LETTER
doi:10.1038/nature15730
Decapentaplegic and growth control in the
developing Drosophila wing
Takuya Akiyama1 & Matthew C. Gibson1,2
a
72 h AEL
120 h AEL
Ore R
ap>GFP
(Dpp n = 49, p-Mad n = 32; Extended Data Fig. 2). Surprisingly, however, loss of dpp at the compartmental boundary had minimal effects
on growth and cell proliferation in third-instar discs (n = 80; Extended
Data Fig. 2). We extended these results by generating larger dppd12
mutant clones using the Minute technique (M(2)25A; Fig. 1d–k)21,22.
Consistent with our conventional clonal analysis, extensive loss of the
Dpp stripe (n = 24) and its associated p-Mad activity gradient (n = 20)
did not strongly affect proliferation in adjacent cell populations (n = 44;
Fig. 1d–k). Indeed, only when clones were induced very early in development did we observe severely reduced wing discs.
The results described earlier indicate that the compartmental stripe
of Dpp expression is not essential for growth in third-instar wing
discs. However, dppd12 mutant clone analysis entails some limitations,
including the hypomorphic nature of the lesion and the lack of precise spatiotemporal control over clone induction. Thus, to eliminate
Dpp expression more precisely from the entire stripe domain, we used
CRISPR–Cas9-mediated homologous recombination to generate a conditional null allele that harbours FRT sequences flanking the first dpp
coding exon (dppFLP-OFF (dppFO); Fig. 2a, Extended Data Fig. 3a and
b
Dpp
kDa
100
75
c
ap>dpp
*
Pre
50
Pro
37
Tub
dpp-GAL4
*
50
dppd12
Control M+ (GFP negative)
M+ (GFP negative)
e
f
g
i
j
k
Dpp
d
Anti-Dpp
p-H3 Dpp GFP DNA
h
p-Mad
As a central model for morphogen action during animal
development, the bone morphogenetic protein 2/4 (BMP2/4)like ligand Decapentaplegic (Dpp) is proposed to form a longrange signalling gradient that directs both growth and pattern
formation during Drosophila wing disc development 1–6 .
While the patterning role of Dpp secreted from a stripe of cells
along the anterior–posterior compartmental boundary is well
established1,2,6, the mechanism by which a Dpp gradient directs
uniform cell proliferation remains controversial and poorly
understood7–13. Here, to determine the precise spatiotemporal
requirements for Dpp during wing disc development, we use
CRISPR–Cas9-mediated genome editing to generate a flippase
recognition target (FRT)-dependent conditional null allele. By
genetically removing Dpp from its endogenous stripe domain, we
confirm the requirement of Dpp for the activation of a downstream
phospho-Mothers against dpp (p-Mad) gradient and the regulation
of the patterning targets spalt (sal), optomotor blind (omb; also
known as bifid) and brinker (brk). Surprisingly, however, third-instar
wing blade primordia devoid of compartmental dpp expression
maintain relatively normal rates of cell proliferation and exhibit only
mild defects in growth. These results indicate that during the latter
half of larval development, the Dpp morphogen gradient emanating
from the anterior–posterior compartment boundary is not directly
required for wing disc growth.
Morphogens, signalling molecules secreted from a localized source to
form gradients of activity, are proposed to coordinately control growth
and patterning in diverse organismal systems1,2,6,14–17. In Drosophila
melanogaster, the BMP2/4-like ligand Dpp is highly expressed in a row
of cells at the anterior–posterior (A/P) compartment border in thirdinstar wing discs (72–120 h after egg laying (AEL); Fig. 1a). The
secreted ligand is proposed to emanate from this position to form a
long-range gradient that directs uniform growth and concentrationdependent patterning1–6. Although the requirements for Dpp in disc
patterning are widely accepted1,2,6, precisely how a gradient of Dpp
might direct homogenous cell proliferation is controversial7–13. The
general requirements for Dpp in growth are clear; imaginal discs fail
to develop in dpp mutant larvae18 and ectopic expression of Dpp is
sufficient to trigger overgrowth in lateral regions of the wing disc19.
Nevertheless, owing to a lack of methods for the detection and disruption of Dpp, the mechanism by which its downstream activity gradient
directs uniform cell proliferation remains unknown.
To visualize Dpp directly, we first generated a polyclonal antibody
(anti-Dpp) that recognizes the Dpp prodomain on western blots and
labels the expected compartmental stripe domain in fixed tissues
(Fig. 1b, c and Extended Data Fig. 1). Next, to validate the specificity
of anti-Dpp, we induced mitotic cell clones homozygous for the hypomorphic allele dppd12 (ref. 20). As expected, dppd12 mutant clones that
impinged on the stripe domain correlated with a pronounced reduction of Dpp and p-Mad levels, indicating that both Dpp expression
and the activity gradient downstream of Dpp signalling were abolished
p-Mad GFP DNA
Figure 1 | dppd12 mutant clones have little effect on wing disc growth.
a, Wing discs grow dramatically during the third larval instar (72–120 h
AEL). dpp-expressing cells are visualized with dpp-GAL4 > UAS-GFP
(red). Scale bar, 100 μ m. b, Anti-Dpp recognizes the Dpp precursor
(Pre) and prodomain (Pro) in western blots. An arrowhead indicates a
previously unidentified Dpp product. Asterisks indicate non-specific
bands. α -Tubulin (Tub): loading control. c, Dpp expression in wild-type
wing disc. Scale bar, 100 μ m. d–k, dppd12 mutant clones. Control (d, e, h, i)
and dppd12 mutant (f, g, j, k) clones were stained with anti-Dpp (d–g)
and anti-p-Mad (h–k). Phospho-histone 3 (p-H3; white) labels mitotic
cells (d, f). Scale bars, 50 μ m. Anterior is to the left in all figures.
