N1 virus. This finding can be applied to the development of H5N1 diagnostic testing. Another clone showed neutralization
activity that inhibited H5N1 influenza virus infection in Madin–Darby canine kidney (MDCK) cells. In addition, one clone showed strong reactivity with several of the influenza A virus subtypes tested. The conversion of this clone to whole IgG is a promising study for a cross-neutralization activity test.
Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction
The highly pathogenic avian influenza virus (AIV) H5N1 strain
has emerged in poultry and wildlife worldwide. Since 1997, human
cases and deaths have been reported from several countries. This
increased concern about a potential influenza pandemic among
the world’s immunologically naïve population. For the management and control of this deadly disease, the development of
vaccines, antiviral drugs, and diagnostic test kits, is required.
The use of diagnostic tests for viruses screening is widely accepted, due to their rapid detection, applicability in the field, and
the need for less complex technical requirement [1]. Besides controlling avian influenza by rapid detection, treatment by therapeutic antibodies has been reported by many researchers [2–4].
For this reason, in the production of both antibody-based diagnostic tests and therapeutic antibodies, the key reagents are based
on specific monoclonal antibodies (MAbs). MAbs can classically be
produced using hybridoma technology, but this technology is
laborious and expensive. So, recently developed phage display
* Corresponding author. Address: 420/6 Ratchawithi Road, Ratchathewi, Bangkok
10400, Thailand. Fax: +66 662 643 5585.
E-mail address: tmprt@mahidol.ac.th (P. Ramasoota).
0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2010.04.040
technology, have become increasingly attractive to researchers
[5–8].
Regarding anti-influenza-virus antibody, among all other influenza virus proteins, hemagglutinin (HA) is of major interest, because it is responsible for two main functions in virus infection,
the attachment of the virus to the host cell receptor, and the mediation of the fusion of the virus envelope and endosomal membrane
after endocytosis. So, HA is widely targeted for the production of
neutralizing-antibody [9]. Moreover, this protein can also be used
to differentiate the dangerous H5N1 virus.
Some rapid tests have been developed for the detection of influenza-virus; however, most are based on the detection of nucleoprotein or matrix protein that is conserved among influenza A
viruses [10,11].
However, while some of anti-HA MAbs for both therapeutic and
diagnostic application have been developed [12–15], most have
been produced using hybridoma technology.
For this reason, in this study, we aimed to produce recombinant
Fab MAbs specific to the HA of H5N1 virus, using phage display
technology. This is the first report of the development of recombinant Fab MAbs specific to H5 hemagglutinin generated from
immunized chickens. This is an animal model of choice; its major
advantage is that only one primer combination of heavy and light
P. Pitaksajjakul et al. / Biochemical and Biophysical Research Communications 395 (2010) 496–501
chain can be used to elucidate all of the diverse immunoglobulin
repertoires [16].
2. Materials and methods
2.1. Ethics statement
All experiments with animals were approved by the Faculty of
Veterinary Science-Animal Care and Use Committee (FVS-ACUC),
Mahidol University (Approval No. 2008-30).
2.2. Chicken immunization and serum characterization
Two chickens were immunized with recombinant HA protein
(H5), developed from H5N1 avian influenza virus (A/Vietnam/
1203/04), (obtained from Dr. Ian A. Wilson, The Scripps Research
Institute, USA) [17], which was mixed with alpha-tocopherol (vitamin E)-based adjuvants. Chicken blood samples were drawn for
serum characterization every week by enzyme-linked immunosorbent assay (ELISA).
2.3. Generation of chimeric chicken/human Fab fragments
Total RNA was isolated from chicken spleens using TRIzol reagent (Invitrogen, USA). The first-strand cDNA was synthesized
using Superscript III First-strand cDNA synthesis system (Invitrogen, USA). The primers used in this study followed the procedure
described previously [18] to amplify Fab (VL–Cj—pelB leader sequence—VH–CH1) fragments.
