Genes affecting novel seed constituents in Limnanthes alba Benth:
transcriptome analysis of developing embryos and a new genetic map
of meadowfoam
Slabaugh, M. B., Cooper, L. D., Kishore, V. K., Knapp, S. J., & Kling, J. G. (2015).
Genes affecting novel seed constituents in Limnanthes alba Benth: transcriptome
analysis of developing embryos and a new genetic map of meadowfoam. PeerJ,
3, e915. doi:10.7717/peerj.915
10.7717/peerj.915
PeerJ
Version of Record
http://cdss.library.oregonstate.edu/sa-termsofuse
Genes affecting novel seed constituents in
Limnanthes alba Benth: transcriptome
analysis of developing embryos and a
new genetic map of meadowfoam
Mary B. Slabaugh1 , Laurel D. Cooper1,2 , Venkata K. Kishore3 ,
Steven J. Knapp4 and Jennifer G. Kling1
1 Department of Crop and Soil Science, Oregon State University, Corvallis, OR,
United States of America
2 Department of Botany and Plant Pathology, Oregon State University, Corvallis OR,
United States of America
3 Monsanto Company, Bengaluru Area, India
4 Department of Plant Sciences, University of California-Davis, Davis, CA,
United States of America
ABSTRACT
Submitted 21 February 2015
Accepted 6 April 2015
Published 19 May 2015
Corresponding author
Mary B. Slabaugh,
mary.b.slabaugh@oregonstate.edu
Academic editor
Susan Gibson
Additional Information and
Declarations can be found on
page 16
The seed oil of meadowfoam, a new crop in the Limnanthaceae family, is highly
enriched in very long chain fatty acids that are desaturated at the Δ5 position.
The unusual oil is desirable for cosmetics and innovative industrial applications
and the seed meal remaining after oil extraction contains glucolimnanthin, a
methoxylated benzylglucosinolate whose degradation products are herbicidal and
anti-microbial. Here we describe EST analysis of the developing seed transcriptome
that identified major genes involved in biosynthesis and assembly of the seed oil and
in glucosinolate metabolic pathways. mRNAs encoding acyl-CoA Δ5 desaturase
were notably abundant. The library was searched for simple sequence repeats
(SSRs) and single nucleotide polymorphisms (SNPs). Fifty-four new SSR markers
and eight candidate gene markers were developed and combined with previously
developed SSRs to construct a new genetic map for Limnanthes alba. Mapped
genes in the lipid biosynthetic pathway encode 3-ketoacyl-CoA synthase (KCS), Δ5
desaturase (Δ5DS), lysophosphatidylacyl-acyl transferase (LPAT), and acyl-CoA
diacylglycerol acyl transferase (DGAT). Mapped genes in glucosinolate biosynthetic
and degradation pathways encode CYP79A, myrosinase (TGG), and epithiospecifier
modifier protein (ESM). The resources developed in this study will further the
domestication and improvement of meadowfoam as an oilseed crop.
Subjects Agricultural Science, Genetics, Plant Science
Keywords Meadowfoam, Desaturase, KCS, LPAT, Glucolimnanthin, Limnanthes
DOI 10.7717/peerj.915
Copyright
2015 Slabaugh et al.
Distributed under
Creative Commons CC-BY 4.0
OPEN ACCESS
INTRODUCTION
Meadowfoam (Limnanthes sp.) is an herbaceous winter annual native to the West Coast
of North America (Mason, 1952). The seed oil is distinctive due to a high content of C20
and C22 fatty acids with Δ5 desaturation (Miller et al., 1964), first characterized in a
systematic USDA survey (Earle et al., 1960). Unusual plant fatty acids (FAs) are widespread
How to cite this article Slabaugh et al. (2015), Genes affecting novel seed constituents in Limnanthes alba Benth: transcriptome analysis
of developing embryos and a new genetic map of meadowfoam. PeerJ 3:e915; DOI 10.7717/peerj.915
with more than 300 examples now documented in various species (Aitzetmuller, Matthaus
& Friedrich, 2003). Many of these have potential nutritional uses or novel commercial
and industrial uses as renewable sources of raw materials. The synthesis of unusual FAs
is restricted to developing seed tissues and they accumulate, often to high levels, in seed
storage lipid as triacylglycerol (TAG) (Napier, 2007).
The exceptional oxidative stability and lubricity of meadowfoam oil is attributed in part
to the proximity of the double bond and the FA carboxy terminus. These properties make
it desirable for use in cosmetics and as a source of fatty acids for bio-based applications
such as specialized surfactants, lubricants, and plasticizers including derivatives such as
estolides and δ-lactones (Burg & Kleiman, 1991; Erhan, Kleiman & Isbell, 1993; Isbell, 1997;
Wohlman, 2001). Blending of meadowfoam fatty acid methyl esters with soybean-derived
biodiesel improved stability, viscosity, and lubricity of the vegetable fuel (Moser, Knothe &
Cermak, 2010).
Most plants that accumulate unusual FAs are wild species that are not agronomically
adapted. Encouraged by the agricultural potential of certain Limnanthes species, however, a
domestication and breeding program at Oregon State University established meadowfoam
as a rotation crop for grass seed farmers in the Willamette Valley, where cultivars developed
from wild accessions of L. alba are currently grown for specialized markets (Jolliff et al.,
1981; Knapp & Crane, 1999; Knapp, Crane & Brunick, 2005). Meadowfoam is the richest
known source of Δ5 monounsaturated FAs and presently the sole commercial source of
Δ5-unsaturated very long chain fatty acids (VLCFAs).
Key activities responsible for determining the seed oil phenotype of meadowfoam
include a microsomal elongase (KCS) that extends 16:0- and 18:1-acyl-CoA substrates
to C20 and C22 VLCFAs, and an unusual desaturase (Δ5DS) that introduces a double
bond in >80% of the elongated chains (Pollard & Stumpf, 1980; Moreau, Pollard &
Stumpf, 1981). In L. alba this produces a fatty acid phenotype of ∼63% 20:1Δ5, ∼4%
22:1Δ5, 10–17% 22:1Δ13 (erucic acid), and 13–19% 22:2Δ5Δ13 (dienoic acid) (Knapp
& Crane, 1995). Unlike in most other species in the Brassicales that synthesize VLCFAs,
the meadowfoam lysophosphatidyl acyltransferase (LPAT) inserts erucic acid into the
sn-2 position of TAG (Cao, Oo & Huang, 1990; Laurent & Huang, 1992; Lassner et al.,
1995; Brown et al., 2002). The meadowfoam genome has been “mined” for its KCS, Δ5DS,
and LPAT genes with the aim of engineering designer lipids in established oilseeds such
as rapeseed and soybean (Lassner et al., 1995; Cahoon et al., 2000; Jadhav et al., 2005;
Nath et al., 2009). To date none of the transgenic efforts has reproduced the high 20:1Δ5
phenotype of meadowfoam oil, although elevation of erucic acid to 72% in rapeseed
transformed with L. douglasii LPAT was reported (Nath et al., 2009).
Meadowfoam seeds also contain 3–4% (w/w) glucolimnanthin (Ettlinger & Lundeen,
1956), a phenylalanine-derived 3-methoxybenzyl glucosinolate whose nitrile and
isothiocyanate degradation products are toxic to germinating seedlings, fungal pathogens,
and insects (Vaughn, Boydston & Mallory-Smith, 1996; Stevens et al., 2009; Zasada et
al., 2012). Although the endogenous glucosinolate-degrading enzyme, myrosinase, is
inactivated by heat treatment during the oil extraction process, fermenting the residual
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
2/21
seed meal with crushed enzyme-active meadowfoam seeds generates breakdown products
with pre-emergent herbicidal activity (Stevens et al., 2009). The efficacy of this by-product
could be improved by augmenting the glucolimnanthin content of meadowfoam cultivars
(Brown & Morra, 2005). A recent survey of meadowfoam accessions revealed a nine-fold
variation in seed glucolimnanthin content among 90 L. alba breeding lines, indicating
substantial genetic diversity in the primary gene pool (Veslasco et al., 2011).