1
Stowers Institute for Medical Research, Kansas City, Missouri 64110, USA. 2Department of Anatomy and Cell Biology, The University of Kansas School of Medicine, Kansas City, Kansas
66160, USA.
1 9 NOV E M B E R 2 0 1 5 | VO L 5 2 7 | NAT U R E | 3 7 5
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
dppFO-GFP
b
3
dppFO
a
3
4
5
ubi-GFP
dppFO/dppFO;
hs-FLP;dppFO/dppFO dpp-GAL4>FLP
6
Cre recombination
FRT
72 h AEL
d
96 h AEL
e
f
120 h AEL
Wild type
Anti-Dpp
Anti-Dpp
h
120 h AEL
(hs at 48 h)
120 h AEL
(hs at 48 h)
i
120 h AEL
(hs at 72 h)
j
120 h AEL
(hs at 96 h)
hs-FLP;dppFO/+
Anti-Dpp
m
*
NS
1.5
dppFO/dppFO;
dpp-GAL4>FLP
hs at 96 h
hs at 72 h
hs-FLP;
dppFO/dppFO
dppFO/+;
dpp-GAL4>FLP
Mitotic index
hs at 48 h
120 h
96 h
*
dppd12/dppd12
p
*
*
Wild type
o
*
NS
Relative disc area
72 h
1.2
1
0.8
0.6
0.4
0.2
0
Figure 2 | Eliminating the Dpp stripe causes
only mild growth defects. a, Design of dppFO.
b, General strategy for either global or stripespecific disruption of dpp through controlled
expression of the FLP recombinase. c–e, AntiDpp staining of wing discs during the third
instar. f, Anti-Dpp staining is lost in dppd12/
dppd12 mutant wing discs. g, Control wing disc
from hs-FLP; dppFO/+ larvae heat shocked at
48 h AEL. h–j, hs-FLP; dppFO/dppFO wing discs
show varying degrees of size reduction after
heat shock at the time points indicated. k–l, Dpp
stripe expression is maintained in controls
(k) but eliminated from the wing blade region
in dppFO/dppFO; dpp-GAL4/UAS-FLP wing discs
(l). Scale bars, 100 μ m. m, Size comparison
between wing discs of the genotypes indicated.
Mean ± standard deviation (s.d.). *P < 0.001,
not significant (NS), two-sided Student’s t-test.
n–o, Mitotic cells in dppFO/+; dpp-GAL4/UASFLP controls (n) and dppFO/dppFO; dpp-GAL4/
UAS-FLP (o) wing discs labelled with anti-p-H3
(green) and anti-Dpp (red). Scale bar, 50 μ m.
p, Mitotic index in dppFO/+; dpp-GAL4/UASFLP controls (n = 57) and dppFO/dppFO; dppGAL4/UAS-FLP (n = 54) wing discs. Mean ± s.d.
*P < 0.001, not significant (NS), two-sided
Student’s t-test.
1
0.5
0
dpp-GAL4>FLP
Anti-Dpp p-H3
120 h AEL
dppFO/dppFO;
Anti-Dpp
n
l
dppFO/+;
dpp-GAL4>FLP
120 h AEL
dppFO/dppFO;dpp-GAL4>FLP
k
dppFO/dppFO;dpp-GAL4>FLP
Anti-Dpp
dppFO/+;dpp-GAL4>FLP
120 h AEL
hs-FLP;dppFO/dppFO
g
dppFO/+;dpp-GAL4>FLP
FLP-OFF
dpp
6
4
dppd12/dppd12
c
5
FRT loxP
FLP
dpp
Methods). The dppFO allele is homozygous viable, and thus dpp-null
mutant cells can be generated in precise spatial and temporal patterns
by using controlled expression of the FLP recombinase to direct excision of the genomic region between the FRT sites (Fig. 2b and Extended
Data Figs 3b, 4a–d). Similar to previously characterized dpp mutants,
hs-FLP; dppFO/dppFO larvae exhibited severely reduced wing discs and
loss of anti-Dpp staining when subjected to heat-shock-induced disruption of dpp during early larval development at 48 h AEL (Fig. 2c–h, m).
We observed a similar loss of Dpp but less pronounced growth defects
after Dpp removal at later time points (72 and 96 h AEL), indicating
that there is a continuous requirement for dpp expression during wing
disc development (Fig. 2i–j, m).