2.4. Library construction
The procedures were followed the methods described by Andris-Widhopf et al. [18]. Briefly, both purified Fab fragments
(10 lg) and the pComb3XSS phagemid vector (20 lg) were digested with SfiI restriction endonuclease (40 U/ll, Roche Applied
Science, Germany). The digested Fab was ligated into digested
pComb3XSS vector (2:1 M ratio) using T4 DNA ligase enzyme
(Invitrogen, USA.) The DNA ligation was precipitated by ethanol/
NaoAc and glycogen, and incubated overnight at 70 °C, centrifuged and resuspended with nuclease-free water and transformed
to electrocompetent SS320 Escherichia coli cells. The library size
was estimated by plating 10, and 100 ll of 1:100 diluted library
culture onto LB/Carbenicillin plates. The library culture was further
amplified and propagated in a total volume of 200 ml SB medium,
and phage-Fab expression was induced by coinfection with
VCSM13 helper phage. Kanamycin was later added to the library
culture, and incubated with shaking overnight, at 37 °C. After spinning the bacterial cells, the phage-Fab-containing supernatant was
precipitated with 5 PEG/2.5 M NaCl. Ten microliters of phage library were re-amplified in E. coli ER2738 cells for optimal Fab display on phages.
497
E. coli ER2738 culture. The cells were incubated at room temperature for 15 min, after which the cultures were increased by adding
5 ml of pre-warmed SB medium. The input and output phages
were determined. The 8 ml of eluted phage culture was further
amplified with the culture volume at 100 ml with antibiotic and
helper phage, and precipitated as same as library amplification.
The precipitated phages were used in the next round of panning.
Four rounds of panning were performed.
2.6. Specificity test by Fab ELISA
The individual colonies were randomly selected from the 4thround output plate. The expression of Fab antibodies were induced
with 0.5 mM isopropyl-b-D-1-thiogalactopyranoside (IPTG), at
30 °C overnight, and Fab-containing supernatants were used for
an ELISA.
Fifty microliters, containing 100 ng of HA protein, and goat antihuman IgG F(ab0 )2 (Pierce, USA) (for Fab expression level control)
were coated overnight at 4 °C. After blocking, 100 ll of Fab-containing culture supernatant were added to the duplicate H5 coated
wells, expression level control well, and BSA negative control well.
After incubation, the plates were washed, and Fab binding was detected by adding 100 ll HRP-conjugated rat anti-HA antibody,
high-binding (Roche Applied Science, Germany) (1:2000). Peroxidase activity was developed with ABTS substrate buffer. The reaction was stopped with 1% SDS. The optical density (OD) of the
reactions was determined at 405 nm.
2.7. Sequence analysis
All positive clones tested by ELISA were analyzed for their Fab
sequences. The pComb3XSS phagemid was prepared from the original overnight culture of the selected positive clones. The variable
heavy and light chains were sequenced using primer VCH1 50
GGACTGTAGGACAGCCGGGAA 30 and CSCVK 50 GTGGCCCAGGCG
GCCCTGACTCAGCCGTCCTCGGTGTC 30 , respectively. The aminoacid sequences were translated, aligned, and compared with
chicken immunoglobulin sequences, using BlastP, ClustalW, and
Bioedit software.
2.8. Western blotting
Five hundred nanograms of purified HA protein, were mixed
with equal volumes of 2 sample buffer, with and without
b-mercaptoethanol, and heated at 95 °C, spun, and subjected to
sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–
PAGE) (12%). All of the separated proteins were transferred to polyvinylidene difluoride (PVDF) membrane (Amersham, Bioscience,
Sweden). The membranes were blocked and incubated with the
obtained specific Fab supernatants at 4 °C overnight. After that,
HRP-conjugated rat-anti-HA antibody was used to bind with the
HA tag of the Fab at room temperature, with rocking for 2 h. Then,
peroxidase-activity development was revealed using a DAB reagent set (KPL, USA).