The objectives of the present study were to (i) catalogue lipid biosynthetic and
glucosinolate ESTs in the developing seed transcriptome, (ii) recover simple sequence
repeat (SSR) and single nucleotide polymorphism (SNP) markers from EST contigs, and
(iii) construct a genetic map of L. alba populated with SSR markers as well as important
candidate genes for lipid synthesis and glucosinolate metabolism. These results can be used
to further current meadowfoam breeding goals that include increasing the seed oil content
and creating cultivars with altered oil and glucosinolate phenotypes.
METHODS
Plant materials
Seeds of meadowfoam cultivar MF164 ‘Ross’ (Knapp, Crane & Brunick, 2005), a
non-inbred L. alba subsp. alba population undergoing recurrent selection for oil content,
were germinated on moistened blotter paper in the dark at 5 ◦ C for one week, transferred
to a growth chamber at 15 ◦ C with 8 h of light/day for two weeks, transplanted to pots
for continued growth, then transferred to the greenhouse at 20–21 ◦ C with 16 h light
at 7 weeks after planting. Flowers were hand-pollinated and the developing seeds were
harvested 14–22 days after flowering. Embryos were excised from seed coats, collected into
liquid N2 , and stored at −80 ◦ C until use.
RNA extraction and EST library construction
Total RNA was isolated from developing embryos using TRIzol reagent (Gibco-BRL,
Grand Island, New York, USA) according to the manufacturer’s instructions and further
purified using RNeasy MinElute Cleanup columns (Qiagen, Hilden, Germany). PolyA+
RNA was isolated using the Poly(A) Purist kit (Ambion) according to manufacturer’s
instruction. A cDNA library was prepared using the Creator SMART cDNA Library
Construction Kit (BD Biosciences, San Jose, California, USA) as directed by the
manufacturer’s instructions. cDNAs above ∼500 bp were directionally cloned into
Clontech pDNR-LIB vector after SfiI digestion. Gel analysis of a trial transformation
showed 100% recombinants with inserts ranging in size from 450 bp to 1.5 kbp and 90%
of inserts >500 bp. The ligated library was provided to The Institute for Genomic Research
(TIGR, Rockville MD) for electro-transformation and sequencing. Clones were sequenced
from the 5′ end of cDNA inserts using the Sanger method and the universal T7 primer
(TAATACGACTCACTATAGGG).
Clustering analysis and annotation
ESTs were cleaned of poor quality and low complexity sequences and trimmed to
exclude vector and adaptor sequences. 15,331 EST sequences were deposited in GenBank
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
3/21
(http://www.ncbi.nlm.nih.gov/nucest/?term=meadowfoam). Table S1 is a look-up table
for converting between the sequence names assigned for GenBank submission and
sequence names assigned by TIGR. Cleaned sequences were assembled into 1,352 contigs
using CAP3 software. The parameters used for assembly were a minimum of 40 base pair
overlap, overlap percent identity cutoff of >94%, and a maximum unmatched overhang of
30 base pairs. Contigs were assigned names TC1. . . TC1352. The EST sequences contained
in each contig are listed in Table S2. Assembled contigs and singletons were compared to a
variety of protein databases using blastx.
SSR marker development and genotyping
Unigenes from the EST analysis were screened for simple sequence repeats (EST-SSRs)
with a minimum repeat size of six for dinucleotide repeats and five for tri-, tetra, and
hexanucleotide repeats. Repeat sequences with di-, tri-, and tetranucleotide SSRs were
also mined from trial methyl-filtered and unfiltered genomic libraries prepared from
meadowfoam leaf DNA and analyzed by Orion Genomics (St. Louis, Missouri, USA)
(genomic-SSRs). Primer3 software was used to pick 172 primer sets (110 EST-SSRs and 62
genomic-SSRs) designed to yield 150–400 bp PCR products. Primers had a Tm of ∼60 ◦ C,
and GC content between 40 and 60%. Forward primers were labeled with either HEX or
FAM fluorescent tags. Primer sequences are available in Table S3.
Linkage map construction
The linkage map was built using an inter-subspecific backcross between MF40-11
(L. alba subsp. alba) and MF64 (L. alba subsp. versicolor). Parents were inbred to S5 prior
to being crossed. SSRs and candidate gene markers were genotyped on 90 BC1 progeny
of the [(MF40-11 × MF64) × MF64] cross. SSR genotyping was as described (Kishore et
al., 2004) except that fragments were separated on an ABI Prism 3,100 capillary system
(Applied Biosystems, Carlsbad, California, USA) at the Central Services Lab, Oregon
State University, and scored using Genotyper software and manual evaluation. Candidate
genes were scored as described below. Linkage maps were assembled using JoinMap 4
software with BC1 population type codes (Van Ooijen, 2006). The input dataset contained
genotypes for 123 SSR markers and eight candidate genes. Markers were assigned to five
linkage groups using a test for independence LOD score of 6.0, and ordered using the
regression mapping algorithm with a recombination frequency threshold of 0.40, a LOD
threshold larger than 1.00, and a jump threshold value of 5.0. The Haldane mapping
function was used to translate recombination frequencies into map distances.
SNP discovery
The program AutoSNP (Barker et al., 2003) was used to search for putative SNP sites
within contigs. An independent CAP3 analysis, done with similar parameters used for the
TIGR CAP3 analysis, yielded 1,376 contigs. AutoSNP parameters were set to report SNP
positions in contigs with minor allele frequencies of at least one for contigs with 2–4 ESTs,
two for contigs with 5–6 ESTs, three for contigs with 7–9 ESTs, four for contigs with 10–12
ESTs, five for contigs with 13–15 ESTs, and six for contigs with 16+ ESTs.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
4/21
Genotyping assays for selected candidate genes
For each meadowfoam, contig of interest homologous genomic and cDNA sequence(s)
from Arabidopsis and other plants were retrieved from databases and sequences were
aligned using ClustalW to identify putative intron locations. Multiple PCR primer sets
were designed to produce intron-containing PCR products and tested on MF40-11 and
MF64 parental templates and a pooled DNA sample from 12 BC1 progeny. The resulting
PCR products were screened for length polymorphisms on agarose gels and for single
strand conformational polymorphisms (SSCP) on silver-stained polyacrylamide gels as
described (Slabaugh et al., 1997). SSCP analyses can resolve DNA segments that differ in
a single nucleotide (Spinardi, Mazars & Theillet, 1991) and typically produce two SSCP
bands per PCR product. Preliminary trials were scored for number of loci amplified,
polymorphism between parents, and transfer of polymorphic loci to progeny. The primer
sequences selected for marker generation are provided in Table S4.
KCS11. Fourteen ESTs comprising Contig 248 were aligned with L. douglasii FAE cDNA
sequence AF247134. Primers KCS1F and KCS4R were designed from sequence segments
with no SNPs among the contig ESTs. The 460-bp PCR product indicated absence of an
intron in the KCS gene.
Δ5DS. ESTs representing all eight haplotypes comprising Contig 104 were aligned
with Arabidopsis genomic sequences At1g06080 (ADS1) and At3g15870 (ADS3), their
respective cDNAs, and L. douglasii Δ5DS cDNA AF247133. This identified four putative
intron locations in the meadowfoam genes. Primers DS218F and DS219R were designed
to flank both sets of (CT)n repeats in the 5′ -UTR and anneal to all haplotypes. Primers
DS221F and DS5R matched invariant segments of the Contig 104 sequence and were
designed to flank intron 1. These primers produced PCR products of ∼700 bp and
∼750 bp, respectively from MF64 and MF40-11 templates indicating intron 1 sizes of
∼600 and ∼650 in parental DNAs. The intron length polymorphism was used to score
segregation of Δ5DS on an agarose gel.
LPAT2. Contig 909 was aligned with genomic LPAT sequences from L. douglasii
(DQ402047) and L. floccosa (AF212042), and cDNA sequences from L. douglasii (Z46836)
and L. alba (U32988), which identified four intron locations. Primers LPAT432F and
LPAT893R were chosen to include introns 2, 3, and 4 and produced 710-bp PCR products
from parental DNAs. The MF40-11 product was resolved by SSCP analysis into two sets
of bands but only one set was observed in BC1 progeny, indicating heterozygosity in the
MF40-11 parent. The transmitted MF40-11 allele was polymorphic with the allele from
MF64.
