Gene Therapy (2011), 1–5
& 2011 Macmillan Publishers Limited All rights reserved 0969-7128/11
www.nature.com/gt
SHORT COMMUNICATION
Benzoate X receptor zinc-finger gene switches for
drug-inducible regulation of transcription
LJ Schwimmer1,2, B Gonzalez1,3 and CF Barbas III1
Targeted zinc-finger (ZF) DNA-binding domains in conjunction with nuclear receptor ligand-binding domains (LBDs) produce
chemically inducible gene switches that have applications in gene therapy and proteomic and genomic research. The benzoate
X receptor-b (BXRb) LBD was used to construct homodimer and single-chain ZF transcription factors (ZFTFs). These ZFTFs
specifically regulated the transcription of target genes in response to two ligands, ethyl-4-hydroxybenzoate and propyl-4hydroxybenzoate, in a dose-dependent manner. The ZFTFs also regulated the expression of endogenous intercellular adhesion
molecule-1 in response to either ligand. The advantage of BXRb-based ZFTFs is that the ligands are inexpensive and easily
synthetically modified, making the system a base for creation of orthogonal ligand–receptor pairs and expanding the
gene-switch toolbox.
Gene Therapy advance online publication, 28 July 2011; doi:10.1038/gt.2011.112
Keywords: gene switch; zinc finger; transcription factor; benzoate X receptor; nuclear receptor
INTRODUCTION
Gene switches that allow control of transcription of a specific gene
with small-molecule drugs are valuable tools for studying gene
function and biological pathways, and may provide the basis for
gene therapies. Tightly controlled, highly inducible and dose-responsive activation of transgenic and endogenous gene expression are
required for effective and safe use of these gene switches. Zinc-finger
(ZF)-based artificial transcription factors (TFZFs), constructed by
fusion of a ZF with an effector domain such as the herpes simplex
VP16 domain (VP64) or the Krüppel-associated box (KRAB),1 have
been shown to regulate transcription of transgenic and endogenous
genes.2,3 Using nuclear receptor ligand-binding domains (LBDs) as
effector domains has the added desired elements of tunable exogenous
and reversible control.4–6
Selected ZF domains specifically recognize three bases of DNA.7 ZFs
are modular proteins that can be combined to create chains that
recognize longer DNA sequences.8–10 To date, ZF domains that recognized almost all of the GNN, ANN and CNN DNA triplets have been
identified.10–14 Approaches other than modular assembly also provide
access to polydactyl ZF proteins.15 Artificial transcription factors that use
ZFs for DNA recognition typically use six ZFs to recognize 18 bases of
DNA; this length of sequence is theoretically unique in the genome.16
Nuclear receptors are ligand-activated transcription factors that
regulate growth, development and homeostasis. Binding of smallmolecule ligands, including hormones, vitamins and dietary lipids,
causes a conformational change in the LBD. This change allows
binding to DNA and to co-activators, which recruit the transcription
machinery, thereby activating transcription in a reversible liganddependent manner. Nuclear receptors function as homodimers or
heterodimers with the retinoid X receptor (RXR).17,18
The modular nature of ZFs and nuclear receptor LBDs make them
ideal partners for the construction of gene switches, and in early
studies we reported the development of progesterone, estrogen and
ecdysone receptor (EcR)-based ZF transcription factors (ZFTFs).4
More recently, we reported using single-chain estrogen receptor
homodimers and single-chain RXR/EcR heterodimers linked to
six-finger ZFs to regulate endogenous gene transcription in a dosedependent manner.6 In an alternative approach, Dent and coworkers
used a truncated progesterone receptor and the nuclear factor-kB p65
activation domain linked to the VZ+434 ZF to create a smallmolecule-activated gene switch that relies on translocation of the
protein to the nucleus after ligand binding.5
Here, we report a new tool for the gene-switch toolbox that uses the
benzoate X receptor-b (BXRb) as a gene switch. The BXRb from
Xenopus laevis is a member of the nuclear receptor superfamily of
ligand-activated transcription factors. It is closely related to Xenopus
BXRa, mouse pregnane X receptor and human steroid and xenobiotic
X receptor.19 However, BXRb does not function as a xenobiotic
receptor as do pregnane X receptor and steroid and xenobiotic X
receptor20 and is less promiscuous than BXRa in both ligand and
co-activator preferences.21 BXRb functions endogenously as a heterodimer with RXRa19 but has shown to function as a homodimer in
transient transfection assays.20,21
BXRb’s chief advantage over other nuclear receptors used as ligandactivated gene switches is its ligands. Ligands for other nuclear
receptor used in gene switches include tamoxifen, mifepristone and
ponasterone-A.5,6 These compounds are expensive and, with the
exception of ponasterone-A, have biological activity in humans. The
ligands for BXRb, ethyl-4-hydroxybenzoate (E-4HB) and propyl-4hydroxybenzoate (P-4HB), are benzoates and are commonly known as
1Departments of Molecular Biology and Chemistry, Skaggs Institute for Chemical Biology, Scripps Research Institute, La Jolla, CA, USA
Correspondence: Professor CF Barbas III, Departments of Molecular Biology and Chemistry, Skaggs Institute for Chemical Biology, Scripps Research Institute, 10550 North Torrey
Pines Road, La Jolla, CA 92037, USA.