2.5. Selection of phage display antibody library against hemagglutinin
protein
2.9. Production and purification of soluble Fab fragments
A freshly prepared phage library was used in the selection
against HA protein. Following the method described previously
[18]. Two-hundred and fifty nanograms of antigen was coated onto
a high-binding 96-well microtiter plate. Then, 100 ll of phage library was added. After 2 h incubation, the unbound phages were
washed off using 0.05% PBS–Tween. The bound phages were eluted
with 50 ll/well of freshly prepared 10 mg/ml trypsin, and then
incubated at 37 °C for 30 min. Eluted phages from the duplicate
wells were combined and added to 3 ml of fresh mid-log phase
The phagemid pCom3XSS of all unique Fabs were transformed
to TOP10F0 E. coli cells. In this host cell, the amber stop codon,
which was suppressed in ER2738 cells, was encoded, resulting
in the production of a soluble form of Fab fragment without fusion of the pIII phage coat protein. Ten milliliters of overnight
cultures of each clone were seeded into 1 l of SB medium, supplemented with 100 lg/ml ampicillin and 20 mM MgCl2. The cultures were grown until the optimal status for the E. coli cell was
reached (OD600 0.7–1). Then, the Fab expressions were induced
498
P. Pitaksajjakul et al. / Biochemical and Biophysical Research Communications 395 (2010) 496–501
with 0.5 mM IPTG at 30 °C for 12 h. After that, the induction cultures were centrifuged at 5000 rpm, for 40 min. Then, the bacterial pellet was resuspended in 40 ml of binding buffer (50 mM
NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0). The suspensions were sonicated on ice for 15 min. The cell debris was pelleted by centrifugation at 15,000 rpm for 40 min. The cell lysate
was passed through 0.2 lm filter. The protein was purified by
affinity chromatography column following the manufacturer procedures. The target proteins were eluted with elution buffer
(50 mM NaH2PO4, 300 mM NaCl, 200 mM imidazole). Purification
efficiency and antibody purity were monitored by running the
cell lysates, flow-through, wash, and elution fraction, on SDS–
PAGE. The purified protein was concentrated and dialysed against
PBS buffer. The concentration of purified protein was measured
by Bradford assay. The reactivity of all purified Fab antibodies
against HA protein was further confirmed by ELISA, as described
above, using an Anti-HA HRP as a detecting reagent.
2.12. Sensitivity test using dot ELISA
The highly specific clone to H5N1 virus was selected for sensitivity testing using dot ELISA. To determine the minimum amount
of antigen (H5 protein) that can be detected by the Fab antibody,
various concentrations of H5 protein were prepared by 10-fold serial dilution, from 20 ng/ll to 2 pg/ll. Similarly, Fab antibody with
various concentrations from 500 to 0.05 ng/ml were prepared. Aliquots (3 ll) of each concentration of antigen were dotted onto presoaked with methanol PVDF membrane strips. A total of 5 strips
per Fab concentration were performed. The membranes were airdried until the antigen solutions were completely absorbed into
the membrane. Then, each strip was incubated with each Fab antibody concentration, diluted in blocking buffer. The anti-HA antibody (1:1000) was then used to react with the Fab antibody. The
membranes were washed again, and the signals were developed
using a DAB reagent set (KPL, USA). The reaction was stopped by
washing the membrane with distilled water.
2.10. Immunofluorescence assay
3. Results
An immunofluorescence assay was used to study the binding
activity of the obtained Fab antibodies, to several strains and
subtypes of influenza A virus; A/duck/Egypt/D2br10/07 (H5N1),
A/crow/Kyoto/53/2004 (H5N1), A/Puerto Rico/8/1934 (H1N1), A/
Sydney/5/1997 (H3N2), A/Turkey/Wisconsin/1/66 (H9N2).
Madin–Darby canine kidney (MDCK) cells were grown in MEM
medium, supplemented with 10% fecal calf serum (FCS), penicillin
(5 104 U/ml), and streptomycin (50 mg/ml). An estimated number of 104 MDCK cells/well were monolayered into a 96-well culture plate (Iwaki, Japan) and infected with several subtypes of
influenza A virus with 0.01 MOI (multiplicity of infection). After
16–24 h incubation at 37 °C, the cells were fixed with ethanol.
Then, the fixed infected cells were reacted with the purified Fab
antibodies. Anti-NP antibody (C43) of influenza A H3N2 [19] was
used as a positive control, and anti-dengue antibody was used as
a negative control. Uninfected cells were also included in all experiments. The plates were incubated with the antibody solutions at
room temperature, with gentle rocking for 40 min. After incubation
with primary antibody, the wells were washed 3 with PBS, and
then reacted with fluorescein isothiocyanate (FITC)-conjugated
rabbit anti-human Fab (Jackson ImmunoResearch, Cambridgeshire,
UK) to detect Fab fragments, and FITC-anti-mouse IgG antibody,
(Invitrogen, MolecularProbe, USA) for anti-NP, and anti-dengue
antibody detection.