DGAT2. Contig 384 was aligned with Arabidopsis genomic sequence At3g51520
(DGAT2) and its cDNA to identify the putative locations of seven introns. Primers
DGAT3F and DGAT4R were designed to include intron 4. The 290-bp PCR product
indicated a size of ∼100 bp for intron 4 in L. alba. A strong set and a weak set of
co-segregating polymorphic bands were amplified from each parental DNA.
TGG. Contig 572 was aligned with Arabidopsis genomic sequences At5g26000 and
At5g25980 (TGG1 and TGG2, respectively) and their corresponding cDNAs, to identify
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
5/21
the putative locations of 11 introns. Primers TGG436F and TGG792R were designed to
include introns 8 through 11. The 760-bp PCR fragment indicated that a total of ∼400 bp
of intronic sequence was included in Limnanthes products. The primers produced three
sets of SSCP bands from each parent and two complex but co-segregating patterns in BC1
progeny, indicating a small gene family.
ESM1,2,3. Contigs 183 and 184 were aligned with Arabidopsis ESM1 genomic
(At3g14210) and corresponding cDNA sequences to identify four intron positions. Primers
ESM-5F (upstream of intron 2, matches Contigs 183 and 184), ESM-2R (downstream of
intron 3, Contig 183-specific) and ESM-4R (downstream of intron 3, Contig 184-specific)
were used. SSCP analysis showed that primers 5F and 2R (Contig 183-specific) amplified
three co-segregating loci; primers 5F and 4R (Contig 184-specific) amplified one
monomorphic locus.
CYP79A. Amino acid sequences from cytochrome P450 genes CYP79A (Phe substrate),
CYP79B (Trp substrate), and CYP79E (Tyr substrate) from Sinapis alba, B. napus,
sorghum, arrowgrass, and Arabidopsis were collected from databases and aligned to
identify residues specifically conserved in each CYP79 subclass. Degenerate primers
were designed to amplify the subgroups. Primer combinations were trialed on parental
DNA and the 12-progeny BC1 bulk using a touch-down PCR protocol in which the
annealing temperature was gradually decreased from 55 C to 50 C. Primers CYP203F
(motif EEIEHV[D/E]) and CYP211R (motif HPVAPFN), targeted to the CYP79A class,
produced a pair of polymorphic bands of the expected size. Primers CYP201F (motif
EHMEAMF) and CYP217R (motif QESDIPKL), targeted to the CYP79B class, produced a
pair of monomorphic bands of the expected size.
RESULTS AND DISCUSSION
Construction and annotation of a developing embryo cDNA
library
To identify genes important for meadowfoam seed phenotypes, a cDNA library was made
from developing embryos of L.alba subsp. alba excised from their seed coats 14–22 days
after fertilization (DAF). Our intent was to sample developmental stages that included
plastidial fatty acid synthesis, cytoplasmic acyl-chain modification and storage lipid
biosynthesis, as well as glucosinolate accumulation. Embryos were collected from 20 plants
of cultivar ‘Ross,’ a heterogeneous, open-pollinated population undergoing recurrent
selection for desirable agronomic traits (Knapp, Crane & Brunick, 2005). mRNA was
isolated from a heterogeneous population to capture sequence variation that could be
utilized for DNA-based markers.
Sanger-sequenced cDNAs had an average read length >500 bp. After cleaning, 12,652 of
the 15,331 high-quality reads were assembled into 1,352 contigs (Table 1). The number of
ESTs per contig ranged from 2 to 460. Thirty-seven per cent of the sequences were assigned
to 1,258 contigs that contained from 2 to 20 ESTs and 45.5% were assigned to 94 large
contigs with >20 ESTs. Most of the large contigs encoded either 2S or 12S seed storage
protein precursors. Sixty-two contigs were annotated as most similar to the 2S seed storage
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
6/21
Table 1 CAP3a assembly statistics for meadowfoam developing seed cDNA library.
Description
Number
Percentage
Total number of EST sequences
Number of high-quality sequences
Number of contigs
Number of singletons
Number of unigenes
Average length of EST
17,376
15,300
1,352
2,679
4,031
528 bp
100%
88%
82% of high-quality sequences
18% of high-quality sequences
Notes.
a
CAP3 parameters: % identity >94, minimum 40 bp overlap, maximum 30 bp overhang.
Table 2 Simple sequence repeats (SSRs) in developing meadowfoam embryo EST and genomic DNA
sequences.
Repeat unit length
EST-SSRsa
Genomic-SSRsb
Number detected
Primers made
Number mapped
Number detected
Primers made
Number mapped
Total
n=2
n=3
n=4
n=6
178
110
44
80
62
10
99
54
26
68
50
7
67
47
13
10
10
3
4
4
2
2
2
0
8
5
3
0
0
0
Notes.
a
4,031 EST unigene sequences were examined.
b 2,864 sequences from genomic libraries were examined.
protein mabinlin from Capparis masaikai, a species in a sister family to Limnanthaceae
within the order Brassicales. Mabinlin is of interest due to an amino acid motif in the
protein that interacts with the sweet taste receptor (Li et al., 2008). The L. alba homologues,
however, contained only part of this motif. As expected in an oilseed, ESTs encoding
proteins with structural roles in lipid synthesis, transport, and storage such as acyl carrier
protein (ACP, 34 ESTs), acyl-CoA binding protein (ACBP, 216 ESTs), and oleosin (OLE,
267 ESTs) were well represented and comprised in aggregate 3.4% of the ESTs whereas ESTs
annotated as encoding enzymes of lipid metabolism represented only 1.2% of the 14–22
DAF transcriptome. Comparison of the meadowfoam EST unigenes against Arabidopsis
proteins revealed 70% hits with E-values ≤10−5 .
SSR markers mined from cDNA and genomic libraries
The EST unigene sequences and an additional 2,864 sequences from pilot-scale
methyl-filtered and unfiltered genomic libraries prepared from L. alba subsp. versicolor
(M Slabaugh, 2004, unpublished data) were searched for simple sequence repeats suitable
for marker development. These searches produced 178 EST library-derived and 80
genomic library-derived candidates with repeat units of 2, 3, 4, or 6, for an overall
frequency of 4.4% and 2.8%, respectively (Table 2). Dinucleotide repeats predominated
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
7/21
in both collections but differed in type: the majority of dinucleotide SSRs from ESTs were
AG/CT repeats, whereas 84% of the dinucleotide repeats in the genomic libraries were
AT repeats. SSRs from genomic sequences had approximately twice the mean number of
repeats as those from EST-SSRs: 16.5 vs. 7.5 for dinucleotide repeats and 9.9 vs. 5.6 for
trinucleotide repeats. Detailed information regarding 172 candidate SSR loci for which
primers could be designed, including primer sequences and allele sizes from multiple
germplasm sources, are contained in Tables S3 and S5. These new SSR loci add to the 624
unique SSR loci mined from genomic libraries and described by Kishore et al. (2004).
The functional utility of SSRs gleaned from the EST library was substantially greater
than SSRs retrieved from genomic libraries as 40% of the 110 EST-SSR candidates but only
16% of the 62 genomic-SSR candidates were polymorphic in our mapping population
(Table 2). Overall, 32% of dinucleotide-SSR primers and 28% of trinucleotide-SSR primers
produced scoreable SSRs. Thirty-eight percent of the candidate PCR products were not
polymorphic, and remaining primers either failed to amplify parental DNA (23%) or
produced ambiguous products (7%).
SNP polymorphisms in the EST unigene set
L. alba subsp. alba EST contigs were analyzed for the presence of single nucleotide
polymorphisms (SNPs) using AutoSNP software (Barker et al., 2003). When run with
stringent minimum redundancy requirements (see ‘Materials and Methods’) AutoSNP
detected 7,193 SNPs in 1,376 contigs of mean length 684 nt, yielding an average frequency
estimate of 1 SNP per 131 nt of contig sequence. These calculations, however, included
contigs with few ESTs where SNP variants may be under-represented or under-scored due
to redundancy requirements, and those with >40 ESTs where SNP calls were exceptionally
high, likely due to paralog pooling by the CAP3 analysis. Restricting the analysis to contigs
with >4 and <41 ESTs (31% of the contig set) produced an estimate of 1 SNP per 294
nts in the out-crossing L. alba breeding population we sampled. The identified SNP sites
can be used to develop additional markers for the genetic map as well as enable design of
SNP markers for candidate genes of interest in targeted breeding projects. AutoSNP results,
including sequence alignments and tabulated SNP sites, are available as HTML files from
the corresponding author.
