Impaired Striatal Akt Signaling Disrupts Dopamine
Homeostasis and Increases Feeding
The MIT Faculty has made this article openly available. Please share
how this access benefits you. Your story matters.
Citation
Bonocora, R. P. et al. “A Homing Endonuclease and the 50-nt
Ribosomal Bypass Sequence of Phage T4 Constitute a Mobile
DNA Cassette.” Proceedings of the National Academy of
Sciences 108.39 (2011): 16351–16356. Web. 13 Apr. 2012.
As Published
http://dx.doi.org/10.1073/pnas.1107633108
Publisher
Proceedings of the National Academy of Sciences (PNAS)
Version
Final published version
Accessed
Thu May 26 23:52:26 EDT 2016
Citable Link
http://hdl.handle.net/1721.1/70026
Terms of Use
Article is made available in accordance with the publisher's policy
and may be subject to US copyright law. Please refer to the
publisher's site for terms of use.
Detailed Terms
A homing endonuclease and the 50-nt ribosomal
bypass sequence of phage T4 constitute
a mobile DNA cassette
Richard P. Bonocora1, Qinglu Zeng1,2, Ethan V. Abel3, and David A. Shub4
Department of Biological Sciences, University at Albany, State University of New York, Albany, NY 12222
Edited* by Marlene Belfort, Wadsworth Center, Albany, NY, and approved August 23, 2011 (received for review May 25, 2011)
|
|
bacteriophage gene structure group I intron horizontal gene transfer
ribosomal frameshifting mobile genetic element
|
I
|
n most of the phages of the T4 superfamily, the large subunit of
DNA topoisomerase is a single polypeptide encoded by gene
39. However, in phage T4 this gene is disrupted by a 1-kb insertion, creating a truncated gene 39 plus a new gene (gene 60)
that encodes the remainder of the topoisomerase subunit (1, 2)
(Fig. 1). Furthermore, the C terminus of the truncated gene 39
and the N terminus of the newly created gene 60 each contain
additional amino acid residues (43 and 30, respectively) that
were not present in the original gene 39 homologs. These two
independently translated proteins interact with the small subunit
(encoded by gene 52) to create an enzymatically active topoisomerase (4). A second, 50-nt insertion beginning with an inphase stop codon, is inserted into the newly created downstream
gene 60 (2). Instead of terminating at this stop codon, approximately half of the ribosomes skip 50 nucleotides and continue
translation in a new reading frame (5). Features involved in this
remarkable process include: the stop codon, the codon at which
translation resumes, a portion of the pre-hop nascent peptide,
a stem-loop at the start of the bypassed sequence, a Shine/Dalgarno-like sequence within the bypassed RNA, and the structure
of the bypassed mRNA (5–8).
The genome sequence of phage T4 (GenBank accession no.
NC_000866) indicated that the insertion into gene 39 contains
two ORFs: an apparent H-N-H homing endonuclease pseudogene (mobA), whose inferred translation product terminates after only 37 codons (Fig. 2), and gene 60.1, which overlaps the
start of gene 60 and encodes a basic protein of 126 amino acids
www.pnas.org/cgi/doi/10.1073/pnas.1107633108
with no relatives in the databases. Interestingly, a screen of independently isolated phages related to T4 revealed several (5/37)
having the same architecture in their large subunit topoisomerase
genes. Although DNA sequences of the ∼1-kb insertions were
not provided, each newly created gene 60 contained a ribosome
bypass sequence identical to that of T4 (9, 10).
Results and Discussion
MobA Is a Site-Specific Endonuclease That Nicks T2 DNA Close to the
Insertion Site of the T4 Bypass Sequence. Thinking that one of the
insertions initially identified by Repoila et al. (9) might encode
an intact mobA gene, we sequenced the PCR products of the
gene 39/60 regions of two of them (phages Pol and SKX, provided by Henry Krisch, Laboratory of Microbiology and Molecular Genetics, CNRS, Toulouse, France) and resequenced this
region from phage T4. Surprisingly, the insertions in all three
phages are almost identical, encoding a single ORF of 271 amino
acids (including both the mobA H-N-H domain and g60.1) that is
highly similar to the other phage T4 H-N-H family homing
endonucleases† (Fig. 2). The SKX and Pol mobA sequences are
identical; the only differences from the T4 sequence are a synonymous G-to-A third position substitution in codon 156 and an
A-to-G substitution at the second position of codon 169, changing threonine to alanine.