E-mail: carlos@scripps.edu
2Current address: XOMA, 2910 7th Street, Berkeley, CA 94710, USA.
3Current address: Institut de Medicina Predictiva i Personalitzada de Càncer, Ctra De Can Ruti, Camı́ de les Escoles, 08916 Badalona, Spain.
Received 14 March 2011; revised 10 June 2011; accepted 24 June 2011
BXR zinc-finger gene switches
LJ Schwimmer et al
2
parabens. These parabens are generally regarded as safe and are used as
preservatives in cosmetics and pharmaceuticals. Other than weak
estrogenic activity (these parabens are 410 000-fold less potent than
17b-estradiol), neither E-4HB nor P-4HB has known biological
activity and neither are carcinogenic nor teratogenic.22
E-4HB nor P-4HB are small and inexpensive. Additionally, as
benzoates are easily synthetically modified, the parabens lend themselves to combinatorial chemistry and can be paired with libraries of
BXRb mutants to create new orthogonal ligand–receptor pairs or
increase affinity of the currently recognized ligands. These techniques
have been demonstrated for RXR and estrogen receptor-based gene
switches.23,24 Here, we fused ZFs with BXRb to create a versatile geneswitch platform. The TFZFs described have potential for use in gene
therapy and for the study of gene expression and biological pathways.
RESULTS AND DISCUSSION
Three systems were constructed to study BXRb-based TFZFs. First, the
BXRb linker and LBD were fused directly to three-finger ZF proteins,
C7(ref. 25) and N1(ref. 4) (Figure 1, upper panel). C7 is based on the Zif268
and has a Kd of 0.5 nM for its DNA target, whereas N1 is based on SP1C
and has a Kd between 5 and 10 mM. Using ZFs with different affinities
allowed us to investigate the effect that ZF affinity for DNA target has on
inducible expression. Previous versions of ZF-nuclear receptor fusions
have used VP64 to impart greater transcriptional activation;4 however, in
the BXR system, VP64 fusions demonstrated unacceptable levels of
activation in the absence of ligand (data not shown).
Inducible transgene expression was probed using a luciferase
reporter vector with 10 copies of the respective ZF response elements
repeated with 4 bp spacing upstream of the luciferase gene. HeLa cells
were transiently transfected with three plasmids carrying the BXRb
ZFTF , the reporter and a constitutively expressed b-galactosidase gene
(CMV-LacZ) for normalization of transfection efficiency. Serial dilutions of each ligand (E-4HB and P-4HB) and 0.1% dimethyl sulfoxide
(as a control) were added B24 h after transfection, and cell lysates
were prepared 48 h after transfection.
BXRb is able to function in human cells as a homodimer (Figure 2).