Construction of an inter-subspecific meadowfoam genetic map
Previous maps for meadowfoam used non-transferable dominant AFLP markers
(Katengam et al., 2001) or were constructed specifically for QTL studies of certain traits
(Gandhi et al., 2009). To develop a framework genetic map populated with easily assayed,
highly polymorphic markers, we used a BC1 population developed from a cross between
partially inbred (S5 ) individuals from L. alba subsp. alba (MF40-11) and L. alba subsp.
versicolor (MF64, recurrent parent). Ninety backcross progeny were genotyped for 54
SSR markers developed during the present study and 74 previously-developed genomic
markers (Kishore et al., 2004). The SSR loci grouped into five linkage groups presumably
corresponding to the five haploid chromosomes of this species. Eight candidate gene loci
were added to the map by genotyping the BC1 population with sequence-specific PCR
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
8/21
Figure 1 The genetic linkage map of Limnanthes alba. Five linkage groups (LG) were constructed from a BC1 mapping population of 90 individuals
derived from an intersubspecific cross between MF40-11 (L. alba subsp. alba) and MF64 (L. alba subsp. versicolor). SSR markers developed from
EST and genomic sequences are shown with LS prefixes, and candidate gene markers genotyped using sequence-specific PCR/SSCP assays are shown
in italics. Regions of LG2 and LG3 previously identified by QTL analysis (Gandhi et al., 2009) as harboring genetic factors affecting erucic acid levels
are shaded light grey.
products whose segregating alleles could be distinguished by single strand conformational
polymorphism (SSCP) (Spinardi, Mazars & Theillet, 1991). SSCP polymorphisms used to
map candidate genes are shown in Fig. S1 and primer sequences are listed in Table S4. The
map assembled by JoinMap 4 was 219 cM long with 19–29 loci per linkage group (Fig. 1).
The groupings were stable to LOD 10, except for LG5 where the distal marker LS628 was
lost at LOD 9. The longest gap was 25.2 cM on linkage group 5. Segregation ratios for 37
loci on linkage groups 3 and 4 were significantly distorted (p ≤ 0.05). All of the distorted
loci had an excess of MF40-11 alleles suggesting selection for heterozygous genotypes.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
9/21
Distortion occurred in the middle of linkage group 3 whereas distortion on linkage group 4
encompassed only the upper half of the linkage group.
The new map was co-linear with a previously published genetic map constructed from
an independently-generated intra-subspecific L. alba subsp. alba F2 population (Gandhi
et al., 2009) as determined by genotyping 20 of the markers from the F2 map that were
also polymorphic in the inter-subspecific BC1 population of this study. The common
loci mapped in the same order except for a minor rearrangement of two closely-spaced
markers on linkage group 1 and co-segregation of two markers on linkage group 2 in the
BC1 map that were 7 cM apart on the F2 map. These common markers permitted naming
and orientation of linkage groups to correspond to Gandhi et al. (2009), except for linkage
group 5 that had only one marker in common. Side by side comparisons indicated that
each map contained markers in telomeric regions not covered by the other (not shown).
Developing seed transcriptome
Table 3 catalogs our analysis of the 14–22 DAF seed transcriptome for lipid and glucosinolate metabolism ESTs. ESTs encoding enzymes involved in fatty acid synthesis in the plastid
(ACCase, KAS I, KAS II, ER, HAD, KAR) and fatty acid elongation in the ER (ACCase,
KCS, ECR, KCR) were each present at low but roughly stoichiometric levels (0.02–0.09%
of total ESTs). ESTs for the structural protein involved in conveyance of nascent acyl-CoA
chains from the plastid to the ER, acyl-CoA-binding protein (ACBP), and the surface
protein that encapsulates oil droplets, oleosin (OLE), were 30- to 40-fold more prevalent
than those for any of the enzymatic activities. The number of haplotypes detected
for enzyme-ESTs was one or two except for the elongase KCS11 (5 haplotypes) and
ADS3-like Δ5DS (8 haplotypes). Multi-gene families for these activities were confirmed
by subsequent mapping experiments (see below). ESTs for the cytoplasmic ADS3-like
Δ5DS were abundant whereas only two ESTs were detected for stearoyl-ACP desaturase,
the plastidial enzyme that produces 18:1Δ9. Missing entirely from the meadowfoam
EST collection were transcripts encoding the plastidial thioesterases FATA and FATB,
and the initial TAG assembly enzyme glycerol-phosphate acyl-CoA transferase, GPAT.
However, the low prevalence of ESTs for thioesterases and GPAT as quantitated by deep
transcriptional profiling of non-normalized libraries from four other developing oilseeds
at a similar developmental stage (Troncoso-Ponce et al., 2011) suggests that these ESTs were
likely below detection in our study.
Meadowfoam seed-expressed fatty acid elongase is a homologue
of AtKCS11
More than 98% of the fatty acids in meadowfoam oil are C20 and C22 VLCFAs
resulting from elongation of saturated and Δ9-monounsaturated acyl-CoA substrates
by ketoacyl-CoA synthase (Pollard & Stumpf, 1980; Sandager & Stymne, 2000). Contig 248
(14 ESTs) encoded an elongase with 76% identity to AtKCS11 (At2g26640), a member
of the ζ -clade of the Arabidopsis KCS gene family (Joubes et al., 2008). Contig 248 was
therefore designated LaKCS11. The deduced amino acid sequence of Contig 248 was 99%
identical to an L. douglasii cDNA previously designated LdFAE1 (Cahoon et al., 2000).
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
10/21
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
Table 3 Seed lipid and glucosinolate metabolism transcripts from the developing embryo EST library.
Gene name(s),
following
Arabidopsis
WRI1
CAC1, BCCP2
CAC2, BC
KAS I
KAS II
ER
HAD
KAR
FAB2/DES
ADS3
FAD8
ACP
LACS4
ACC1
KCS11
ECR
KCR
ADS3-like
FAD2
ACBP6
ACBP6
ACBP6
LPAT2
DGAT2
LPEAT
LTP4
OLE2
L. alba contig(s) or
singleton(s)
Activity identified by BLASTx
Lipid synthesis and TAG assembly
Contig 1095
Transcription factor of the AP2/ERWEBP class
Contig 434
Biotin carboxyl carrier protein
Contig 311
Biotin carboxylase subunit of Het-ACCase
Contig 418
3-Ketoacyl-ACP synthase I
Contig 555
3-Ketoacyl-ACP synthase II
Contig 535
Enoyl-ACP reductase
Contig 457
Hydroxyacyl-ACP dehydratase
a
Contig 803
3-Ketoacyl-ACP reductase (KAR)
Contig 1261a
MF1BL10TV
Stearoyl-ACP desaturase
MF1CR48TV
MF1EJ57TV
Palmitoyl-monogalactosyldiacyl glycerol desaturase, delta9
FADS-like
MF1CZ39TV
Delta-15 desaturase, plastid
Contig 141
Acyl carrier protein
MF1CK48TV
Long-chain acyl-CoA synthetase
Contig 1339
Homomeric Acetyl-CoA carboxylase
Contig 248
3-Ketoacyl-CoA synthase
Contig 567
Enoyl-CoA reductase
Contig 405
3-Keto acyl-CoA reductase
Contig 104
Delta-5 acyl-CoA desaturase
MF1AB25TVB
Delta-12 fatty acid desaturase, ER
Contig 99
Acyl-CoA-binding protein
Contig 100
Acyl-CoA-binding protein
Contig 101
Acyl-CoA-binding protein
Contig 909
Lysophosphatidyl acyltransferase
Contig 384
Diacylglycerol acyltransferase
Contig 980
Phospholipid/glycerol acyltransferase
Contig 1122
Lipid transfer protein 4
Contig 108
Oleosin
Contig 110
Oleosin
No. of Contig No. of
ESTs size (bp) SNPs
No. of
haplo-types
Representative at
gene model
2
7
11
7
5
5
6
3
2
2
780
1,064
531
1,110
854
1,253
810
474
658
NA2
3
0
0
0
4
0
5
9
2
NA2
2
1
1
1
2
1
2
2
2
NA2
At3g54320
At5g15530
At5g35360
At5g46290
At1g74960
At2g05990
At5g10160
At1g24360
1
NA2
NA2
NA2
At3g15850
1
34
1
2
14
5
8
91
1
53
37
126
2
8
2
2
86
2
NA2
787
NA2
697
846
1,232
1,194
1,411
NA2
587
574
585
814
1,156
780
788
870
757
NA2
9
NA2
3
16
8
8
27
NA2
0
0
8
7
12
0
9
25
11
NA2
4
NA2
2
5
2
2
8
NA2
1
1
8
2
2
1
2
6
2
At5g05580
At1g54580
At4g23850
At1g36160
At2g26640
At3g55360
At1g67730
At3g15850
At3g12120
At1g31812
At1g31812
At1g31812
At2g43710
At3g51520
At1g80950
At5g59310
At5g40420
At2g25890
(continued on next page)
11/21
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
Table 3 (continued)
Gene name(s),
following
Arabidopsis
OLE1
ESM1
ESM1
TGG1
MBP
L. alba contig(s) or
singleton(s)
Activity identified by BLASTx
Contig 111
Oleosin
Contig 118
Oleosin
Contig 119
Oleosin
Contig 120
Oleosin
Contig 125
Oleosin
Contig 300,
Oleosin
Contig 301
Glucosinolate metabolism
Contig 183
Epithiospecifier modifier/myrosinase-associated protein
Contig 184
Epithiospecifier modifier/myrosinase-associated protein
Contig 572
β-Thioglucoside glucohydrolase/ myrosinase
Contig 901
Myrosinase binding protein
No. of Contig No. of
ESTs size (bp) SNPs
No. of
haplo-types
Representative at
gene model
78
5
22
22
44
8
839
735
737
728
746
647
19
0
0
5
4
0
4
1
1
3
3
1
At2g25890
At3g01570
At3g01570
At3g01570
At4g25140
At3g01570
5
15
4
3
851
1,270
1,098
1,049
5
15
3
NAc
3
3
2
NAc
At3g14210
At3g14210
At5g26000
At1g52030
Notes.