Free-standing homing endonucleases (i.e., those not encoded
within a group I intron or intein) cleave the DNA of close relatives
lacking the endonuclease gene, usually in a gene adjacent to
the site of endonuclease gene insertion (12–14), and are copied
into the recipient genome via recombination-mediated DNA repair, a process that has been called “homing” (for recent reviews,
see refs. 14 and 15). Therefore, we tested the protein product of
the mobA gene for endonuclease activity on DNA from phage T2,
which has an uninterrupted gene 39.
The mobA gene of phage T4 was expressed in vitro using cellfree extracts and also in vivo by induction of plasmid expression
vector pMobA. Incubation of either protein preparation with a
Author contributions: R.P.B., Q.Z., and D.A.S. designed research; R.P.B. and Q.Z. performed research; E.V.A. contributed new reagents/analytic tools; R.P.B., Q.Z., and D.A.S.
analyzed data; and R.P.B., Q.Z., and D.A.S. wrote the paper.
The authors declare no conflict of interest.
*This Direct Submission article had a prearranged editor.
1
R.P.B. and Q.Z. contributed equally to this work.
2
Present address: Civil and Environmental Engineering, Massachusetts Institute of Technology, 15 Vassar Street, Cambridge, MA 02139.
3
Present address: Thomas Jefferson University, 233 South 10th St., Philadelphia, PA 19107.
4
To whom correspondence should be addressed. E-mail: shub@albany.edu.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1107633108/-/DCSupplemental.
†
After this work was completed, the phage T4 genomic sequence was redetermined
(accession no. HM_137666) with mobA sequence identical to that presented here (11).
The inaccuracies in accession NC_000866 were undoubtedly due to the common practice
at that time of cloning genes in unregulated plasmids before sequencing. Genes like
mobA, whose products are highly toxic to E. coli, were likely to have suffered inactivating
mutations at the cloning step.
PNAS | September 27, 2011 | vol. 108 | no. 39 | 16351–16356
GENETICS
Since its initial description more than two decades ago, the
ribosome bypass (or “hop”) sequence of phage T4 stands out as
a uniquely extreme example of programmed translational frameshifting. The gene for a DNA topoisomerase subunit of T4 has
been split by a 1-kb insertion into two genes that retain topoisomerase function. A second 50-nt insertion, beginning with an inphase stop codon, is inserted near the start of the newly created
downstream gene 60. Instead of terminating at this stop codon,
approximately half of the ribosomes skip 50 nucleotides and continue translation in a new reading frame. However, no functions,
regulatory or otherwise, have been imputed for the truncated
peptide that results from termination at codon 46 or for the bypass sequence itself. Moreover, how this unusual mRNA organization arose and why it is maintained have never been explained.
We show here that a homing endonuclease (MobA) is encoded in
the insertion that created gene 60, and the mobA gene together
with the bypass sequence constitute a mobile DNA cassette. The
bypass sequence provides protection against self-cleavage by the
nuclease, whereas the nuclease promotes horizontal spread of the
entire cassette to related bacteriophages. Group I introns frequently provide protection against self-cleavage by associated
homing endonucleases. We present a scenario by which the bypass sequence, which is otherwise a unique genetic element,
might have been derived from a degenerate group I intron.
Fig. 1. Insertions in the phage T4 genes for the large subunit of topoisomerase II. (A) The parts of the T4 sequence that are homologous to phage T2 gene 39
are shown as open boxes. The carboxyl-terminal 43 amino acids of T4 gene 39 and the amino-terminal 30 amino acids of gene 60 are contributed by the
insertion (gray bars), and the presumed mobA homing endonuclease pseudogene and gene 60.1 are depicted as a black bar. An early phage transcription
start site (PE), start and stop codons, and Shine/Dalgarno (S/D) sequences are indicated. The 50-nt untranslated bypass or Hop sequence (solid line) inserted
after codon 46 of gene 60 begins with an in-frame stop codon. The schematic is not drawn to scale. (B) Amino acid sequences surrounding sites of insertion.
The position of the 1-kb insertion containing mobA is indicated by an open triangle, with the number of additional amino acid residues added to the end of
truncated gene 39 and the beginning of newly created gene 60 indicated in brackets. The insertion of the 50-bp bypass sequence is indicated by a solid
triangle, with an asterisk showing positions of conserved active site residues. Homologous sequences from other members of the T4 superfamily and Saccharomyces cerevisiae are shown for comparison. Sequences were aligned with ClustalW1.8 (3). Identities and similarities of amino acid residues are outlined
with Boxshade using default parameters (http://sourceforge.net/projects/boxshade/).