When fused to either ZF, BXRb showed a dose-dependent activation
of gene expression, with virtually no background expression in the
absence of ligand. In general, use of P-4HB resulted in higher absolute
expression levels than E-4HB, although the fold upregulations were
comparable (Figure 2 and Table 1). The EC50s (concentration of ligand
at which relative light unit is half maximal) for both ZFs with P-4HB
(1–3 mM) were lower than with E-4HB (3–10 mM). Finally, the absolute
and relative expression levels with C7 were higher than those with N1,
reflecting the ZF affinity difference.
This homodimer system has its limits for practical use. The direct
repeat response elements with four-base spacing are required for
proper dimerization of the BXRb LBDs to occur. This requirement
severely limits the endogenous target sites available for transcriptional
activation. Therefore, we developed systems with a single-chain BXRb
homodimer (BLB) and a single-chain RXRa-BXRb heterodimer
(RLB) as shown in Figure 1, middle and lower panels. These
constructs can be linked to a six-finger ZF protein, removing the
symmetry requirement and increasing the targeting selectivity.
The single-chain constructs consisted of a six-finger ZF, followed by
the linker and the LBD from either BXRb or RXRa. These were linked
by a 30 amino-acid flexible linker to the LBD of BXRb. Constructs
with and without a VP64 domain were also made for comparison
(Figure 1, middle and lower panels). The CD54-31opt ZF (31opt),
which targets the promoter for intercellular adhesion molecule-1
(ICAM-1), was chosen for these studies because it binds with high
Gene Therapy
Figure 1 Schematic representation of the two modes of action of
ZF–benzoate receptor fusion proteins. Top, three-finger fusion proteins
undergo intermolecular dimerization (BXRb homodimer) and bind composite
target sequences consisting of two 9 bp subsites (ZF response element, ZF
RE). Middle, six-finger ‘single-chain’ BXR–BXR fusion proteins undergo an
intramolecular rearrangement and bind to a single, contiguous 18-bp DNA
ZF RE sequence. Lower, six-finger ‘single-chain’ RXR–BXR fusion proteins
undergo an intramolecular rearrangement and bind to a single, contiguous
18-bp DNA ZF RE sequence. ED, effector domain.
affinity and specificity to a single unique site of the ICAM-1
promoter26 and can be used for studying both transgene and endogenous regulation. The 31opt-BLB, 31opt-RLB, 31opt-BLB-VP64 and
31opt-RLB-VP64 vectors were transiently transfected with a reporter
plasmid containing the ICAM-1 promoter upstream of the luciferase
gene26 and the CMV-LacZ plasmid. The ligands were added, and the
luciferase assay was performed as described for the C7- and N1-BXRb
constructs. In contrast to the reporter used for the homodimer system
studied with C7- and N1-BXRb constructs, this reporter contains only
a single response element.
BLB and RLB both showed dose-dependent transcriptional activation with and without the VP64 domain (Figure 3). The constructs
with VP64 imparted a higher absolute level of activation, but the fold
activation was less than without VP64 (Table 1). There was more basal
activation with RLB than BLB. We hypothesize that by linking RXR
and BXR in the RLB construct their affinity for each other allows
dimerization, even when ligand is not present (BXRb forms a
heterodimer with RXRa). As BXRb does not naturally form homodimers, there was less basal activation of transcription.
BXR zinc-finger gene switches
LJ Schwimmer et al
3
Figure 2 Dose–response of N1- and C7-BXRb homodimer constructs to
E-4HB and P-4HB. Serial dilutions of each ligand were added to HeLa cells
transfected with an effector plasmid containing the BXR construct, a
reporter plasmid with 10 copies of the target ZF response element
controlling transcription of luciferase, and a plasmid constitutively
expressing b-galactosidase. Luciferase activity was normalized to
b-galactosidase activity and reported as relative light units (RLUs).
Table 1 Maximum fold activation of luciferasea
C7-BXR
N1-BXR
31opt-BLB
31opt-RLB
31opt-BLB-VP
31opt-RLB-VP
E-4HB
P-4HB
1080 (±150)
470 (±55)
48 (±8)
900 (±206)
750 (±70)
37 (±12)
14 (±3)
8 (±1)
11 (±3)
12 (±1)
3 (±0.6)
3 (±0.8)
Abbreviations: BXR, benzoate X receptor; DMSO, dimethyl sulfoxide; E-4HB, ethyl-4-hydroxybenzoate;
P-4HB, propyl-4-hydroxybenzoate; RLU, relative light unit.
aCalculated by dividing the maximum RLU obtained with ligand by the RLU with vehicle (0.1%
DMSO).