To test specifically the requirements for the Dpp morphogen gradient
in disc growth, we used a disc-specific dpp-GAL4 to drive expression
of FLP in the compartmental stripe domain of dppFO/dppFO wing discs
(Fig. 2b). Under these conditions Dpp protein was eliminated from the
A/P compartmental boundary throughout the wing blade primordium
(n = 40; Fig. 2k, l and Extended Data Fig. 4e–k). Strikingly, however, the
affected discs were grossly normal in both size and overall morphology
(Fig. 2k–m). Some residual Dpp expression was detected in the posterior hinge, part of the ventral–anterior hinge and in some peripodial
cells in which dpp-GAL4 is not expressed (Fig. 2l, arrowheads, and
Extended Data Fig. 4i–k). In addition, small clusters of cells expressing Dpp were frequently observed in proximity to the dorso-ventral
boundary, perhaps due to reduced Gal4 expression (n = 27/40; Fig. 2l, o
and Extended Data Fig. 4i–k). However, consistent with the results of
dppd12 mosaic analyses (Fig. 1d–k and Extended Data Fig. 2), disruption
of the Dpp stripe caused only a mild growth defect relative to controls
(7% reduction of area; Fig. 2k–m), without any obvious effect on cell
proliferation (Fig. 2n–p). While we cannot rule out a contribution of
residual Dpp to the growth of dppFO/dppFO; dpp-GAL4/UAS-FLP wing
discs, these experiments suggest that there is no instantaneous growth
requirement for the canonical Dpp gradient centred on the A/P compartment boundary of the wing blade primordium.
To address the kinetics of dpp disruption in dppFO/dppFO; dpp-GAL4/
UAS-FLP discs, we monitored Dpp expression and p-Mad activity at
72, 96 and 120 h AEL (Fig. 3). Compared with controls (Fig. 3a, c), the
compartmental stripe of Dpp and its associated p-Mad activity gradient were disrupted in dppFO/dppFO; dpp-GAL4/UAS-FLP wing discs
dissected and fixed at 72 h AEL (Fig. 3b, d). The loss of Dpp and its
activity gradient became more pronounced by 96 h AEL, and persisted
as discs grew to a relatively normal size by 120 h AEL. Combined, these
observations are consistent with the results of dppd12 clonal analysis
(Fig. 1d–k and Extended Data Fig. 2) and further support the conclusion that a continuous Dpp gradient centred on the compartmental
stripe is not essential for proliferative growth in the third larval instar.
During wing disc development, p-Mad levels peak at the compartmental boundary and gradually diminish laterally (Fig. 4a)1,2. Upon
phosphorylation, Mad translocates to the nucleus to regulate the transcriptional targets Sal, Omb and Brk (Fig. 4b–d), which in turn define
the positions of the vein primordia visualized by anti-Delta (Dl) staining (Fig. 4e)23. In agreement with this general model for wing patterning downstream of Dpp, removal of the compartmental Dpp stripe
led to a pronounced loss of the p-Mad gradient (n = 37; Fig. 4f) and
3 7 6 | NAT U R E | VO L 5 2 7 | 1 9 NOV E M B E R 2 0 1 5
© 2015 Macmillan Publishers Limited. All rights reserved
dppFO/dppFO;dpp-GAL4>FLP
dppFO/+;dpp-GAL4>FLP
LETTER RESEARCH
a
96 h AEL
72 h AEL
c
120 h AEL
Anti-Dpp
120 h AEL
Anti-p-Mad
n = 24
b
96 h AEL
72 h AEL
n = 28
n = 40
n = 20
d
Anti-Dpp
n = 28
n = 37
Anti-p-Mad
Figure 3 | The Dpp gradient is not essential for growth in third instar
wing discs. a, b, Stripe Dpp expression is present in dppFO/+; dpp-GAL4/
UAS-FLP controls (a) but eliminated from dppFO/dppFO; dpp-GAL4/
UAS-FLP (b) wing discs during the third larval instar (72–120 h AEL).
c, d, The p-Mad activity gradient observed in dppFO/+; dpp-GAL4/UASFLP controls (c) is abolished in dppFO/dppFO; dpp-GAL4/UAS-FLP wing
discs during the third larval instar (d). Scale bars, 100 μ m.
the corresponding Sal (n = 25; Fig. 4g) and Omb expression domains
(n = 53; Fig. 4h). In addition, Brk expression was de-repressed throughout the wing pouch (n = 25; Fig. 4i) and patterning of presumptive
vein territories was disrupted in discs devoid of the Dpp stripe (n = 20;
Fig. 4j). Intriguingly, in the course of these experiments we also noted
that dpp disruption in dorsal cells led to a compartment-specific loss
of p-Mad that was not rescued by Dpp of ventral origin (Extended
Data Fig. 5). Likewise, dppd12 mutant clones adjacent to the dorsal–
ventral border resulted in a compartment-specific loss of p-Mad staining (Fig. 1j, k and Extended Data Fig. 2g, h), suggesting either that Dpp
protein is not able to cross the dorso-ventral boundary or that Dpp
movement is directionally regulated along the disc A/P axis.