PCR-amplified region of T2 gene 39 generated a specific nick on
the template (bottom) strand (Figs. 3 and 4B), but the proteins
were inactive on the homologous T4 sequence (Fig. 4B). Introduction of a UAG stop codon at Tyr195 (Fig. 2) abolished
activity (Fig. 3). To confirm that this activity was indeed encoded
in T4 (and not in some other phage contaminant), we used DNA
from a mutant T4 phage in our collection that has a deletion
(saΔ9) (16) located distantly from the g39/60 locus as template
for in vitro protein synthesis. This protein product displayed
similar nuclease activity on T2 DNA as when our wild-type T4
DNA was used to program the reaction (Fig. 3). Nucleotide resolution mapping of the cleavage position showed that MobA
cleaves T2 DNA 19 bp upstream of the insertion site of the bypass
sequence in T4 gene 60 (Fig. 4 A and C).
Function of the Bypass Sequence Is Prevention of Self-Cleavage by
MobA. The close association of the cleavage site and the bypass
insertion site suggested that the bypass sequence might play
Fig. 2. Alignment of H-N-H family endonucleases of phage T4. Sequence of MobA (old) is as reported in accession no. NC_000866. All other sequences are as
reported in T4 genomic sequence accession no. HM_137666. The beginning of putative gene product 60.1, within the MobA reading frame, is indicated by an open
triangle. The location of the tyrosine to amber nonsense mutation at codon 195 is indicated by an asterisk. Alignment and shading were performed as in Fig. 1.
16352 | www.pnas.org/cgi/doi/10.1073/pnas.1107633108
Bonocora et al.
Fig. 3. Activity of in vitro-synthesized MobA protein. Substrate DNA was
made by PCR of T2 gene 39 DNA with only one primer labeled at its 5′ end in
each reaction. Template DNAs for the in vitro transcription were wild type
T4 (wt), a mutant T4 strain with a deletion distant from the mobA gene
(saΔ9), and T4 containing a tyrosine-to-amber nonsense mutation at codon
195 of mobA (Y195am) (Fig. 2). Control reactions were either in vitro protein
synthesis reactions carried out without addition of template DNA (Mock) or
with no protein synthesis reaction added (NP) in the endonuclease assay.
Positions of end-labeled DNA size standards (in kb) are on the left.
a role in protecting the T4 genome from self-cleavage by MobA.
However, in addition to the bypass, there are 13 individual basepair differences between T2 and T4 in this region that might
account for the cleavage specificity (17) (Fig. 4C).
To establish whether protection against self-cleavage was
provided by these sequence polymorphisms, the bypass sequence,
or by both, target DNA sequences were constructed whereby
the bypass was removed from the T4 sequence or inserted into the
corresponding T2 sequence. Cleavage occurred in both phage
sequences lacking the bypass but was prevented by the presence
of the bypass (Fig. 4B), demonstrating that the bypass sequence
is both necessary and sufficient for protection against cleavage by MobA.
Hop, Skip, and Jump: MobA Mobilizes the Bypass Sequence for
Horizontal Gene Transfer. These properties of MobA and the ex-
istence of virtually identical 1-kb insertions in phages T4, Pol,
and SKX suggest that mobA and the gene 60 bypass might
function together as a nuclease-activated mobile genetic element.
Unregulated expression of MobA is lethal to Escherichia coli (our
early attempts to clone wild-type mobA failed, yielding only
mutant sequences until the tightly regulated expression plasmid
pBAD was used, generating plasmid pMobA). Therefore, to
demonstrate horizontal transfer to phage T2, we used a twoplasmid system (18). The donor plasmid was pT4(39–60ΔmobA)
(the T4 gene 39/60 locus, with codons 15–132 of mobA deleted)
and wild-type MobA was provided by induction of plasmid
pMobA. Screening of progeny from infected cells for the bypass
sequence by plaque hybridization revealed that it is nearly universally present when MobA is supplied in trans (Table 1 and Fig.
S1), and hybridization with a probe that is specific for mobA
showed that all phage that received the bypass sequence also
received the truncated mobA gene from the donor plasmid (Fig.
Bonocora et al.