The BLB and RLB constructs were tested for their ability to
upregulate transcription of endogenous ICAM-1. When the VP64
domain was present, endogenous activation was observed, and the
addition of the ligand induced little (BLB) or no (RLB) additional
upregulation (data not shown). When the VP64 domain was not
present, the 15–25% of cells transduced with the RLB or BLB
constructs showed 25- to 50-fold induction (shift in mean fluorescence intensity) of ICAM-1 expression in the presence of 100 mM
E-4HB or P-4HB (Figure 4). Controls with no ligand, or with nontargeting ZFs (data not shown), did not show any induction of
expression. This demonstrated that, in the presence of their ligands,
the BLB and RLB constructs induced expression of endogenous genes
by targeting the endogenous promoter.
For the estrogen receptor (scER) and RXR/EcR (RE and RLE)
single-chain gene switches, endogenous regulation is context
dependent.6 In the BLB and RLB systems, only a fraction of cells
showed upregulation of ICAM-1 expression; this could be due to
interaction with retinoic acid receptor as was hypothesized with the
RE and RLE switches. Additionally, the ICAM-1 promoter is known to
contain a silencing region that regulates endogenous expression27 and
this may counteract the upregulation by BLB and RLB in a sub-
Figure 3 Dose–responses of (a) pcDNA3-31opt-RLB and pcDNA3-31optBLB and (b) pcDNA3-31opt-RLB-VP64 and pcDNA3-31opt-BLB-VP64.
Serial dilutions of each ligand were added to HeLa cells transfected with an
effector plasmid containing the BXR construct, a reporter plasmid with the
target ZF response element controlling transcription of luciferase, and a
plasmid constitutively expressing b-galactosidase. Luciferase activity was
normalized to b-galactosidase activity and reported as relative light units
(RLUs).
population of the C8161 cells. However, for the cells that do respond
to ligand, the 25- to 50-fold induction of ICAM-1 expression is
much greater than the maximum 4.8-fold induction seen with our
previously published TFZFs.6
The basal upregulation of the target genes in the reporter and
endogenous systems when BLB and BLR are fused to VP64 may stem
from BXRb’s non-human origin. Nuclear receptors naturally interact
with corepressors, which function to repress transcription when no
ligand is bound.28 BXRb may not interact properly with human
corepressors, which is a limitation of this system. The RE, RLE and
scER TFZFs are of human origin and do not have this issue, and are
therefore able to utilize VP64 and KRAB to assist in the up- and
downregulation of gene expression.
Gene Therapy
BXR zinc-finger gene switches
LJ Schwimmer et al
4
BLB P-4HB
104
104
104
103
2
2
0 102 103 104 105
GFP
0
RLB isotype
102 103 104 105
GFP
10
102
0
Cy-5
Cy-5
10
103
103
0 10
3
4
10 10
GFP
5
10
0 102
0 10
2
3
4
10 10
GFP
5
10
103 104 105
GFP
RLB P-4HB
5
10
10
103
102
0
102
0
2
4
103 10 105
GFP
4
4
10
2
RLB E-4HB
105
4
30
103
10
0
0 10
RLB DMSO
105
35
2
10
0
10
0
10
0
103
Cy-5
103
Cy-5
104
Cy-5
105
2
Cy-5
BLB E-4HB
105
5
104
0 10
3
4
10 10
GFP
5
10
25
20
15
10
5
103
0
102
0
2
% of GFP+ cells with
ICAM-1 induction
BLB DMSO
105
Cy-5
Cy-5
BLB isotype
105
DMSO E-4HB P-4HB
2
0 10
3
4
10 10
GFP
5
10
Figure 4 Endogenous activation of ICAM-1 expression by BXR single-chain gene switches retrovirally transduced into C8161 cells. (a) Representative flow
cytometry dot plots with green fluorescent protein (GFP) representing cells expressing BXR constructs on the x axis and Cy-5 representing ICAM-1 expression
on the y axis. (b) Average percentage of GFP-positive cells with BLB (black bars) and RLB (white bars) retrovirally tranduced into C8161 cells that show an
increase in ICAM-1 expression upon treatment with 100 mM ligand or 0.1% dimethyl sulfoxide.