a
Non-overlapping contigs: Contig 1,261 covered 5′ end of KAR cds (60%) and contig 803 covered 3′ end of KAR cds (25%).
b NA = Single EST or two non-overlapping ESTs,
c
Probable paralogs.
12/21
Contig 248 plus a singleton EST (MF1E193TV) together covered ca. 90% of the LaKCS
coding sequence. The contig comprised five haplotypes with at least two representatives
each, plus two singleton haplotypes, based on 12 SNPs in the cds and 3′ UTR. Cds SNPs
were synonymous substitutions except for one conservative codon change, resulting in
two polypeptide variants: 12 ESTs encoded Val and 2 ESTs encoded Ile at residue 462
(numbering based on the LdFAE1 sequence).
To map LaKCS11 we amplified genomic DNA with primers that flanked eight SNP
sites within the cds. Analysis revealed as many as eight interleaved SSCP bands in the BC1
progeny. The segregation patterns were de-convoluted, revealing that the L. alba subsp.
alba and L. alba subsp. versicolor parents carried contrasting alleles at two unlinked KCS
loci. LaKCS11-1 was mapped to LG2 and LaKCS11-2 was mapped to LG5 (Fig. 1). Because
the KCS family in Arabidopsis includes 21 genes with functions in various metabolic
pathways and differing substrate preferences (Blacklock & Jaworski, 2002; Blacklock &
Jaworski, 2006; Joubes et al., 2008), our results raised the question of whether the primers
we used might have amplified KCS paralogs in addition to KCS11, if these exist in
Limnanthes. To address this, we aligned amino acid sequences representing each of the
eight Arabidopsis clades with KCS sequences from Brassica sp., Teesdalia, Crambe, Lunaria,
Tropaeolium, and Limnanthes. This revealed that the upstream primer we used was in fact
located in highly conserved sequence but the downstream primer was targeted to a region
that varied extensively between clades and included a ζ -clade-specific Phe codon at its 3′
end. We concluded that both LaKCS loci were likely members of the ζ -clade.
A major determinant of the VLCFA profile in seeds is the substrate range and activity of
the elongase system(s) (Jasinski et al., 2012). Based on biochemical experiments Sandager
& Stymne (2000) suggested that in meadowfoam, one system with specificity for saturated
substrates elongates to C20 and another system with specificity for mono-unsaturated
substrates elongates to C22. However, when Jadhav et al. (2005) co-expressed L. douglasii
FAE1(LdKCS11) and Δ5DS cDNAs in soybean seeds, the resulting fatty acid profile
included 10.6% 20:1Δ5 and 10.0% 20:1Δ11, evidence that a single meadowfoam KCS
could extend both saturated and mono-unsaturated substrates. Consistent with this, an
embryo-expressed ζ -clade KCS from nasturtium (Tropaeolum majus) displayed broad
substrate activity when transformed into Arabidopsis and tobacco (Mietkiewska et al.,
2004) and a recombinant AtKCS11 polypeptide was shown to have elongase activity on
both saturated and mono-unsaturated C16–C20 substrates in vitro (Blacklock & Jaworski,
2006). We cannot rule out the possibility that the Val/Ile variants at residue 462 in our EST
collection might have somewhat different substrate preferences, however, as residues in this
part of the protein are predicted to be near the substrate pocket based on modeling (Joubes
et al., 2008; Jasinski et al., 2012).
L. alba Δ5DS is highly expressed in mid-development embryos
Contig 104 (91 ESTs) encoded the enzyme that confers unique chemical properties to
meadowfoam oil, desaturation at the Δ5 position (Pollard & Stumpf, 1980; Moreau,
Pollard & Stumpf, 1981; Cahoon et al., 2000). The abundance of Δ5DS transcripts in the
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
13/21
cDNA library likely explains how <20% of fatty acid chains escape Δ5 desaturation in
meadowfoam seeds. Δ5DS ESTs grouped into two classes distinguished by either (CT)6
(34 ESTs) or (CT)7 (57 ESTs) dinucleotide repeats in the 5′ -UTR, and nine SNP sites
within the cds. Deduced amino acid sequences, however, were invariant. A second (CT)n
repeat also within the 5′ -UTR varied from 8 to 16 repeats in the (CT)6 class (5 haplotypes)
and 12–14 repeats in the (CT)7 class (3 haplotypes), with a single variant accounting
for ca. 70% of the sequences in each class. One explanation for this diversity of EST
haplotypes is that the L. alba genome contains two paralogous Δ5DS genes characterized
by (CT)6 vs. (CT)7 repeats and that diversity in the second repeat motif is attributable to
allelic polymorphism among the outbred plants sampled for the cDNA library. However,
this explanation was not supported by amplifying DNA from four partially inbred (S5 )
mapping parents in our breeding program with (CT)6 -specific or (CT)7 -specific PCR
primers, as the results indicated that each line harbored only one or the other of the two
classes (not shown).
The presence of at least two Δ5DS genes in the meadowfoam genome was deduced by
using primers matching invariant sequences flanking both sets of repeats. When applied
to MF40-11 and MF64 parental DNAs these primers produced three sets of polymorphic
SSCP bands from each template (Fig. S1). BC1 progeny, however, produced only one band
set from each parent, suggesting that both parents carried two Δ5DS loci but were each
heterozygous at one locus. The co-segregating Δ5DS loci were mapped to the upper end
of LG2 (Fig. 1). In sum, our results indicated that the Δ5DS gene family consists of two
closely-linked loci that are hyperpolymorphic within populations due to the presence of
tandom (CT)n repeats in the 5′ -UTR.
Gandhi et al. (2009) mapped meadowfoam QTL affecting erucic acid (22:1Δ13) and
dienoic acid (22:2Δ5Δ13) in an L. alba subsp. alba F2 population in which factors that
promoted a 3- to 4-fold reduction of erucic acid (to ∼3%) were segregating. Erucic and
dienoic QTL associated with 22% of the phenotypic variance were coincident and had
opposite effects on erucic and dienoic levels. These QTL mapped to LG2 (see Fig. 3 of
Gandhi et al., 2009). As estimated from four common markers on LG2, the Δ5DS EST
loci mapped in the present study are within the erucic/dienoic QTL peak of the F2 map
(shaded in Fig. 1), lending support to the suggestion that the Δ5DS is a candidate gene
underlying the low erucic phenotype. Because erucic and dienoic acids are presumed
to have a precursor-product relationship, differing expression levels, specific activity, or
substrate preference in this enzyme could contribute to oil phenotype differences, as well as
explain the coincidence of erucic and dienoic QTL on LG2.