Origin of the Bypass Sequence. The results presented here provide
an explanation for the function (prevention of self-cleavage by
MobA) and persistence (spread by horizontal gene transfer) of
the ribosome bypass sequence. However, we still have no convincing evidence for how this remarkable element came to be
inserted into gene 60 in the first place. Although programmed
translational frameshifts of one or a few nucleotides have been
repeatedly encountered in bacteria and eukaryotes, nothing remotely close to the 50-nt ribosomal hop in T4 gene 60 has been
substantiated in any other biological system (20). One possible
scenario, consistent with the rarity of bypassing, is suggested by
similarities of this system to the recently described phenomenon
of “collaborative homing” of homing endonucleases and group I
introns (13).
Intron-encoded homing endonucleases are protected from
cleaving their own genomes by disruption of the DNA-binding/
cleavage site by the intron (15) (Fig. 5A), whereas most intronless (or free-standing) homing enzymes have sequence polymorphisms at their target sites that prevent cleavage (17) (Fig.
5B). In collaborative homing, an intron (lacking its own homing
endonuclease gene) is inserted into the target sequence of a freestanding homing endonuclease, thereby preventing self-cleavage
by the enzyme (13) (Fig. 5C). When a related sensitive DNA
sequence is cleaved, both the intron and endonuclease gene are
incorporated into the recipient during recombination-dependent
DNA repair. The relationship between mobA and the bypass
sequence appears to be a variation of the collaborative homing
theme (Fig. 5D), which raises the interesting possibility that the
bypass may once have been a functional group I intron.
Despite the lack of sequence relatedness between the bypass
sequence and any known intron, there are suggestive similarities
in their structures and insertion sites. Like the bypass sequence,
the 5′ ends of many bacteriophage introns begin with an in-frame
stop codon, which is part of the base-paired stem (P1) with which
all group I introns begin (21, 22). Furthermore, like the insertion
sites of most group I introns (12, 23–25), the bypass sequence is
inserted into a highly conserved sequence of an essential protein,
the Mg2+-binding region at the active site of type II topoisomerases (26) (Fig. 1B).
These considerations, together with the results presented here,
lead us to propose the following hypothesis as a plausible scenario for origin of the bypass. It is possible that the bypass sequence was derived from a group I intron that engaged in
collaborative homing with free-standing endonuclease MobA.
The intron may have suffered a large deletion that prevented
splicing but, adventitiously, the conformation of the remaining
RNA (8) may have permitted ribosomal bypassing. Unlike most
other “essential” T4 genes, conditional lethal mutations in gene
39 still allow a significant yield of progeny phage under nonpermissive conditions (27). So, despite the negative selection
PNAS | September 27, 2011 | vol. 108 | no. 39 | 16353
GENETICS
S2). The amount of MobA protein required for this extremely
high frequency of transfer is remarkably small because optimal
levels were achieved in the absence of induction of the tightly
regulated expression plasmid (Table 1). When cells contained the
empty expression vector pBAD, or the same plasmid expressing
the unrelated homing endonuclease F-CphI (13) instead of
pMobA, the bypass is transferred to fewer than 2% of the
progeny phage (Table 1 and Fig. S1), a frequency consistent with
homologous recombination between the gene 39/60 sequences on
the phage and the donor plasmid.
Although models for homing invoke unidirectional gene conversion (with coconversion of flanking DNA) resulting from repair of double-strand breaks in DNA, the homing activity of
nicking endonuclease MobA is not surprising. Although the
mechanism remains to be elucidated, other nicking endonucleases of the H-N-H family have been shown to trigger highly
efficient homing events (19).
Fig. 4. MobA cleavage of phage DNA depends on the absence of the bypass sequence. (A) Determination of the cleavage site of MobA on T2 gene 39 DNA.
Substrate DNA amplified with end-labeled bottom strand primer: (+) digested or (−) undigested with in vitro-synthesized MobA. The same end-labeled
oligonucleotide was used to prime dideoxy sequencing reactions on cloned T2 DNA. All samples were subjected to electrophoresis in the same polyacrylamide gel. Sequence and position of cleavage (arrow) are shown on the left. (B) DNAs were amplified by PCR from plasmid templates, with either the
top (Top) or bottom (Bot) strand primer end-labeled with 32P. Amplified DNA was digested (+) or not digested (−) with MobA and subjected to denaturing
gel electrophoresis next to molecular size markers (M). Target DNAs were from wild type T2 and T4, T4 with the bypass sequence deleted (T4Δhop), and T2
with the bypass sequence inserted (T2hop). (C) The DNA sequence of a portion of T2 gene 39 is shown, with the position of cleavage (CS) by MobA on the
bottom strand indicated by an arrow. The coding strand of the homologous region of T4 gene 60 is shown above, with the position of insertion of the 50-nt
bypass sequence (HOP) indicated by an arrow. Sequence differences are shown in boldface type. The translated amino acid sequence is shown above the
nucleotide sequence.