Taken together, our results confirm that dpp is a crucial regulator
of wing disc pattern formation (Fig. 4a–j) but also demonstrate that
the canonical morphogen gradient is not continuously required for
growth and cell proliferation as the disc doubles in size during the third
larval instar (Figs 2k–p, 3 and Extended Data Fig. 4f–k). This implies
that the requirement for dpp in disc growth could either be fulfilled by
earlier functions of the pathway24 or by a cellular source of Dpp outside
the classical stripe domain. An important possibility in dppFO/dppFO;
dpp-GAL4/UAS-FLP discs is that an initial burst of Dpp expression at
the compartment boundary could precede FLP-mediated excision of
the dpp locus and provide a sufficient stimulus to initiate early disc
growth. Nevertheless, we found that global inactivation of dpp generated growth defects even at relatively late time points, consistent with
a continuous requirement (Fig. 2h–j). To probe potential sources of
Dpp expression outside of the stripe domain, we eliminated Dpp from
defined spatial territories using the Gal4/UAS system. While loss of
Dpp expression from whole discs or anterior cells alone elicited severe
growth phenotypes, elimination of Dpp from posterior cells showed
little or no effect (Extended Data Fig. 6a–d)25. Phenotypes caused by
Dpp elimination with both ap- and nub-GAL4 were consistent with
the interpretation that Dpp produced by anterior cells is necessary for
wing disc growth (Extended Data Fig. 6e, f), even though the compartmental stripe itself was not essential (Fig. 2l, o). To assess the
temporal requirements for dpp in anterior cells, we used GAL80ts to
repress ci-GAL4 activity (Fig. 4k–v and Extended Data Fig. 7)26. In wing
discs from dppFO/dppFO,ci-GAL4,UAS-GFP; UAS-FLP,tub-GAL80ts/+
larvae, Dpp expression was generally disrupted within 24 h of removing
Gal80-mediated repression of Gal4 (n = 34/40; Fig. 4o, p). Inactivation
p-Mad
Sal
b
c
g
h
Omb
Brk
d
e
i
j
Figure 4 | The Dpp stripe is crucial for wing
pattern formation. a–j, The p-Mad activity
gradient and BMP-dependent gene expression
domains observed in controls (a–e) are severely
disrupted following loss of the Dpp gradient in
dppFO/dppFO; dpp-GAL4/UAS-FLP wing discs
(f–j). Scale bar, 50 μ m. k–v, Dpp elimination
from the anterior compartment of wing discs
at a series of time points before dissection. In all
cases, dppFO/dppFO, ci-GAL4,UAS-GFP; UAS-FLP,
tub-GAL80ts/+ wing discs were stained for
anti-Dpp (red) and DNA (blue). Green
fluorescent protein (GFP; green) indicates
de-repressed Gal4 activity. Compared with
controls (k, l), normal Dpp expression is
maintained for 18 h after temperature shift
(m, n; n = 33) but mostly eliminated within 24 h
(o, p; n = 34/40). Normal Dpp staining is lost
after temperature shifts at 36 (q, r; n = 33), 48
(s, t; n = 80) and 72 (u, v; n = 43) h before
dissection. Scale bar, 100 μ m.
Dl
dppFO/+;
dpp-GAL4>FLP
(120 h AEL)
a
dppFO/dppFO;
dpp-GAL4>FLP
(120 h AEL)
f
dppFO/dppFO,ci-GAL4,UAS-GFP;
UAS-FLP,tub-GAL80ts/+
k
m
18 h
o
24 h
q
36 h
s
48 h
u
72 h
Dpp GFP DNA
l
n
p
r
t
v
Dpp
1 9 NOV E M B E R 2 0 1 5 | VO L 5 2 7 | NAT U R E | 3 7 7
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
of anterior dpp at earlier larval time points through temperature shifts
caused the most severe growth defects (Fig. 4s–v), but even late inactivation resulted in mildly reduced disc size (Fig. 4q, r). Although these
experiments offer limited temporal resolution, the results indicate that
Dpp produced within the ci-GAL4 expression domain is required for
wing disc growth throughout development. By inference, this would
indicate that Dpp expressed within the anterior compartment is sufficient to sustain homogenous disc growth in the absence of the canonical morphogen gradient during the third larval instar.
Drosophila Dpp has long served as a central paradigm for understanding how morphogens regulate growth and patterning during animal development. To date, several distinct models have been proposed
for imaginal disc growth control by the Dpp activity gradient7–13. We
directly tested the requirements for a gradient of Dpp signalling during wing disc development. Consistent with established dpp mutant
phenotypes and the critical temporal requirement for Dpp during early
development24, eliminating Dpp throughout the disc at early larval
stages caused severe growth defects (Fig. 2h). Surprisingly, however,
abrogation of the compartment-boundary-centred Dpp signalling
gradient did not disrupt active cell proliferation and elicited only mild
growth defects during the third larval instar (Figs 2k–p, 3 and Extended
Data Fig. 4f–k). In summary, while Dpp is clearly required for disc
growth, we propose that the classical Dpp morphogen gradient primarily regulates pattern formation and is not continuously required
to drive proliferative growth in the latter half of larval development.
These findings suggest dynamic spatial and temporal requirements
for Dpp. Expanding on our results, we speculate that other morphogen
systems may utilize a similar strategy to coordinate growth and patterning during organ and appendage development.
Online Content Methods, along with any additional Extended Data display items and
Source Data, are available in the online version of the paper; references unique to
these sections appear only in the online paper.
Received 13 March; accepted 14 September 2015.
Published online 9 November 2015.
1. Raftery, L. A. & Umulis, D. M. Regulation of BMP activity and range in
Drosophila wing development. Curr. Opin. Cell Biol. 24, 158–165 (2012).
2. Affolter, M. & Basler, K. The Decapentaplegic morphogen gradient: from
pattern formation to growth regulation. Nature Rev. Genet. 8, 663–674
(2007).
3. Lecuit, T. et al. Two distinct mechanisms for long-range patterning by
Decapentaplegic in the Drosophila wing. Nature 381, 387–393 (1996).
4. Nellen, D., Burke, R., Struhl, G. & Basler, K. Direct and long-range action of a
DPP morphogen gradient. Cell 85, 357–368 (1996).