The Δ5DS’s encoded by L. alba and L. douglasii (Cahoon et al., 2000) are members of
the large “Delta9-FADS-like” or ADS subfamily found in eukaryotes including vertebrates,
insects, higher plants and fungi, as well as a wide range of bacteria. These non-heme,
iron-containing, ER membrane-bound enzymes exhibit a diversity of subcellular
localization, lipid substrate utilization, regiospecificity, and biological function (see
http://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=58171). Blastp revealed
that L. alba and L. douglasii Δ5DS s, which lack a chloroplastic transit peptide, are 98%
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
14/21
identical to each other and show ∼60% identity to a large number of proteins including
palmitoyl-monogalactosyldiacylglycerol Δ7DSs similar to the chloroplastic ADS3 from
Arabidopsis (Heilmann et al., 2004), predicted cytoplasmic Δ9DSs from many plant
species, and two Δ5DS s from Anemone leveillei (Sayanova et al., 2007). The acyl-lipid
substrate for the Δ5DS s remains to be proven, although the preferred substrates for the
meadowfoam Δ5DS are putatively acyl-CoAs, as inferred from biochemical time course
assays using a variety of substrates and cell free extracts of developing seeds (Moreau,
Pollard & Stumpf, 1981). Sayanova et al. (2007) examined the acyl-CoA pools in developing
seeds of Arabidopsis transformed with two A. leveillei Δ5DS cDNAs and found evidence
that both enzymes use acyl-CoA substrates.
Genes for LPAT and DGAT
ESTs for two activities in the acyl-CoA dependent Kennedy pathway for TAG assembly
were present in the meadowfoam library. Contig 909, comprising two overlapping
ESTs covering the 3′ third of the cds, was annotated as lysophosphatidyl acyltransferase,
homologous to endoplasmic reticulum-based LPATs from other plant species and referred
to as LPAT2 in most oilseeds (Taylor et al., 2010). Segregation analysis of SSCP patterns
(Fig. S1) indicated the presence of a single LPAT2 locus that mapped to the interior of
LG3 (Fig. 1). A QTL for erucic acid associated with 13% of the phenotypic variability was
previously mapped (Gandhi et al., 2009) to the corresponding region of LG3 (shaded in
Fig. 1), as estimated from three SSR markers in common between the maps. Although
L. douglasii LPAT2 showed a preference for 22:1-acyl-CoA substrate in vitro, the enzyme
exhibited a broad substrate range (Brown et al., 2002), and it is feasible that variation at
the erucic-inserting LPAT2 locus could underly phenotypic variability in erucic acid in
meadowfoam seed oil.
The final enzyme in TAG synthesis via the Kennedy pathway, acyl-CoA diacylglycerol
acyltransferase, or DGAT, was encoded by Contig 384. Meadowfoam DGAT2 ESTs
displayed two haplotypes among eight ESTs and we mapped the DGAT2 locus to the upper
arm of LG1. The lack of a DGAT1 homologue in our library is consistent with suggestions
that DGAT2 functions in seed-specific TAG biosynthesis and may be preferentially
involved in transfer of unusual fatty acids into storage oil (Shockey et al., 2006; Banilas
et al., 2011). Work in several plant species suggests that DGAT activity is rate-limiting in
TAG biosynthesis and thus has an effect on final seed oil content, as shown in Arabidopsis
(Jako et al., 2001), B. napus (Weselake et al., 2008), soybean (Lardizabal et al., 2008), and
maize (Zheng et al., 2008).
Mapping genes in meadowfoam glucosinolate metabolism
Myrosinase, a glucoside glucohydrolase that initiates the degradation of glucosinolates
upon tissue disruption, was encoded by Contig 572, a homologue of Arabidopsis TGG2
(At5g26000). Two haplotypes were present among the four ESTs, and three sets of SSCP
bands from parental DNAs (MF40-11 and MF64) and BC1 progeny indicated a small
multi-gene family. The myrosinase genes were localized to the upper end of LG2 (Fig. 1).
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
15/21
Contigs 183 and 184 were homologous to an Arabidopsis gene, EPITHIOSPECIFIER
MODIFIER1 (ESM1, At3g14210), that directs the glucosinolate hydrolysis pathway
towards isothiocyanate breakdown products (Zhang, Ober & Kliebenstein, 2006). Contigs
183 and 184 likely represent paralogous ESM1 genes as there were eight amino acid
differences between the deduced protein sequences. Contig 183-specific primers amplified
three polymorphic sequences from the mapping parent DNAs (Fig. S1), and LaESM1,2,3
genes were localized to the interior of LG3, co-segregating with LPAT2 (Fig. 1). Contig
184-specific primers produced a single set of non-polymorphic bands from each parent.
Glucosinolates are synthesized in maternal vegetative tissues and actively translocated
into developing seeds (Lykkesfeldt & Moller, 1993; Nour-Eldin et al., 2012). Consistent
with this we did not detect transcripts for glucosinolate biosynthetic enzymes in the
meadowfoam developing embryo library. However, because enhancing seed glucosinolate
content is a goal of meadowfoam breeding (Veslasco et al., 2011), we developed a marker for
CYP79A, the gene encoding the cytochrome P450 enzyme that catalyzes the rate-limiting
step in benzyl glucosinolate synthesis from phenylalanine (Wittstock & Halkier, 2000).
Primers designed to exclusively produce an intron-containing CYP79A gene fragment
generated a single polymorphic product that was localized to LG2 (Fig. 1).
CONCLUSIONS
Transcriptome analysis of meadowfoam embryos identified key genes essential to synthesis
of the unusual VLCFAs characteristic of Limnanthes seeds and indicated that the prevalence of Δ5 desaturation in meadowfoam TAG is due to an abundance of transcripts from
a small gene family encoding a specialized acyl-CoA desaturase. The presence of Kennedy
pathway acyl transferase transcripts (LPAT and DGAT) and absence of alternative enzymes
involved in TAG assembly such as lysophosphatidyl-chloline acyl transferase (LPCAT),
suggests that the classical acyl-CoA dependent pathway is predominant in meadowfoam.
This study located lipid and glucosinolate metabolic genes on the meadowfoam genetic
map, and uncovered gene-specific SSCP and SNP polymorphisms that can be used in
targeted molecular breeding to enhance this new oilseed crop.
ACKNOWLEDGEMENTS
We thank Dave Edwards (University of Queensland, AU) for performing the AutoSNP
analysis and Joanna Rosinska for assistance with SSR genotyping.
ADDITIONAL INFORMATION AND DECLARATIONS
Funding
Funding for this work was provided by USDA grant #99-34407-7509 to Dr. SJ Knapp and
by grants from the Oregon Meadowfoam Growers to Dr. Jennifer Kling. The funders had
no role in study design, data collection and analysis, decision to publish, or preparation of
the manuscript.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
16/21
Grant Disclosures
The following grant information was disclosed by the authors:
USDA: #99-34407-7509.
Oregon Meadowfoam Growers.
Competing Interests
Dr. Venkata Kishore is an employee of Monsanto. Additional authors declare there are no
competing interests.
Author Contributions
• Mary B. Slabaugh conceived and designed the experiments, performed the experiments,
analyzed the data, contributed reagents/materials/analysis tools, wrote the paper,
prepared figures and/or tables, reviewed drafts of the paper.
• Laurel D. Cooper conceived and designed the experiments, performed the experiments,
reviewed drafts of the paper.
• Venkata K. Kishore conceived and designed the experiments, performed the experiments, analyzed the data, contributed reagents/materials/analysis tools, wrote the paper.
• Steven J. Knapp conceived and designed the experiments, analyzed the data, contributed
reagents/materials/analysis tools, reviewed drafts of the paper.
• Jennifer G. Kling analyzed the data, contributed reagents/materials/analysis tools,
reviewed drafts of the paper.
Patent Disclosures
The following patent dependencies were disclosed by the authors:
Patent EP1790731, source of two sequences included in Fig. 2 and acknowledged in the
figure legend.
DNA Deposition
The following information was supplied regarding the deposition of DNA sequences:
GenBank, GI 166344198 through GI 166359570.
Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/
10.7717/peerj.915#supplemental-information.
REFERENCES
Aitzetmuller K, Matthaus B, Friedrich H. 2003. A new database for seed oil fatty acids—the
database SOFA. European Journal of Lipid Science and Technology 105:92–103
DOI 10.1002/ejlt.200390022.
Barker G, Batley J, O’Sullivan H, Edwards KJ, Edwards D. 2003. Redundancy based detection
of sequence polymorphisms in expressed sequence tag data using autoSNP. Bioinformatics
19:421–422 DOI 10.1093/bioinformatics/btf881.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
17/21
Banilas G, Karampelias M, Makariti I, Kourti A, Hatzopoulos P. 2011. The olive DGAT2 gene is
developmentally regulated and shares overlapping but distinct expression patterns with DGAT1.
Journal of Experimental Botany 62:521–532 DOI 10.1093/jxb/erq286.
Blacklock BJ, Jaworski JG. 2002. Studies into factors contributing to substrate specificity of
membrane-bound 3-ketoacyl-CoA synthases. European Journal of Biochemistry 269:4789–4798
DOI 10.1046/j.1432-1033.2002.03176.x.
Blacklock BJ, Jaworski JG. 2006. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases.
Biochemical and Biophysical Research Communications 346:583–590
DOI 10.1016/j.bbrc.2006.05.162.
Brown AP, Carnaby S, Brough C, Brazier M, Slabas AR. 2002. Limnanthes douglasii
lysophosphatidic acid acyltransferases: immunological quantification, acyl selectivity and
functional replacement of the Escherichia coli plsC gene. Biochemical Journal 364:795–805
DOI 10.1042/BJ20020071.
Brown J, Morra MJ. 2005. Glucosinolate-containing seed meal as a soil amendment to control
plant pests. Subcontract Report NREL/SR-510-35254. 1–95.
Burg DA, Kleiman R. 1991. Preparation of meadowfoam dimer acids and dimer esters and their
use as lubricants. Journal of the American Oil Chemists Society 68:600–603
DOI 10.1007/BF02660161.
Cahoon EB, Marillia E-F, Stecca KL, Hall SE, Taylor DC, Kinney AJ. 2000. Production of
fatty acid components of meadowfoam oil in somatic soybean embryos. Plant Physiology
124:243–251 DOI 10.1104/pp.124.1.243.
Cao Y-Z, Oo K-C, Huang AHC. 1990. Lysophosphatidate acyltransferase in the microsomes from
maturing seeds of meadowfoam (Limnanthes alba). Plant Physiology 94:1199–1206
DOI 10.1104/pp.94.3.1199.
Earle FR, Glass CA, Geisinger GC, Wolff IA. 1960. Search for new industrial oils IV. Journal of the
American Oil Chemists Society 37:440–447 DOI 10.1007/BF02631204.
Erhan SM, Kleiman R, Isbell TA. 1993. Estolides from meadowfoam oil fatty acids and other
monounsaturated acyl moieties in developing seeds. Journal of the American Oil Chemists
Society 70:460–465.
Ettlinger MG, Lundeen AJ. 1956. The mustard oil of Limnanthese douglasii seed, m-methoxy
isothiocyanate. Journal of the American Chemical Society 78:1952–1954
DOI 10.1021/ja01590a052.
Gandhi SD, Kishore VK, Crane JM, Slabaugh MB, Knapp SJ. 2009. Selection for low erucic
acid and genetic mapping of loci affecting the accumulation of very long-chain fatty acids
in meadowfoam seed storage lipids. Genome 52:547–556 DOI 10.1139/G09-032.
Heilmann I, Mekhedov S, King B, Browse J, Shanklin J. 2004. Identification of the Arabidopsis
palmitoyl-monogalactosyldiacylglycerol Δ7-desaturase gene FAD5, and the effects of plastidial
retargeting of Arabidopsis desaturases on the fad5 mutant phenotype. Plant Physiology
136:4237–4245 DOI 10.1104/pp.104.052951.
Isbell T. 1997. Development of meadowfoam as an industrial crop through novel fatty acid
derivatives. Lipid Technology 9:140–144.
Jadhav A, Marillia E-F, Babic V, Giblin EM, Cahoon EB, Kinney AJ, Mietkiewska E, Brost JM,
Taylor DC. 2005. Production of 22:2Δ5Δ13 and 20:1Δ5 in Brassica carinata and soybean
breeding lines via introduction of Limnanthes genes. Molecular Breeding 15:157–167
DOI 10.1007/s11032-004-4730-1.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
18/21
Jako C, Kumar A, Wei Y, Zou J, Barton DL, Giblin EM, Covello PS, Taylor DC. 2001.
Seed-specific over-expression of an Arabidopsis cDNA encoding a diacylglycerol acyltransferase
enhances seed oil content and seed weight. Plant Physiology 126:861–874
DOI 10.1104/pp.126.2.861.
Jasinski S, Lecureuil A, Miquel M, Loudet O, Raffaele S, Froissard M, Guerche P. 2012. Natural
variation in seed very long chain fatty acid content is controlled by a new isoform of KCS18 in
Arabidopsis thaliana. PLoS ONE 7:e49261 DOI 10.1371/journal.pone.0049261.
Jolliff GD, Tinsley IJ, Calhoun W, Crane JM. 1981. Meadowfoam (Limnanthes alba): its research
and development as a potential new oilseed crop for the Willamette Valley of Oregon, Agricultural
Experiment Station Oregon State University, Corvallis Station Bulletin, 648.
Joubes J, Raffaele S, Bourdenx B, Garcia C, Laroche-Traineau J, Moreau P, Domergue F,
Lessire R. 2008. The VLCFA elongase gene family in Arabidopsis thaliana: phylogenetic
analysis, 3D modeling and expression profiling. Plant Molecular Biology 67:547–566
DOI 10.1007/s11103-008-9339-z.
Katengam S, Crane JM, Slabaugh MB, Knapp SJ. 2001. Genetic mapping of a macro mutation
and quantitative trait loci underlying fatty acid composition differences in meadowfoam oil.
Crop Science 41:1927–1930 DOI 10.2135/cropsci2001.1927.
Kishore VK, Velasco P, Shintani DK, Rowe J, Rosato C, Adair N, Slabaugh MB, Knapp SJ. 2004.
Conserved simple sequence repeats for the Limnanthaceae (Brassicales). Theoretical and Applied
Genetics 108:450–457 DOI 10.1007/s00122-003-1447-1.
Knapp SJ, Crane JM. 1995. Fatty acid diversity of section Inflexae Limnanthes (meadowfoam).
Industrial Crops and Products 4:219–227 DOI 10.1016/0926-6690(95)00035-B.
Knapp SJ, Crane JM. 1999. Breeding advances and germplasm resources in meadowfoam: a very
long chain oilseed. In: Janick J, ed. Perspectives on new crops and new uses. Alexandria: ASHS
Press, 225–233.
Knapp SJ, Crane JM, Brunick R. 2005. Registration of ‘Ross’ meadowfoam. Crop Science
45:407 DOI 10.2135/cropsci2005.0407.
Lardizabal K, Effertz R, Levering C, Mai J, Pedroso MC, Jury T, Aasen E, Gruys K, Bennett K.
2008. Expression of Umbelopsis raranniana DGAT2A in seed increases oil in soybean. Plant
Physiology 148:89–96 DOI 10.1104/pp.108.123042.
Lassner MW, Charlene K, Levering CK, Davies HM, Knutzon DS. 1995. Lysophatidic acid
acyltransferase from meadowfoam mediates insertion of erucic acid at the sn-2 position of
triacylglycerol in transgenic rapeseed oil. Plant Physiology 109:1289–1394
DOI 10.1104/pp.109.4.1389.
Laurent P, Huang AHC. 1992. Organ- and development-specific acyl coenzyme A
lysophosphatidate acyltransferases in palm and meadowfoam. Plant Physiology 99:1711–1715
DOI 10.1104/pp.99.4.1711.
Li DF, Jiang P, Zhu DY, Hu Y, Max M, Wang DC. 2008. Crystal structure of mabinlin II: a novel
structural type of sweet protein and the main structural basis for its sweetness. Journal of
Structural Biology 162:50–62 DOI 10.1016/j.jsb.2007.12.007.