implied by reduced translation efficiency, the bypass could have
been maintained because of its essential relationship with mobA,
with continued selection favoring increased efficiency of ribosome hopping. In this context, it is interesting to note that a
portion of the nascent gp60 peptide chain upstream of the bypass
sequence, which is required for efficient ribosome hopping (6, 7),
is not homologous to a segment of the original gene 39, but is
contributed as part of the 1-kb insertion that includes mobA
(Fig. 1A).
mobA is one example of a homing endonuclease-like gene that
disrupts the coding sequence of an essential gene without
destroying its function (1), and two other examples have recently
been described in phages belonging to the T4 superfamily. In one
case, a GIY-YIG family endonuclease gene disrupts DNA polymerase (28, 29); in the other case, a H-N-H family endonuclease
gene disrupts the large subunit of ribonucleotide reductase (30).
In all three cases, the products of the split genes reunite to form
enzymatically active proteins. In the ribonucleotide reductase
case, this requires peptide sequences that had been added to the
ends of the split proteins at the site of the endonuclease gene
insertion (31). The C terminus of T4 gp39 and the N terminus of
gp60 also have extensive amino acid sequences (43 and 30 residues, respectively) that are absent in the intact homologs
(Fig. 1B), and it has been suggested (31) that these may also play
a role in assembly of the split proteins into an active enzyme.
Table 1. Homing frequency
% L-arabinose
Expression plasmid*
pMobA
pF-CphI
pBAD
Experiment
0
0.00002
0.0002
0.002
1
2
1
2
1
2
97
88
1
0
2
0
99
98
0
0
1
0
94
92
2
1
2
2
56
54
0
0
0
1
T2 progeny plaques (of 100 picked) that hybridize to the bypass sequence
probe MobA25.
*Cells also contain the donor plasmid pT4 (39-60ΔmobA).
16354 | www.pnas.org/cgi/doi/10.1073/pnas.1107633108
Fig. 5. Modes of protection against self-cleavage by homing endonucleases. (A) Homing endonuclease gene (HEG) encoded within a group I
intron. The intron interrupts the sensitive binding/cleavage site (○). (B) HEG
inserted intercistronically, resistance due to sequence differences at the
binding/cleavage site ( ). (C) HEG inserted intercistronically. Resistance is
due to group I intron inserted into sensitive binding/cleavage site. (D) mobA
inserted within an ancestral gene 39. Resistance is due to insertion of bypass
sequence (Hop) within the sensitive binding/cleavage site. Group I introns,
dark bars; homing endonuclease genes, shaded boxes; target genes without
insertions, clear boxes; intergenic spaces, thin lines.
•
Bonocora et al.
Materials and Methods
Oligonucleotides. Restriction sites are underlined in the sequences
listed below.
ym001: AAATTAATACGACTCACTATAGGGATCCAAGCCATAGGGAGGACATATGAATTACGAAAAAATCTATAATGA (noncoding sequence containing a T7 promoter and ribosome binding site is in italics);
ym003: GAGGATTTAATAGAACGACGAACATT;
M13Fwd: TGTAAAACGACGGCCAGT;
M13Rev: CAGGAAACAGCTATGACC;
EVA7: GGGTCATGAATTACGAAAAAATCTATAATGACTTAA;
EVA8: CCCGAATTCTTATATTTTTTCATATCAACGCTAGAAGAA;
g39.5: CCCGAAACCAAACGAGGATAAGTCATGA;
T2T4-3: AAAACTGCAGAGATTTTTCCAAAGAGCCAAGTCC;
T4dhop1: TCTGCGAGCTCATTGATTCTTCTAGCGTTGATATGAA;
T4dhop2:TCCGAGCAGAGAAGGATAAATAGAACCTAATCCATCGTGATCTGCGTCTGTC;
T4dhop4:GCTATTATGACAGACGCAGATCACGATGGATTAGGTTCTATTTATCCTTCTCTGC;
T2hop1: TCTGCGAGCTCGATATTTGCGCAATCACTGGTCTA;
T2hop2: TCCAATAATCTCTTAATTATGAGGTATTTCTATAGATAGCCCGAAGGCTAACCATCATGGTCAGCATCAGTCA (50-nt bypass sequence is in italics);
T2hop4: TAGCCTTCGGGCTATCTATAGAAATACCTCATAATTAAGAGATTATTGGACTAGGAAGCATTTATCCTTCTCTG (50-nt bypass sequence is in italics);
MobA6: GCTCTAGAAAGGTCAGCATTATCTCCCATGAGCAT;
MobA7: TATATAGGATCCCCGCACTATTAAGTCATTATAGAT;
MobA8: TATATAGGATCCAAGGAATGGTGCGGTGTTAATAAAG;
MobA10: TGAGCGGGATCCACAGGAGTTTTGACAAAGCGAATT;
MobA11: TTCTTTGGATCCCTGAGGGTGATTCGGCTATCG;
MobA24: GTGAATTACGAAAAAATCTATAATGAC; and
MobA25: TTCGGGCTATCTATAGAAATACCTCA.