3.1. Library construction and selection
2.11. Focus reduction neutralization test
A focus reduction neutralization test was performed, as
described previously [20]. Briefly, MDCK cells (104 cell/well) were
infected with virus solution, preincubating with various concentrations of each Fab antibody by adjusting to yield a final
control count of 100 FFU/well, and cultured for 20 h with FCSfree MEM. The infected cells were fixed with ethanol, and then
staining. Focus staining was conducted by staining the cells with
mouse anti-influenza A (anti-NP) antibody at 1:1000 dilution in
PBS, followed by rabbit anti-mouse antibody (1:1000), goat
anti-rabbit immunoglobulin G (1:500), and peroxidase-rabbit
anti-peroxidase (PAP) complex (1:1000). Each incubation step
was performed at 37 °C for 30 min, with washing 3 with PBS.
The peroxidase reaction was developed using 0.3 mg 3,30 -diaminobenzidine (DAB), and 0.01% H2O2 per ml in PBS buffer. The cells
were then rinsed with tap-water and air-dried. The neutralizingantibody titer was expressed as the reciprocal of the highest
dilution that reduced the number of foci to 50% or less of the noantibody control value.
The 1.65 108 individual clones of the H5-immunized chimeric
chicken/human Fab library were successfully constructed. After the
4th selection round, the specific phages binding with the H5 protein were increased 100, implying that the antigen-specific
phage-Fab clones were enriched (data not shown).
3.2. Specificity test by Fab ELISA
After the 4th panning round, a total of 144 phage clones were
selected randomly. Among these, 55 positive clones showed high
reactivity against hemagglutinin (H5) protein.
3.3. Sequence analysis of specific positive clones
Using ClustalW and BioEdit programs, 9/55 unique variablechain patterns were found. The nine clones representing each pattern were designated H5Fab1–H5Fab9. The amino-acid sequences
of the variable heavy and light chains of all unique clones were
compared with germline chicken immunoglobulin sequences
obtained from the GenBank database (AAA48833.1 and AAA
48866.1), and Kabat immunoglobulin sequences database [21].
3.4. Determination of Fabs binding by Western blot
All clones bound to the epitope on the hemagglutinin protein
(HA0). Under reducing conditions H5Fab1 and H5Fab4–H5Fab8
bound to epitopes of HA2, and H5Fab9 bound to the epitope of
HA1. However, H5Fab2 and H5Fab3 bound neither to epitope on
HA1 nor HA2.
3.5. Immunofluorescence assay and neutralization test
By using purified Fab antibody to characterize the binding reactivity, all clones were tested by IFA using MDCK cells infected with
several influenza A virus subtypes. All clones reacted with both
Egyptian and Kyoto strains of the H5N1 virus. Clones H5Fab1,
H5Fab5, and H5Fab6, bound only with H5N1 virus. Clones
H5Fab2, H5Fab3, H5Fab4, H5Fab7, H5Fab8, and especially
H5Fab9, were cross-reacted with some other subtypes—H1N1,
H3N2, and H9N2. The binding reactivity of each Fab is shown in
Fig. 1. Interestingly, clone H5Fab2 showed 50% neutralization
activity at a concentration of 12.5 lg/ml (Fig. 2A and B). Reduction
of focus formation is shown in Fig. 2C.
P. Pitaksajjakul et al. / Biochemical and Biophysical Research Communications 395 (2010) 496–501
3.6. Sensitivity test using dot ELISA
H5Fab6 was selected for sensitivity-testing by dot ELISA. After
reacting each concentration of Fab antibody with various concentrations of purified H5 protein, it was shown that as little as
60 pg of H5 protein could be detected by our Fab antibodies. The
results are shown in Fig. 3.
4. Discussion
To control epidemic avian influenza virus, therapeutic antibodies and rapid and reliable diagnostic tests are among the most
valuable tools. By phage display technology, this technology involves the expression of protein or antibody, which is encoded
499
from genetic material inserted into the bacteriophage genome,
then displayed on the surface of the filamentous phage. By these
means, a billion protein variants can be constructed simultaneously, to produce a so-called phage antibody library. These libraries can then be easily used to select specific phage particles
carrying sequences with desired binding specificities from nonbinding particles [22].
In this study, we constructed an immunized phage display library using chickens as an animal model, due to the complexity
of the primer combinations required to generate the library. This
is because chickens only have one functional immunoglobulin variable heavy (VH) chain and light (VL) chain region. However, chicken immunoglobulin diversification is based on mechanisms called
‘‘gene conversion”, using a rearrangement of the pseudo-V gene
Fig. 1. Immunofluorescence of MDCK cell infected with several subtypes of influenza A virus, and reacted with each 9 Fab antibodies. The influenza virus used is A/crow/
Kyoto/53/2004 (H5N1), A/duck/Egypt/D2br10/07 (H5N1), A/Puerto Rico/8/1934 (H1N1), A/Sydney/5/1997 (H3N2), A/Turkey/Wisconsin/1/66 (H9N2).