Lykkesfeldt J, Moller BL. 1993. Synthesis of benzylglucosinolate in Tropaeolum majus L. Plant
Physiology 102:609–613.
Mason CT. 1952. A systematic study of the genus Limnanthes. Bot Publ 25:455–512.
Mietkiewska E, Giblin EM, Wang S, Barton DL, Dirpaul J, Brost JM, Katavic V, Taylor DC.
2004. Seed-specific heterologous expression of a nasturtium FAE gene in Arabidopsis results
in a dramatic increase in the proportion of erucic acid. Plant Physiology 136:2665–2675
DOI 10.1104/pp.104.046839.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
19/21
Miller RW, Daxenbichler ME, Earle FR, Gentry HS. 1964. Search for new industrial oils: VIII.
The genus Limnanthes. Journal of the American Oil Chemists Society 41:167–169
DOI 10.1007/BF03024637.
Moreau RA, Pollard MR, Stumpf PK. 1981. Properties of a Δ5 fatty acyl-CoA desaturase in the
cotyledons of developing Limnanthes alba. Archives of Biochemistry and Biophysics 209:376–384
DOI 10.1016/0003-9861(81)90295-2.
Moser BR, Knothe G, Cermak SC. 2010. Biodiesel from meadowfoam (Limnanthes alba L.) seed
oil: oxidative stability and unusual fatty acid composition. Energy & Environmental Science
3:318–327 DOI 10.1039/b923740m.
Napier JA. 2007. The production of unusual fatty acids in transgenic plants. Annual Review of
Plant Biology 58:295–319 DOI 10.1146/annurev.arplant.58.032806.103811.
Nath UK, Wilmer JA, Wallington EJ, Becker HC, Möllers C. 2009. Increasing erucic acid content
through combination of endogenous low polyunsaturated fatty acids alleles with Ld-LPAAT
+ Bn-fae1 transgenes in rapeseed (Brassica napus L.). Theoretical and Applied Genetics
118:765–773 DOI 10.1007/s00122-008-0936-7.
Nour-Eldin HH, Andersen TG, Burow M, Madsen SR, Jorgensen ME, Olsen CE, Dreyer I,
Hedrich R, Geiger D, Halkier BA. 2012. NRT/PTR transporters are essential for translocation
of glucosinolate defence compounds to seeds. Nature 488:531–534 DOI 10.1038/nature11285.
Pollard MR, Stumpf PK. 1980. Biosynthesis of C20 and C22 fatty acids by developing seeds of
Limnanthes alba: chain elongation and Δ5 desaturation. Plant Physiology 66:649–655
DOI 10.1104/pp.66.4.649.
Sandager L, Stymne S. 2000. Characterisation of enzymes determining fatty acid chain length
in developing seeds of Limnanthes douglasii. Journal of Plant Physiology 156:617–622
DOI 10.1016/S0176-1617(00)80221-7.
Sayanova O, Haslam R, Caleron MV, Napier J. 2007. Cloning and characterization of unusual
fatty acid desaturases from Anemone leveilei: identification of an acyl-CoenzymeA
C20D5-desaturase responsible for the synthesis of sciadonic acid. Plant Physiology 144:455–467
DOI 10.1104/pp.107.098202.
Shockey JM, Gidda SK, Chapital DC, Kuan J-C, Dhanoa PK, Bland JM, Rothstein SJ, Mullen RT,
Dyer JM. 2006. Tung tree DGAT1 and DGAT2 have nonredundant functions in triacylglyerol
biosynthesis and are localized to different subdomains of the endoplasmid reticulum. The Plant
Cell 18:2294–2313 DOI 10.1105/tpc.106.043695.
Slabaugh MB, Huestis GM, Leonard J, Holloway JL, Rosato C, Hongtrakul V, Martini N,
Toepfer R, Voetz M, Schell J, Knapp SJ. 1997. Sequence-based genetic markers for genes and
gene families: single-strand conformational polymorphisms for the fatty acid synthesis genes of
Cuphea. Theoretical and Applied Genetics 94:400–408 DOI 10.1007/s001220050429.
Spinardi L, Mazars R, Theillet C. 1991. Protocols for improved detection of point mutations by
SSCP. Nucleic Acids Research 19:4009 DOI 10.1093/nar/19.14.4009.
Stevens JL, Reed RL, Alber S, Pritchett L, Machado S. 2009. Herbicidal activity of glucosinolate
degradation products in fermented meadowfoam (Limnathes alba) seed meal. Journal of
Agricultural and Food Chemistry 57:1821–1826 DOI 10.1021/jf8033732.
Taylor DC, Francis T, Lozinsky S, Hoffman T, Giblin M, Marillia E-F. 2010. Cloning and
characterization of a constitutive Lysophosphatidic acid acyltransferase 2 (LPAT2) gene from
Tropaeolum majus L. The Open Plant Science Journal 4:7–17
DOI 10.2174/1874294701004010007.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
20/21
Troncoso-Ponce MA, Kilaru A, Cao X, Durrett TP, Fan J, Jensen JK, Thrower NA, Pauly M,
Wilkerson C, Ohlrogge JB. 2011. Comparative deep transcriptional profiling of four developing
oilseeds. The Plant Journal 68:1014–1027 DOI 10.1111/j.1365-313X.2011.04751.x.
Van Ooijen JW. 2006. JoinMap 4, Software for the calculation of genetic linkage maps in
experimental populations. Kyazma BV, Wageningen. Available at http://www.kyazma.nl/index.
php/mc.JoinMap/.
Vaughn SF, Boydston RA, Mallory-Smith CA. 1996. Isolation and identification of
(3-methoxyphenyl)acetonitrile as a phytotoxin from meadowfoam (Limnanthes alba) seedmeal.
Journal of Chemical Ecology 22:1939–1949 DOI 10.1007/BF02028513.
Veslasco P, Slabaugh MB, Reed R, Kling J, Kishore VK, Stevens JF, Knapp SJ. 2011.
Glucosinolates in the new oilseed crop meadowfoam: natural variation in section I nf lexae
of Limnanthes, a new glucosinolate in L. floccosa, and QTL analysis in L. alba. Plant Breeding
130:352–359 DOI 10.1111/j.1439-0523.2010.01830.x.
Weselake RJ, Shah S, Tang M, Quant PA, Snyder QL, Furukawa-Stoffer TL, Zhu W, Taylor DC,
Zou J, Kumar A, Hall L, Laroche A, Rakow G, Raney P, Moloney MM, Harwood JL. 2008.
Metabolic control analysis is helpful for informed genetic manipulation of oilseed rape
(Brassica napus) to increase seed oil content. Journal of Experimental Botany 59:3543–3549
DOI 10.1093/jxb/ern206.
Wittstock U, Halkier BA. 2000. Cytochrome P450 CYP79A2 from Arabidopsis thaliana L.
catalyzes the conversion of l-phenylalanine to phenylacetaldoxime in the biosynthesis of
benzylglucosinolate. Journal of Biological Chemistry 275:14659–14666
DOI 10.1074/jbc.275.19.14659.
Wohlman A. 2001. Meadowfoam derivatives: technologically advanced cosmetic ingredients.
Journal of Cosmetic Science 52:149–150.
Zasada IA, Weiland JE, Reed RL, Stevens JF. 2012. Activity of meadowfoam (Limnanthes alba)
seed meal glucolimnanthin degradation products against soilborne pathogens. Journal of
Agricultural and Food Chemistry 60:339–345 DOI 10.1021/jf203913p.
Zhang Z, Ober JA, Kliebenstein DJ. 2006. The gene controlling the quantitative trait locus
EPITHIOSPECIFIER MODIFIER1 alters glucosinolate hydrolysis and insect resistance in
Arabidopsis. The Plant Cell 18:1524–1536 DOI 10.1105/tpc.105.039602.
Zheng P, Allen WB, Roesler K, Williams ME, Zhang S, Li J, Glassman K, Ranch J, Nubel D,
Solawetz W, Bhattramakki VL, Deschamps S, Zhong G-Y, Tarczynski MC, Shen B. 2008. A
phenylalanine in DGAT is a key determinant of oil content and composition in maize. Nature
Genetics 40:367–372 DOI 10.1038/ng.85.
Slabaugh et al. (2015), PeerJ, DOI 10.7717/peerj.915
21/21