5. Akiyama, T. & Gibson, M. C. Morphogen transport: theoretical and experimental
controversies. Wiley Interdiscip. Rev. Dev. Biol. 4, 99–112 (2015).
6. Restrepo, S., Zartman, J. J. & Basler, K. Coordination of patterning and growth
by the morphogen DPP. Curr. Biol. 24, R245–R255 (2014).
7. Rogulja, D. & Irvine, K. D. Regulation of cell proliferation by a morphogen
gradient. Cell 123, 449–461 (2005).
8. Rogulja, D., Rauskolb, C. & Irvine, K. D. Morphogen control of wing growth
through the Fat signaling pathway. Dev. Cell 15, 309–321 (2008).
9. Schwank, G., Restrepo, S. & Basler, K. Growth regulation by Dpp: an essential
role for Brinker and a non-essential role for graded signaling levels.
Development 135, 4003–4013 (2008).
10. Schwank, G. et al. Antagonistic growth regulation by Dpp and Fat drives
uniform cell proliferation. Dev. Cell 20, 123–130 (2011).
11. Schwank, G., Yang, S. F., Restrepo, S. & Basler, K. Comment on “Dynamics of
Dpp signaling and proliferation control”. Science 335, 401 (2012).
12. Wartlick, O. et al. Dynamics of Dpp signaling and proliferation control. Science
331, 1154–1159 (2011).
13. Day, S. J. & Lawrence, P. A. Measuring dimensions: the regulation of size and
shape. Development 127, 2977–2987 (2000).
14. Lecuit, T. & Le Goff, L. Orchestrating size and shape during morphogenesis.
Nature 450, 189–192 (2007).
15. Schwank, G. & Basler, K. Regulation of organ growth by morphogen gradients.
Cold Spring Harb. Perspect. Biol. 2, a001669 (2010).
16. Kicheva, A., Bollenbach, T., Wartlick, O., Jülicher, F. & Gonzalez-Gaitan, M.
Investigating the principles of morphogen gradient formation: from tissues to
cells. Curr. Opin. Genet. Dev. 22, 527–532 (2012).
17. Müller, P., Rogers, K. W., Yu, S. R., Brand, M. & Schier, A. F. Morphogen transport.
Development 140, 1621–1638 (2013).
18. Spencer, F. A., Hoffmann, F. M. & Gelbart, W. M. Decapentaplegic: a gene
complex affecting morphogenesis in Drosophila melanogaster. Cell 28,
451–461 (1982).
19. Zecca, M., Basler, K. & Struhl, G. Sequential organizing activities of engrailed,
hedgehog and decapentaplegic in the Drosophila wing. Development 121,
2265–2278 (1995).
20. St Johnston, R. D. et al. Molecular organization of the decapentaplegic gene in
Drosophila melanogaster. Genes Dev. 4, 1114–1127 (1990).
21. Morata, G. & Ripoll, P. Minutes: mutants of Drosophila autonomously affecting
cell division rate. Dev. Biol. 42, 211–221 (1975).
22. Domínguez, M., Wasserman, J. D. & Freeman, M. Multiple functions of the EGF
receptor in Drosophila eye development. Curr. Biol. 8, 1039–1048 (1998).
23. Blair, S. S. Wing vein patterning in Drosophila and the analysis of intercellular
signaling. Annu. Rev. Cell Dev. Biol. 23, 293–319 (2007).
24. Paul, L. et al. Dpp-induced Egfr signaling triggers postembryonic wing
development in Drosophila. Proc. Natl Acad. Sci. USA 110, 5058–5063 (2013).
25. Foronda, D., Pérez-Garijo, A. & Martín, F. A. Dpp of posterior origin patterns the
proximal region of the wing. Mech. Dev. 126, 99–106 (2009).
26. McGuire, S. E., Le, P. T., Osborn, A. J., Matsumoto, K. & Davis, R. L.
Spatiotemporal rescue of memory dysfunction in Drosophila. Science 302,
1765–1768 (2003).
Acknowledgements We thank G. Struhl and K. Wharton for extensive discussion
and suggestions, S. Kondo for technical advice with CRISPR, K. Irvine, W. Deng
and the Bloomington Stock Center for fly stocks, and R. Barrio, G. Pflugfelder,
A. Teleman and the Developmental Studies Hybridoma Bank for antibodies.
We thank K. Marr and L. Ellington for a critical reading of the manuscript,
L. Gutchewsky for administrative support, and members of the Gibson
laboratory for discussions and advice. This work was supported by funding
from the Stowers Institute for Medical Research.
Author Contributions T.A. and M.C.G. conceived the project, designed the
experiments and wrote the manuscript. T.A. performed the experiments and
analysed the data.
Additional Information Reprints and permissions information is available
at www.nature.com/reprints. The authors declare no competing financial
interests. Readers are welcome to comment on the online version of the paper.
Correspondence and requests for materials should be addressed to
M.C.G. (MG2@stowers.org).