500
P. Pitaksajjakul et al. / Biochemical and Biophysical Research Communications 395 (2010) 496–501
Fig. 2. Focus reduction neutralization test. (A) The neutralization activities of 9 Fab
MAbs with influenza virus strain A/crow/Kyoto/53/2004 (H5N1). No-antibody
control means the infection of the virus to MDCK cell by pre-incubation with PBS
buffer. (B) The neutralization activity of H5Fab2 with A/crow/Kyoto/53/2004
(H5N1), A/duck/Egypt/D2br10/07 (H5N1), A/Puerto Rico/8/1934 (H1N1). The 50%
inhibitory were observed with antibody concentration at 12.5 lg/ml. (C) The
reduction of focus forming unit comparing between no-antibody control and
H5Fab2 at 12.5 lg/ml.
Fig. 3. Dot ELISA for sensitivity test of H5Fab6. As little as 20 pg/ll of H5 antigen
can be detected.
set of primer binding to the conserved region of the functional V
gene can be used to amplify the full diversity of the antibody sequences [23–26].
We generated 9 Fab MAbs for further characterization of subunit specificity by Western blot, and binding specificity by immunofluorescence assay (IFA). The advantage of recombinant
antibodies is they are relative ease of use and greater stability for
batch-to-batch production.
For the study of specificity, all Fabs were specifically reacted
with different strains and clades of the H5N1 virus. Most of them
(6/9) bound to the epitope of HA2, which is the conserved domain
responsible for fusion of the viral envelope and endosomal membrane. Some of these clones showed cross-reactivity to some of
the other subtypes of the influenza virus tested (H1, H3, and H9).
However, three Fab clones (H5Fab1, H5Fab5, and H5Fab6) were
highly specific only to H5N1 influenza virus. For this reason, for
diagnostic applications, these three clones might be good candidates for further affinity characterization, and development as a
diagnostic reagent for H5N1 testing. Among these 3 Fab MAbs,
H5Fab6 was chosen for sensitivity testing using dot ELISA.
For therapeutic applications, one Fab (H5Fab2) can inhibit virus’
infecting to MDCK cells, observed by the reduction in focus forming
units. However, the epitope study showed that this clone only
bound to the linear epitope on HA0, which was similar to another
clone, H5Fab3. It may be that these two clones bound to a structural inter-domain epitope supported by the disulfide linkage.
Therefore, the binding epitopes of these Fabs need to be clarified
in a further study. Since the variable antibody regions of our Fab
antibody originated from chickens, humanization of this Fab clone
is required. Another Fab clone (H5Fab9) showed strong binding
reactivity to all subtypes of influenza virus tested. This clone recognized the epitope on the HA1 domain, which has more genetic variation. This domain is responsible for host receptor binding, which
is more prone to mutation and natural selection to evade the host’s
immune response [9]. However, study of the crystal structure of
the HA protein found that most of the HA structure had a similarly
configured receptor binding domain (RBD), and antigenic variation
mostly occurred in this region [17]. So, it may possible that the epitope in which this cross-reactive Fab antibody was bound, could be
located outside this region.
We found that two Fab clones with unique characteristics—
H5Fab2 with neutralization activity, and H5Fab9 with cross-reactivity—have unique heavy chain CDR3 sequences. So, it may be inferred that the heavy chain CDR3 of our antibodies plays an
important role and is associated with the Fab binding function to
the antigen, as described by some researchers [27]. This is another
advantage of phage display technology: we can commence working with genetic materials, check the phenotype characteristics,
and then analyze, compare, and modify the genetic information,
as needed.
Our results show that the anti-HA Fab MAbs obtained from this
study can be successfully and conveniently produced from chickens. This is the first report of recombinant MAb production specific
to the H5 protein of H5N1 Influenza virus, using phage display
technology, and generated from chickens. The antibody obtained
from this study may possess some unique characteristic never obtained in previous studies using humans or mice. This method,
especially when chickens are used, produces MAbs very efficiently.
Moreover, since the soluble Fab fragments can be produced from
the prokaryotic system, the cost of MAb production is much lower
than cell culture systems.