In conclusion, we have demonstrated that BXRb can function, in
conjunction with ZFs, as a gene switch in the context of reporter
plasmids and endogenous genes. These BLB and RLB ZFTFs complement the previously described nuclear receptor-based gene switches5,6
by providing a system activated by small, inexpensive ligands. The BLB
and RLB ZFTF systems can be readily adapted through engineering of
the BXR LBD to bind derivatives of the known ligands as has been
previously done with RXR.24 A library of BXR/ligand gene switches
paired with a multitude of ZFs has the potential to be a very powerful
tool for genomic and proteomic research, as well as gene therapy
applications.
MATERIALS AND METHODS
Plasmid construction
BXRb was codon optimized for human expression and synthesized by GeneArt
(Regensburg, Germany). The DNA sequence and translation for BXRb are
included as Supplementary Information. The Supplementary Information also
includes DNA sequences for the effector plasmids and translations of the
effectors. All restriction endonucleases were purchased from New England
Biolabs (Ipswich, MA, USA) with the exception of SfiI, which was purchased
from Roche (Indianapolis, IN, USA). pcDNA3-N1-BXR and pcDNA3-C7-BXR
were created by first inserting BXR between E2C and VP64 in the pcDNA3/
E2C-V64(ref. 8) plasmid via digestion with FseI and AscI. The VP64 domain was
removed by digesting with AscI and NotI, followed by filling in the overhangs
using T4 DNA polymerase and blunt ligation. A stop codon was added using
site-directed mutagenesis with primers BXRstopF (5¢-GTGTTCGGATCCCTG
AACGAGTGAGGGCGCGGGCCGC-3¢) and BXRstopR (5¢-GCGGCCCGCGC
CCTCACTCGTTCAGGGATCCGAACAC-3¢). The E2C ZF was replaced with
ZFs N1(ref. 8) and C7(ref. 25) via SfiI digestion. To construct pcDNA3- 31optRLB-VP64, an NheI site was added in the linker of pcDNA3/E2C-RLE-VP64 via
overlap extension PCR. First, the RXRa portion was amplified with primers
pcDNAseqF (5¢-CACTATAGGGAGACCCAAGCTTG-3¢) and NheI+R (5¢-GCC
ACCGCCGCTAGCGGAACCACCCCCACCAC-3¢), and the EcR portion was
amplified with primers NheI+F (5¢-GTGGTGGGGGTGGTTCCGCTAGCGGC
GGTGGC-3¢) and Primseq2 (5¢-CAGATGGCTGGCAACTAG-3¢). The PCR
products were then annealed and amplified in a PCR reaction with pcDNAseqF
and Primseq2. This PCR product was digested with AscI and AgeI and ligated
into pcDNA-E2C-BXR-VP64, replacing the BXR region and creating pcDNAE2C-RLE(+NheI)-VP64. BXR was amplified from pcDNA-N1-BXR-VP64 with
Gene Therapy
primers LinkBXRF (5¢-GAGGAGGAGGCTAGCGGCGGTGGCGGTGGCTCC
TCTGGTGGCGGTGGCGGTTCTTCCCCCGAGCAGCAGCACTTC-3¢) and
BXRR (5¢-GAGGAGGAGGGCGCGCCCCTCG-3¢). The PCR product was
digested with NheI and AscI and used to replace the EcR in pcDNA-E2CRLE(+NheI)-VP64. The E2C ZF was replaced with the CD54-31opt26 ZF. To