Plasmid Construction. For expression of MobA, T4 mobA was amplified by PCR
with KOD HiFi DNA polymerase (Novagen) using primers EVA7 and EVA8,
digested with PagI and EcoRI and ligated into similarly digested pBAD/MycHisA vector (Invitrogen) to create pMobA. The 50-bp ribosomal bypass from
phage T4 was inserted into a fragment of T2 gene 39 by the SOEing PCR
method (33) with KOD HiFi DNA polymerase using primers T2T4-3, T2hop4,
T2hop2, and T2hop1. The product was digested with PstI and SacI and ligated into pBSM13+ (Stratagene) to generate pT2hop. pT4dhop, which has
the ribosomal bypass sequence removed from a fragment of the T4 gene 60,
was created in a similar fashion using primers T2T4-3, T4dhop4, T4dhop2,
and T4dhop1.
Plasmid pMobATS#4 was constructed by amplification of the T2 gene 39
with primers MobA10 and MobA11 and cloned in pBSM13+. pT4(39–
60ΔmobA) was constructed as the donor plasmid for homing experiments. It
contains all of gene 39 and all but the last seven codons of gene 60 of phage
T4, to provide sequence homology for recombination with phage T2. To
prevent the lethality that accompanies its uncontrolled expression, the
plasmid also contains an in-frame deletion of mobA lacking codons 15–132:
T4 gene 39 to codon 14 of mobA was amplified with primers g39.5 and
1. Huang WM, Wei LS, Casjens S (1985) Relationship between bacteriophage T4 and T6
DNA topoisomerases. T6 39-protein subunit is equivalent to the combined T4 39- and
60-protein subunits. J Biol Chem 260:8973–8977.
2. Huang WM, et al. (1988) A persistent untranslated sequence within bacteriophage T4
DNA topoisomerase gene 60. Science 239:1005–1012.
3. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: Improving the sensitivity of
progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680.
4. Seasholtz AF, Greenberg GR (1983) Identification of bacteriophage T4 gene 60
product and a role for this protein in DNA topoisomerase. J Biol Chem 258:
1221–1226.
5. Maldonado R, Herr AJ (1998) Efficiency of T4 gene 60 translational bypassing. J
Bacteriol 180:1822–1830.
6. Weiss RB, Huang WM, Dunn DM (1990) A nascent peptide is required for ribosomal
bypass of the coding gap in bacteriophage T4 gene 60. Cell 62:117–126.
Bonocora et al.
MobA7, and amplification from codon 133 of mobA to codon 153 of gene 60
was with primers MobA8 and MobA6. These products were digested with
BamHI and ligated, and the purified product was digested with PagI and
XbaI and ligated into similarly digested pACYC184.
In Vitro Expression of MobA Protein. Templates for in vitro protein synthesis
were obtained by PCR amplification of T4 mobA with Taq DNA polymerase
(Fermentas), according to the manufacturer’s specifications, using primers
ym001 and ym003. The purified product was used to direct MobA expression
in vitro with TNT Quick Coupled Transcription/Translation Systems (Promega) as specified by the manufacturer.