Acknowledgments
fragment, which possesses 25 VL and 100 VH pseudogenes, upstream of the functional V gene, [23]. For this reason, only one
The authors thank Dr. Takaaki Nakaya, of the Research Institute
for Microbial Diseases, Osaka University, for providing the Kyoto
P. Pitaksajjakul et al. / Biochemical and Biophysical Research Communications 395 (2010) 496–501
strain of H5N1 (A/crow/Kyoto/53/2004). The authors also thank
Prof. Ian A. Wilson (The Scripps Research Institute, USA) for kindly
providing hemagglutinin protein. This research was supported by
the Thailand Research Fund. A student scholarship was provided
by the Strategic Scholarships for Frontier Research Network for
the Joint Ph.D. Program Thai Doctoral degree, Office of the Commission on Higher Education, Ministry of Education, Thailand.
References
[1] B.S. Kamps, C. Hoffman, W. Preiser, Influenza Report 2006. Flying Publisher,
155p. Available from: <www.influenzareport.com>.
[2] C.P. Simmons, N.L. Bernasconi, A.L. Suguitan, K. Mills, J.M. Ward, N.V. Chau, T.T.
Hien, F. Sallusto, Q. Ha do, J. Farrar, M.D. de Jong, A. Lanzavecchia, K. Subbarao,
Prophylactic and therapeutic efficacy of human monoclonal antibodies against
H5N1 influenza, PLoS Med. 4 (2007) e178.
[3] J. Lu, Z. Guo, X. Pan, G. Wang, D. Zhang, Y. Li, B. Tan, L. Ouyang, X. Yu, Passive
immunotherapy for influenza A H5N1 virus infection with equine
hyperimmune globulin F(ab0 )2 in mice, Respir. Res. 7 (2006) 43.
[4] B.J. Hanson, A.C. Boon, A.P. Lim, A. Webb, E.E. Ooi, R.J. Webby, Passive
immunoprophylaxis and therapy with humanized monoclonal antibody
specific for influenza A H5 hemagglutinin in mice, Respir. Res. 7 (2006) 126.
[5] M.S. Lee, J.C. Lee, C.Y. Choi, J. Chung, Production and characterization of
monoclonal antibody to Botulinum Neurotoxin Type B light chain by phage
display, Hybridoma 27 (2008) 18–24.
[6] Y.C. Lee, S.J.C. Leu, C.J. Hu, N.Y. Shih, I.J. Huang, H.H. Wu, W.S. Hsieh, B.L. Chiang,
W.T. Chiu, Y.Y. Yang, Chicken single-chain variable fragments against the
SARS-CoV spike protein, J. Virol. Methods 146 (2007) 104–111.
[7] W.J.J. Finlay, I. Shaw, J.P. Reilly, M. Kane, Generation of high-affinity chicken
single-chain Fv antibody fragments for measurement of the Pseudonitzschia
pungens toxin domoic acid, Appl. Environ. Microbiol. 72 (2006) 3343–3349.
[8] X.K. Deng, L.A. Nesbit, K.J. Morrow Jr., Recombinant single-chain variable fragment
antibodies directed against Clostidium difficile toxin B produced by use of an
optimized phage display system, Clin. Diagn. Lab. Immunol. 10 (2003) 587–595.
[9] F.F. Chiu, N. Venkatesan, C.R. Wu, A.H. Chou, H.W. Chen, S.P. Lian, S.J. Liu, C.C.
Huang, W.C. Lian, P. Chong, C.H. Leng, Immunological study of HA1 domain of
hemagglutinin of influenza H5N1 virus, Biochem. Biophys. Res. Commun. 383
(2009) 27–31.
[10] L.V. Zhmaeva, A.Iv. Kozlov, S.S. Iamnikova, S.L. Kal’nov, O.A. Verkhovskii, T.I.
Aliper, Development of a diagnostic test system on the basis of sandwich ELISA
for the detection of avian influenza A virus, Vopr. Virusol. 54 (4) (2009) 45–49.
[11] M. Yang, Y. Berhane, T. Salo, M. Li, K. Hole, A. Clavijo, Development and
application of monoclonal antibodies against avian influenza virus
nucleoprotein, J. Virol. Methods 147 (2008) 265–274.
[12] S. Oh, P. Selleck, N.J. Temperton, P.K.S. Chan, B. Capecchi, J. Manavis, G. Higgins,
C.J. Burrell, T. Kok, Neutralizing monoclonal antibodies to different clades of
influenza A H5N1 viruses, J. Virol. Methods 157 (2009) 161–167.