3 7 8 | NAT U R E | VO L 5 2 7 | 1 9 NOV E M B E R 2 0 1 5
© 2015 Macmillan Publishers Limited. All rights reserved
LETTER RESEARCH
METHODS
Dpp antibody production. dpp complementary DNA was cloned into
pET-DEST42 (Invitrogen) using the GATEWAY system. The expression of Dpp–
His6 was induced by the addition of 1 mM isopropylthiogalactoside (IPTG) at an
OD600 nm of 0.5 in 1 l of LB media at 37 °C. After a 3 h induction, cells were harvested,
resuspended in 50 ml of denaturing buffer (50 mM Tris-HCl, 1 M NaCl, 20 mM
imidazole, 6 M urea, and 0.1% Triton X-100, pH 7.5) and disrupted by sonication.
The cell lysate was applied to a Ni Sepharose column for protein purification (GE
Health Care Life Sciences). The column was washed (50 mM Tris-HCl, 1 M NaCl,
6 M urea, and 0.1% Triton X-100, pH 7.5) and DPP-His6 proteins were eluted with
2 ml of elution buffer (50 mM Tris-HCl, 1M NaCl, 500 mM imidazole, 6M urea,
and 0.1% Triton X-100, pH 7.5). The purified protein was renatured by step-wise
reduction of urea concentration. The soluble fraction of the purified Dpp–His6
protein was used to immunize two rabbits pre-screened for low serum immunoreactivity against imaginal discs, one of which produced suitable antibodies.
Rabbit anti-sera against Dpp–His6 were affinity purified using the Dpp prodomain
(amino acids 1–456).
Clonal analyses of dppd12 mutant cells in wing discs. All flies were maintained
using standard cornmeal media at 25 °C. dppd12 is a strong hypomorphic allele that
carries a chromosomal inversion in the dppdisc enhancer region20. Mutant clones
were generated by the FLP-FRT method27 and marked by the absence of GFP
according to the following schemes. Control cross: y,w,hs-FLP; ubi-GFP,FRT40A/
CyO × w; FRT40A; experimental cross: y,w,hs-FLP; ubi-GFP,FRT40A/CyO × w; dppd12,FRT40A/CyO,twi-GAL4,UAS-GFP.
dppd12 clones in a Minute background21,22 were generated as follows. Control
cross: y,w,hs-FLP; ubi-GFP,M(2)25A,FRT40A/CyO × w; FRT40A; experimental
cross: y,w,hs-FLP; ubi-GFP,M(2)25A,FRT40A/CyO × w; dppd12,FRT40A/CyO,
twi-GAL4,UAS-GFP. Clones were induced at 37 °C for 2 h at 48 h AEL (standard)
or 72 h AEL (Minute).
Western blot analysis. Wing discs were homogenized in SDS sample buffer
and boiled. Protein samples were subjected to 4–20% Mini-PROTEAN TGX gel
(Bio-Rad) or 10% SDS–PAGE gel electrophoresis and then analysed by western blot with SuperSignal (Thermo). Rabbit anti-Dpp (1:1,000), mouse
anti-α -tubulin (1:1,000, Sigma) and horseradish peroxidase (HRP)-conjugated
secondary antibodies (1:10,000, Jackson ImmunoResearch) were used for
detection.
Generation of an FLP/FRT-mediated conditional dpp-null allele. pBFv-U6.2
(ref. 28) was used for making sgRNA DNA constructs. The following primers were
annealed and cloned into the BbsI site of pBFv-U6.2. sgRNA construct 1: 5′ -CTT
CGGTTCGGATGTGGACCGGAA-3′ , 5′ -AAACTTCCGGTCCACATCCGAA
CC-3′ ; sgRNA construct 2: 5′ -CTTCGGACAGAAGGATCTAGGGAT-3′ , 5′ -AA
ACATCCCTAGATCCTTCTGTCC-3′ .
To generate a ubi-GFP selection cassette, the 1,760 bp promoter region of
ubiqutin-63E was amplified from w1118 genomic DNA using 5′ -GGCGGCGAA
TTCATCAGTACTGTCCAAAATCGAAAATCGCCGAACCG-3′ and 5′ -GGC
GGCGGTACCTTTGGATTATTCTGCGGGAAGAAAATAGAGATGTGG-3′ primers with EcoRI and KpnI sites at the 5′ and 3′ ends, respectively (restriction
enzyme sites in primers are in bold). Then, the PCR product was cloned into the
EcoRI and KpnI sites of pH-Stinger29.
The Gibson assembly technique (NEB) was employed to obtain a donor DNA
for CRISPR–Cas9-mediated homologous recombination. First, five PCR fragments
were prepared using the following primer sets. Fragment 1 (pHSG298 vector):
5′ -CCGGGTACCGAGCTCGAA-3′ , 5′ -GGATCCTCTAGAGTCGACCTG-3′ ;
fragment 2 (left arm homology-FRT 5′ ): 5′ -AGGTCGACTCTAGAGGATCCCG
AAAGATCCCTTTGCGC-3′ ,5′ -TTATGATATCGAAGTTCCTATACTTTCTA
GAGAATAGGAACTTCGGAATAGGAACTTCGAATGGAATCGCGTTCGT
ATTCCACTCAATCC-3′ ; fragment 3 (loxP 5′ -ubi-GFP selection cassette-loxP
3′ ): 5′ -TAGGAACTTCGATATCATAACTTCGTATAGCATACATTATACGAA
GTTATTCGCCAAGCTTGGGCTGCATCACGTAATAAGTGTGCGTTG-3′ ,
5′ -ATGTGGACCGATAACTTCGTATAATGTATGCTATACGAAGTTATTTA
ACTTACATACATACTAGAATTGATCGGCTAAATGGTATGGC-3′ ; fragment
4 (dpp-FRT 3′ ): 5′ -ACGAAGTTATCGGTCCACATCCGAACCC-3′ , 5′ -AGGAT
CTAGGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAA
CTTCCATATGGATCGGCAGGTATGCAAATCGCTTAG-3′ ; fragment 5 (right
arm homology): 5′ -TAGGAACTTCCCTAGATCCTTCTGTCCTCG-3′ , 5′ -ATT
CGAGCTCGGTACCCGGGCGGGAATGCTCTTCACGTC-3′ .