construct pcDNA3-31opt-BLB-VP64, BXR was amplified from pcDNA-N1BXR-VP64 with primers BXRF (5¢-GAGGAGGAGGGCCGGCCGGAAGG-3¢)
and LinkBXRR (5¢-GAGGAGGAGGCTAGCGGAACCACCCCCACCACCGCC
CGAGCCACCGCCCGAGCCACCGCCACCAGAGAACTCGTTCAGGCTGCC
GAAC-3¢). The PCR product was digested with FseI and NheI, and used to
replace the RXR region in pcDNA3-31opt-RLB-VP64. To construct pcDNA331opt-RLB and pcDNA3-31opt-BLB, BXR was amplified from pcDNA-N1BXR with LinkBXRF and BXRSacIIR (5¢-GAGGAGGAGCCGCGGCCCG
CGC-3¢). The PCR product was digested with NheI and SacII, and used to
replace BXR-VP64 in pcDNA3-31opt-RLB-VP64 and pcDNA3-31opt-BLBVP64. 31opt-BLB-VP64 was transferred into the pMX-IRES-GFP vector via
digestion with XhoI and PacI and subsequently ligated into pMX-E2C-VP64(ref. 6)
to create pMX-31opt-BLB-VP64. pMX-31opt-RLB-VP64 was created by digestion of pcDNA3-31opt-RLB-VP64 with XcmI and ligation into pMX-31optBLB-VP64, replacing the first BXR with RXR. The pMX-31opt-RLB-KRAB and
pMX-31opt-BLB-KRAB plasmids were created by digestion of pMX-E2C-RLEKRAB6 with AscI and EcoRI. The resulting fragment was used to replace the
VP64 domains of pMX-31opt-RLB-VP64 and pMX-31opt-BLB-VP64 with
KRAB. The pMX-31opt-BLB and pMX-31opt-RLB plasmids were created by
digestion of and pMX-31opt-BLB-KRAB and pMX-31opt-RLB-KRAB with
AscI and EcoRI, followed by ligation with a small, double-stranded DNA
adaptor (5¢-CGCGCCGATGCTTACCCGTACGACGTTCCGGACTACGCTTC
TTGAATCGGTAGG-3¢).
Luciferase assays
E-4HB and P-4HB were purchased from Sigma (St Louis, MO, USA). HeLa
cervix carcinoma cells were obtained from the ATCC (Manassas, VA, USA) and
were maintained in Dulbecco’s modified Eagle’s medium supplemented with
10% (v/v) fetal calf serum, antibiotics and antimycotics. Approximately 5104
HeLa cells were seeded into 24-well plates at 40–60% confluency. HeLa cells
were transfected with 150 ng reporter plasmid (pGL3-10xN1-TATA8, pGL310xC7-TATA8 or pGL3-ICAM-1(ref. 26)), 25 ng effector plasmid (pcDNA3-C7BXRb, pcDNA3-N1-BXRb, pcDNA3-31opt-RLB, pcDNA3- 31opt-BLB,
pcDNA3-31opt-RLB-VP64 or pcDNA3-31opt-BLB-VP64) and 100 ng of
CMV-LacZ using Lipofectamine and Plus reagents (Invitrogen, Carlsbad, CA,
BXR zinc-finger gene switches
LJ Schwimmer et al
5
USA). After B24 h, expression was induced by the addition of serial dilutions
of E-4HB or P-4HB. Cell lysates were prepared B48 h after transfection by
incubation in Passive Lysis Buffer (Promega, Madison, WI, USA). Luciferase
and b-galactosidase activities were measured using assay reagent kits from
Promega and Tropix (Bedford, MA, USA), respectively, in a MicroLumat
LB96P luminometer (EG&G Berthold, Gaithersburg, MD, USA). Luciferase
activity was normalized to b-galactosidase activity in HeLa cells.