501
[13] A. Du, T. Daidoji, T. Koma, M.S. Ibrahim, S. Nakamura, U.C. de Silva, M. Ueda,
C.S. Yang, T. Yasunaga, K. Ikuta, T. Nakaya, Detection of circulating Asian H5N1
viruses by a newly established monoclonal antibody, Biochem. Biophys. Res.
Commun. 378 (2009) 197–202.
[14] S.F. Wang, K.H. Chen, A. Thitithanyanont, L. Yao, Y.M. Lee, Y.J. Chan, S.J. Liu, P.
Chong, W.T. Liu, J.C. Huang, Y.M. Chen, Generating and characterizing
monoclonal and polyclonal antibodies against avian H5N1 hemagglutinin
protein, Biochem. Biophys. Res. Commun. 382 (4) (2009) 691–696.
[15] Q. Luo, H. Huang, W. Zou, H. Dan, X. Guo, A. Zhang, Z. Yu, H. Chen, M. Jin, An
indirect sandwich ELISA for the detection of avian influenza H5 subtype
viruses using anti-hemagglutinin protein monoclonal antibody, Vet. Microbiol.
137 (2009) 24–30.
[16] M.J.H. Ratcliffe, Antibodies, immunoglobulin genes and the bursa of fabricius
in chicken B cell development, Dev. Comp. Immunol. 30 (2006) 101–118.
[17] J. Stevens, O. Blixt, T.M. Tumpey, J.K. Taubenberger, J.C. Paulson, Structure and
receptor specificity of the hemagglutinin from an H5N1 influenza virus,
Science 312 (2006) 404–410.
[18] J. Andris-Widhopf, C. Rader, P. Steinberger, R. Fuller, C.F. Barbas III, Methods for
the generation of chicken monoclonal antibody fragments by phage display, J.
Immunol. Methods 242 (2000) 159–181.
[19] Y. Okuno, Y. Isegawa, F. Sasao, S. Ueda, A common neutralizing epitope
conserved between the hemagglutinins of influenza A virus H1 and H2 strains,
J. Virol. 67 (1993) 2552–2558.
[20] Y. Okuno, K. Tanaka, K. Baba, A. Maeda, N. Kunita, S. Ueda, Rapid focus
reduction neutralization test of influenza A and B viruses in microsystem, J.
Clin. Microbiol. 28 (1990) 1308–1313.
[21] E.A. Kabat, T.T. Wu, H.M. Perry, K.S. Gottesman, C. Foeller, Sequences of
Proteins of Immunological Interest, Public Health Service, National Institute of
Health, 1991.
[22] H.M.E. Azzazy, W.E. Highsmith, Phage display technology: clinical applications
and recent innovations, Clin. Biochem. 35 (2002) 425–445.
[23] S.I. Sapats, H.G. Heine, L. Trinidad, G.J. Gould, A.J. Foord, S.G. Doolan, S. Prowse,
J. Ignjatovic, Generation of chicken single chain antibody variable fragments
(scFv) that differentiate and neutralize infectious bursal disease virus (IBDV),
Arch. Virol. 148 (2003) 497–515.
[24] W.J.J. Finlay, N.C. deVore, E.N. Dobrovolskaia, A. Gam, C.S. Goodyear, J.E. Slater,
Exploiting the avian immunoglobulin system to simplify the generation of
recombinant antibodies to allergenic proteins, Clin. Exp. Allergy 35 (2005)
1040–1048.
[25] A.J. Foord, J.D. Muller, M. Yu, L.F. Wang, H.G. Heine, Production and application
of recombinant antibodies to foot-and-mouth disease virus non-structural
protein 3ABC, J. Immunol. Methods 321 (1–2) (2007) 142–151 (Epub 2007 Feb
14).
[26] D. Abi-Ghanem, S.D. Waghela, D.J. Caldwell, H.D. Danforth, L.R. Berghman,
Phage display selection and characterization of single-chain recombinant
antibodies against Eimeria tenella sporozoites, Vet. Immunol. Immunopathol.
121 (1–2) (2008) 58–67 (Epub 2007 Aug 11).
[27] Y. Shen, X. Yang, N. Dong, X. Xie, X. Bai, Y. Shi, Generation and selection of
immunized Fab phage display library against human B cell lymphoma, Cell
Res. 17 (2007) 650–660.