After the PCR reaction, all fragments were purified using Zymoclean Gel DNA
Recovery kit (Zymo research) and subjected to Gibson assembly (NEB).
After confirming the DNA sequences, these plasmid DNAs were mixed,
precipitated by ethanol precipitation and dissolved in nuclease-free water with
food dye at 250 ng μ l−1 for each DNA construct. The DNA mixture was injected
into the posterior side of embryos obtained from a cross of w1118 and y,cho,v;
attP40{nos-Cas9}/CyO (ref. 28). Transgenic flies were first selected by GFP expression and were further confirmed by Southern blots, PCR and DNA sequencing.
Genomic Southern blot analysis. Genomic DNAs from w1118 and w; dppFO-GFP/
CyO adults were prepared as described previously30, digested with ClaI at 37 °C
for 4 h, and subjected to 0.7% agarose gel electrophoresis. After electrophoresis,
Southern blotting was performed using a standard protocol described previously31.
A DIG-labelled GFP probe was generated using DIG DNA labelling kit (Roche).
After hybridization at 65 °C overnight, hybridized DNA fragments were visualized
via alkaline phosphatase conjugated anti-Dig (1:5,000, Roche).
PCR analysis of FLP/FRT-mediated dpp knockdown. Fifty wing discs
from w; dppFO/dppFO and w; dppFO/dppFO; dpp-GAL4/UAS-FLP were collected to obtain genomic DNAs using Maxwell 16 system (Promega). Then,
PCR was carried out using 5′ -CCACCGATCCGCCTTATCGGAGG-3′ and
5′ -CGCCGCCTTCAGCTTCTCGTCG-3′ primers.
Heat shock. Control cross: y,w,hs-FLP; dppFO/CyO,sChFP x w1118; experimental
cross: y,w,hs-FLP; dppFO/CyO,sChFP x y,w,hs-FLP; dppFO/CyO,sChFP. dpp mutant
cells were induced by heat shock at 37 °C for 30 min at 48, 72 or 96 h AEL (ref. 32).
GAL4/UAS. dpp-GAL4 (dppblk-GAL4; GAL4 expression is controlled by a partial
dppdisc enhancer)33, en-GAL4 (ref. 34), ci-GAL4 (ref. 35), ap-GAL4 (ref. 36) and
nub-GAL4 (ref. 36) were used to induce FLP to eliminate Dpp expression from
specific regions of wing discs using the Gal4/UAS system (ref. 37). The efficiency
of FLP/FRT-mediated recombination was monitored by using Act5c(-FRT)lacZ
(ref. 38).
dpp-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; dpp-GAL4/
TM6B; experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; dppFO/
CyO,sChFP; dpp-GAL4/TM6C.
dpp-GAL4, Act5c(-FRT)lacZ. Control cross: w; dppFO/CyO,sChFP; UASFLP,Act5c(-FRT)lacZ/TM6C × dpp-GAL4/TM6B; experimental cross: w; dppFO/
CyO,sChFP; UAS-FLP,Act5c(-FRT)lacZ/TM6C × w; dppFO/CyO,sChFP; dpp-GAL4/
TM6C.
en-GAL4,ci-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; en-GAL4,ci-GAL4 (on II); experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/
TM6C × w; dppFO,en-GAL4,ci-GAL4/CyO,twi-GAL4,UAS-GFP.
en-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; en-GAL4
(on II); experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; dppFO,
en-GAL4/CyO,twi-GAL4,UAS-GFP.
ci-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; ci-GAL4
(on II); experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; dppFO,ci-GAL4/CyO,twi-GAL4,UAS-GFP.
ci-GAL4, tub-GAL80 ts . Control cross: w; dpp FO/CyO,sChFP; UAS-FLP,
tub-GAL80ts/TM6C × ci-GAL4,UAS-GFP (on II); experimental cross: w; dppFO/
CyO,sChFP; UAS-FLP,tub-GAL80ts/TM6C × w; dppFO,ci-GAL4,UAS-GFP (on II).
ap-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; ap-GAL4/
T2;3; experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; dppFO,
ap-GAL4/CyO,twi-GAL4,UAS-GFP.
nub-GAL4. Control cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w; nubGAL4 (on II); experimental cross: w; dppFO/CyO,sChFP; UAS-FLP/TM6C × w;
dppFO,nub-GAL4/CyO,twi-GAL4,UAS-GFP.
Immunohistochemistry and imaging. Immunostaining of wing discs was carried
out as previously described39 with some modifications. Rabbit anti-Dpp (1:100),
mouse anti-p-H3 (1:1,000, Millipore), mouse anti-Dlg (1:500, DSHB), mouse
anti-β -galactosidase (Z3781, 1:200, Promega), rabbit anti-pSmad3 (EP823Y,
1:1,000, Epitomics)40,41, rat anti-Sal (1:200)42, rabbit anti-Omb (1:1,000)43, guinea
pig anti-Brk (1:500)44, mouse anti-Dl (C594.9B, 1:500, DSHB)45, and Alexaconjugated secondary antibodies (1:500, Invitrogen) were used for this study.