In Vivo Expression of MobA Under Induction by L-Arabinose. A culture of E. coli
LMG194 (Invitrogen) containing pMobA was grown to OD600 = 0.5 in RM
medium (1× M9 Salts, 2% Casamino Acids (Difco), 0.2% glucose, 1 mM
MgCl2) containing 100 μg/mL ampicillin, induced by adding L-arabinose to
a final concentration of 0.02% at 37 °C for 5 h. Cells were harvested by
centrifugation at 6,000 × g for 20 min, resuspended in equal volume ice-cold
lysis mixture (50 mM Tris·HCl, pH 7.2, 1 mM EDTA, 1 mM PMSF, 2 μg/mL
leupeptin, and 200 mM KCl), sonicated to complete lysis and used directly in
endonuclease assays.
Generation of DNA Substrates. Individually 5′ end-labeled targets were
generated by 5′ end labeling (with γ[32P]ATP and T4 polynucleotide kinase)
one of the oligonucleotides before use in PCR together with an unlabeled
primer partner (34). PCR was performed with Taq DNA polymerase as
described above.
Endonuclease Assays. Endonuclease assay reactions (10 μL) containing 2 μL
crude cell extract and 4 μL DNA substrate were incubated at 30 °C for 30 min
in 0.05 M NaCl, 0.05 M Tris (pH 7.5), and 0.5 μg poly(dI-dC). Reaction products
were extracted with an equal volume of phenol before separation on a 4%
denaturing polyacrylamide gel.
Cleavage Site Mapping. The location of the MobA cleavage site was mapped,
as previously described (34), on the bottom strand of the T2 gene 39 using
substrate amplified from pMobATS#4 with labeled M13Fwd primer and
unlabeled M13Rev primer. PCR amplification, 5′ end labeling, and endonuclease assay conditions were the same as described above. Cleavage products
were separated by electrophoresis on 4% denaturing polyacrylamide gel
next to sequencing ladders generated using the same template DNA and
labeled primers.
Plasmid to Phage Homing. Plasmid-to-phage homing assays were performed as
described by Quirk et al. (18). Briefly, E. coli LMG194 cells harboring plasmids
pT4(39–60ΔmobA) (donor) and either pMobA, pF-CphI, (35) or pBAD/MycHisA (the empty expression plasmid) were induced with increasing concentrations of L-arabinose on H agar plates at 30 °C for 2 h. Serial dilutions of T2
phage were spotted onto the plates and incubated overnight at 30 °C. The
dilution that had almost cleared was scraped off, mixed with 1 mL buffered
saline, shaken at 37 °C for 1 h, and diluted for single plaques on H plates.
Plaques were transferred to a gridded lawn, and homing products were
detected by plaque hybridization (17) using oligos MobA25 for the bypass
sequence and MobA24 for the truncated mobA gene.
ACKNOWLEDGMENTS. This work was supported by the Northeast Biodefense Center through National Institutes of Health Grant U54-AI057158 and
by a research development award from the College of Arts and Sciences,
University at Albany.
7. Herr AJ, Nelson CC, Wills NM, Gesteland RF, Atkins JF (2001) Analysis of the roles of
tRNA structure, ribosomal protein L9, and the bacteriophage T4 gene 60 bypassing
signals during ribosome slippage on mRNA. J Mol Biol 309:1029–1048.
8. Wills NM, et al. (2008) Translational bypassing without peptidyl-tRNA anticodon
scanning of coding gap mRNA. EMBO J 27:2533–2544.
9. Repoila F, Tétart F, Bouet JY, Krisch HM (1994) Genomic polymorphism in the T-even
bacteriophages. EMBO J 13:4181–4192.
10. F. Repoila (1995) Etude du Polymorphisme Genomique Chez les Bacteriophages
T-pair. PhD thesis (Paul Sabatier University, Toulouse, France).
11. Petrov VM, Ratnayaka S, Nolan JM, Miller ES, Karam JD (2010) Genomes of the T4related bacteriophages as windows on microbial genome evolution. Virol J 7:292.
12. Bonocora RP, Shub DA (2009) A likely pathway for formation of mobile group I introns. Curr Biol 19:223–228.
13. Zeng Q, Bonocora RP, Shub DA (2009) A free-standing homing endonuclease targets
an intron insertion site in the psbA gene of cyanophages. Curr Biol 19:218–222.
PNAS | September 27, 2011 | vol. 108 | no. 39 | 16355
GENETICS
We have shown here that mobA can be spread by horizontal
transmission, and it is likely that other similar constructs will also
be shown to practice homing. Recent metagenomic analysis of
environmental DNA samples has yielded additional examples of
genes split by insertion of putative homing endonucleases (32),
indicating that the infectious splitting of essential proteins may be
a more common phenomenon than previously thought.