Endogenous activation of ICAM-1
The 293-GagPol packaging cell line was obtained from I Verma (Salk Institute,
San Diego, CA, USA). Melanoma C8161 cells were a gift from RA Reisfeld
(Scripps Research Institute, La Jolla, CA, USA) and were chosen because they
express ICAM-1 at moderate levels. 293-GagPol cells were maintained in
Dulbecco’s modified Eagle’s medium supplemented with 10% (v/v) fetal calf
serum, antibiotics and antimycotics. C8161 cells were maintained in Dulbecco’s
modified Eagle’s medium supplemented with 10% fetal calf serum, antibiotics,
antimycotics, 1 mM modified Eagle’s medium sodium pyruvate and 20 mM
HEPES. Retroviral gene delivery was accomplished as previously described26
with minor modifications. Virus was cleared by filtration with a 0.45-mm
syringe filter, and C8161 host cells were infected three times with media from
virus expressing 293-GagPol cells. After 24 h, Dulbecco’s modified Eagle’s
medium media (as described above for C8161 cell maintenance) additionally
supplemented with 100 mM E-4HB, 100 mM P-4HB or 0.1% dimethyl sulfoxide
(as vehicle) was added. Dimethyl sulfoxide was used as a cosolvent at 1 ml ml 1
vol/vol. After 24 h, cell-surface expression of ICAM-1 was measured with an
anti-ICAM-1 antibody (clone HA58, BD Pharmingen, San Diego, CA, USA)
at 5 mg ml 1. Mouse IgG2a-UNLB (Southern Biotechnology Associates,
Birmingham, AL, USA) was used as an isotype control at 2.5 mg ml 1, and
Cy-5-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, West
Grove, PA, USA) diluted 1:1000 was used as the secondary antibody. Flow
cytometric data were collected on an LSRII (BD Pharmingen) and analyzed
using FlowJo (Tree Star Inc., Ashland, OR, USA; http://www.flowjo.com/
index.php).
CONFLICT OF INTEREST
The authors declare no conflict of interest.
ACKNOWLEDGEMENTS
This study was supported in part by the National Institute of Health Grant
R01GM065059 (CFB). LJS was supported by The American Cancer Society
Illinois Division—Linda M Campbell Postdoctoral Fellowship.
1 Margolin JF, Friedman JR, Meyer WK, Vissing H, Thiesen HJ, Rauscher 3rd FJ. Kruppelassociated boxes are potent transcriptional repression domains. Proc Natl Acad Sci
USA 1994; 91: 4509–4513.
2 Beerli RR, Barbas 3rd CF. Engineering polydactyl zinc-finger transcription factors.
Nat Biotechnol 2002; 20: 135–141.
3 Jamieson AC, Miller JC, Pabo CO. Drug discovery with engineered zinc-finger proteins.
Nat Rev Drug Discov 2003; 2: 361–368.
4 Beerli RR, Schopfer U, Dreier B, Barbas 3rd CF. Chemically regulated zinc finger
transcription factors. J Biol Chem 2000; 275: 32617–32627.
5 Dent CL, Lau G, Drake EA, Yoon A, Case CC, Gregory PD. Regulation of endogenous
gene expression using small molecule-controlled engineered zinc-finger protein transcription factors. Gene Therapy 2007; 14: 1362–1369.
6 Magnenat L, Schwimmer LJ, Barbas 3rd CF. Drug-inducible and simultaneous
regulation of endogenous genes by single-chain nuclear receptor-based zinc-finger
transcription factor gene switches. Gene Therapy 2008; 15: 1223–1232.
7 Desjarlais JR, Berg JM. Toward rules relating zinc finger protein sequences and DNA
binding site preferences. Proc Natl Acad Sci USA 1992; 89: 7345–7349.
8 Beerli RR, Dreier B, Barbas 3rd CF. Positive and negative regulation of endogenous
genes by designed transcription factors. Proc Natl Acad Sci USA 2000; 97:
1495–1500.
9 Beerli RR, Segal DJ, Dreier B, Barbas 3rd CF. Toward controlling gene expression at will:
specific regulation of the erbB-2/HER-2 promoter by using polydactyl zinc finger
proteins constructed from modular building blocks. Proc Natl Acad Sci USA 1998;
95: 14628–14633.
10 Segal DJ, Dreier B, Beerli RR, Barbas 3rd CF. Toward controlling gene expression
at will: selection and design of zinc finger domains recognizing each of the
5¢-GNN-3¢ DNA target sequences. Proc Natl Acad Sci USA 1999; 96:
2758–2763.
11 Dreier B, Beerli RR, Segal DJ, Flippin JD, Barbas 3rd CF. Development of zinc
finger domains for recognition of the 5¢-ANN-3¢ family of DNA sequences and their
use in the construction of artificial transcription factors. J Biol Chem 2001; 276:
29466–29478.