14. Edgell DR, Gibb EA, Belfort M (2010) Mobile DNA elements in T4 and related phages.
Virol J 7:290.
15. Raghavan R, Minnick MF (2009) Group I introns and inteins: Disparate origins but
convergent parasitic strategies. J Bacteriol 191:6193–6202.
16. Depew RE, Snopek TJ, Cozzarelli NR (1975) Characterization of a new class of deletions of the D region of the bacteriophage T4 genome. Virology 64:144–145.
17. Belle A, Landthaler M, Shub DA (2002) Intronless homing: Site-specific endonuclease
SegF of bacteriophage T4 mediates localized marker exclusion analogous to homing
endonucleases of group I introns. Genes Dev 16:351–362.
18. Quirk SM, Bell-Pedersen D, Belfort M (1989) Intron mobility in the T-even phages:
High frequency inheritance of group I introns promoted by intron open reading
frames. Cell 56:455–465.
19. Landthaler M, Lau NC, Shub DA (2004) Group I intron homing in Bacillus phages SPO1
and SP82: A gene conversion event initiated by a nicking homing endonuclease. J
Bacteriol 186:4307–4314.
20. Baranov PV, Fayet O, Hendrix RW, Atkins JF (2006) Recoding in bacteriophages and
bacterial IS elements. Trends Genet 22:174–181.
21. Michel F, Westhof E (1990) Modelling of the three-dimensional architecture of group
I catalytic introns based on comparative sequence analysis. J Mol Biol 216:585–610.
22. Shub DA, et al. (1988) Structural conservation among three homologous introns of
bacteriophage T4 and the group I introns of eukaryotes. Proc Natl Acad Sci USA 85:
1151–1155.
23. Landthaler M, Begley U, Lau NC, Shub DA (2002) Two self-splicing group I introns in
the ribonucleotide reductase large subunit gene of Staphylococcus aureus phage
Twort. Nucleic Acids Res 30:1935–1943.
24. Lazarevic V (2001) Ribonucleotide reductase genes of Bacillus prophages: A refuge to
introns and intein coding sequences. Nucleic Acids Res 29:3212–3218.
16356 | www.pnas.org/cgi/doi/10.1073/pnas.1107633108
25. Swithers KS, Senejani AG, Fournier GP, Gogarten JP (2009) Conservation of intron and
intein insertion sites: Implications for life histories of parasitic genetic elements. BMC
Evol Biol 9:303.
26. Marchler-Bauer A, et al. (2009) CDD: Specific functional annotation with the Conserved Domain Database. Nucleic Acids Res 37(Database issue):D205–D210.
27. Epstein RH, et al. (1963) Physiological studies of conditional lethal mutants of bacteriophage T4D. Cold Spring Harb Symp Quant Biol 28:375–392.
28. Petrov VM, et al. (2006) Plasticity of the gene functions for DNA replication in the T4like phages. J Mol Biol 361:46–68.
29. Petrov VM, Ratnayaka S, Karam JD (2010) Genetic insertions and diversification of the
PolB-type DNA polymerase (gp43) of T4-related phages. J Mol Biol 395:457–474.
30. Friedrich NC, et al. (2007) Insertion of a homing endonuclease creates a genes-inpieces ribonucleotide reductase that retains function. Proc Natl Acad Sci USA 104:
6176–6181.
31. Crona M, et al. (2011) Assembly of a fragmented ribonucleotide reductase by protein
interaction domains derived from a mobile genetic element. Nucleic Acids Res 39:
1381–1389.
32. Dassa B, London N, Stoddard BL, Schueler-Furman O, Pietrokovski S (2009) Fractured
genes: A novel genomic arrangement involving new split inteins and a new homing
endonuclease family. Nucleic Acids Res 37:2560–2573.
33. Horton RM, Cai ZL, Ho SN, Pease LR (1990) Gene splicing by overlap extension: Tailormade genes using the polymerase chain reaction. Biotechniques 8:528–535.
34. Bonocora RP, Shub DA (2001) A novel group I intron-encoded endonuclease specific
for the anticodon region of tRNA(fMet) genes. Mol Microbiol 39:1299–1306.
35. Zeng Q (2008) Collaborative homing directed by site-specific endonucleases in bacteriophages. PhD thesis (University at Albany, State University of New York, Albany,
NY).
Bonocora et al.