12 Dreier B, Fuller RP, Segal DJ, Lund CV, Blancafort P, Huber A et al. Development of zinc
finger domains for recognition of the 5¢-CNN-3¢ family DNA sequences and their use
in the construction of artificial transcription factors. J Biol Chem 2005; 280:
35588–35597.
13 Dreier B, Segal DJ, Barbas 3rd CF. Insights into the molecular recognition of the
5¢-GNN-3¢ family of DNA sequences by zinc finger domains. J Mol Biol 2000; 303:
489–502.
14 Liu Q, Xia Z, Zhong X, Case CC. Validated zinc finger protein designs for all 16 GNN
DNA triplet targets. J Biol Chem 2002; 277: 3850–3856.
15 Maeder ML, Thibodeau-Beganny S, Sander JD, Voytas DF, Joung JK. Oligomerized pool
engineering (OPEN): an ‘open-source’ protocol for making customized zinc-finger
arrays. Nat Protoc 2009; 4: 1471–1501.
16 Liu Q, Segal DJ, Ghiara JB, Barbas 3rd CF. Design of polydactyl zinc-finger proteins
for unique addressing within complex genomes. Proc Natl Acad Sci USA 1997; 94:
5525–5530.
17 Nagy L, Schwabe JW. Mechanism of the nuclear receptor molecular switch. Trends
Biochem Sci 2004; 29: 317–324.
18 Sonoda J, Pei L, Evans RM. Nuclear receptors: decoding metabolic disease. FEBS Lett
2008; 582: 2–9.
19 Nishikawa J, Saito K, Sasaki M, Tomigahara Y, Nishihara T. Molecular cloning and
functional characterization of a novel nuclear receptor similar to an embryonic benzoate
receptor BXR. Biochem Biophys Res Commun 2000; 277: 209–215.
20 Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA et al. Pregnane X
receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR)
define three pharmacologically distinct classes of nuclear receptors. Mol Endocrinol
2002; 16: 977–986.
21 Grun F, Venkatesan RN, Tabb MM, Zhou C, Cao J, Hemmati D et al. Benzoate X
receptors alpha and beta are pharmacologically distinct and do not function as
xenobiotic receptors. J Biol Chem 2002; 277: 43691–43697.
22 Soni MG, Carabin IG, Burdock GA. Safety assessment of esters of p-hydroxybenzoic
acid (parabens). Food Chem Toxicol 2005; 43: 985–1015.
23 Kinzel O, Fattori D, Muraglia E, Gallinari P, Nardi MC, Paolini C et al. A structureguided approach to an orthogonal estrogen-receptor-based gene switch activated by
ligands suitable for in vivo studies. J Med Chem 2006; 49: 5404–5407.
24 Schwimmer LJ, Rohatgi P, Azizi B, Seley KL, Doyle DF. Creation and discovery of
ligand-receptor pairs for transcriptional control with small molecules. Proc Natl Acad
Sci USA 2004; 101: 14707–14712.
25 Wu H, Yang WP, Barbas 3rd CF. Building zinc fingers by selection: toward a therapeutic
application. Proc Natl Acad Sci USA 1995; 92: 344–348.
26 Magnenat L, Blancafort P, Barbas 3rd CF. In vivo selection of combinatorial libraries
and designed affinity maturation of polydactyl zinc finger transcription factors
for ICAM-1 provides new insights into gene regulation. J Mol Biol 2004; 341:
635–649.
27 Jahnke A, Van de Stolpe A, Caldenhoven E, Johnson JP. Constitutive expression of
human intercellular adhesion molecule-1 (ICAM-1) is regulated by differentially active
enhancing and silencing elements. Eur J Biochem 1995; 228: 439–446.
28 McKenna NJ, Lanz RB, O’Malley BW. Nuclear receptor coregulators: cellular and
molecular biology. Endocr Rev 1999; 20: 321–344.
Supplementary Information accompanies the paper on Gene Therapy website (http://www.nature.com/gt)
Gene Therapy