All primary antibodies were diluted in Can Get Signal Immunostain Solution
B (TOYOBO). DNA was visualized using Hoechst 33342 (1:1,000; Thermo
Scientific). Images of wing discs were obtained using a Leica TCS SP5 confocal
microscope.
Image analysis. Sizes of wild-type wing discs at 72 h (n = 61), 96 h (n = 57) and
120 h AEL (n = 84) were measured using the ‘measure’ function of FIJI and analysed using Student’s t-test. The same method was used to measure discs of the
following genotypes: dppd12/dppd12 (n = 25), hs-FLP; dppFO/dppFO (heat shocked
at 48 h (n = 23), 72 h (n = 22) and 96 h AEL (n = 26)), dppFO/+; dpp-GAL4/
UAS-FLP (n = 187) and dppFO/dppFO; dpp-GAL4/UAS-FLP (n = 252). Mitotic
index was determined by dividing the numbers of mitotic cells (p-H3-positive
cells) by total cell numbers (visualized by anti-Dlg staining) in a 30.03 μ m square
in the anterior–ventral wing pouch region. The ‘find maxima’ function of FIJI
was used to automatically count total cell numbers. No statistical methods were
used to predetermine sample size. The experiments were not randomized. The
investigators were not blinded to allocation during experiments and outcome
assessment.
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
27. Xu, T. & Rubin, G. M. Analysis of genetic mosaics in developing and adult
Drosophila tissues. Development 117, 1223–1237 (1993).
28. Kondo, S. & Ueda, R. Highly improved gene targeting by germline-specific
Cas9 expression in Drosophila. Genetics 195, 715–721 (2013).
29. Barolo, S., Carver, L. A. & Posakony, J. W. GFP and β -galactosidase
transformation vectors for promoter/enhancer analysis in Drosophila.
Biotechniques 29, 726, 728, 730, 732 (2000).
30. Huang, A. M., Rehm, E. J. & Rubin, G. M. Quick preparation of genomic DNA
from Drosophila. Cold Spring Harb. Protoc. 2009, pdb.prot5198 (2009).
31. Brown, T. Southern blotting. Curr. Protoc. Mol. Biol. Chapter 2, Unit2 9A (2001).
32. Golic, K. G. & Lindquist, S. The FLP recombinase of yeast catalyzes site-specific
recombination in the Drosophila genome. Cell 59, 499–509 (1989).
33. Staehling-Hampton, K., Jackson, P. D., Clark, M. J., Brand, A. H. & Hoffmann, F. M.
Specificity of bone morphogenetic protein-related factors: cell fate and gene
expression changes in Drosophila embryos induced by decapentaplegic but
not 60A. Cell Growth Differ. 5, 585–593 (1994).
34. Johnson, R. L., Grenier, J. K. & Scott, M. P. patched overexpression alters wing
disc size and pattern: transcriptional and post-transcriptional effects on
hedgehog targets. Development 121, 4161–4170 (1995).
35. Croker, J. A., Ziegenhorn, S. L. & Holmgren, R. A. Regulation of the Drosophila
transcription factor, Cubitus interruptus, by two conserved domains. Dev. Biol.
291, 368–381 (2006).
36. Calleja, M., Moreno, E., Pelaz, S. & Morata, G. Visualization of gene expression
in living adult Drosophila. Science 274, 252–255 (1996).
37. Brand, A. H. & Perrimon, N. Targeted gene expression as a means of altering
cell fates and generating dominant phenotypes. Development 118, 401–415
(1993).
38. Struhl, G. & Basler, K. Organizing activity of wingless protein in Drosophila.
Cell 72, 527–540 (1993).
39. Akiyama, T. et al. Dally regulates Dpp morphogen gradient formation by
stabilizing Dpp on the cell surface. Dev. Biol. 313, 408–419 (2008).
40. Akiyama, T., Marqués, G. & Wharton, K. A. A large bioactive BMP ligand with
distinct signaling properties is produced by alternative proconvertase
processing. Sci. Signal. 5, ra28 (2012).
41. Dejima, K., Kanai, M. I., Akiyama, T., Levings, D. C. & Nakato, H. Novel
contact-dependent bone morphogenetic protein (BMP) signaling mediated by
heparan sulfate proteoglycans. J. Biol. Chem. 286, 17103–17111 (2011).
42. Barrio, R. & de Celis, J. F. Regulation of spalt expression in the Drosophila wing
blade in response to the Decapentaplegic signaling pathway. Proc. Natl Acad.
Sci. USA 101, 6021–6026 (2004).
43. Shen, J., Dahmann, C. & Pflugfelder, G. O. Spatial discontinuity of optomotorblind expression in the Drosophila wing imaginal disc disrupts epithelial
architecture and promotes cell sorting. BMC Dev. Biol. 10, 23 (2010).
44. Doumpas, N. et al. Brk regulates wing disc growth in part via repression of Myc
expression. EMBO Rep. 14, 261–268 (2013).
45. Bangi, E. & Wharton, K. Dpp and Gbb exhibit different effective ranges in the
establishment of the BMP activity gradient critical for Drosophila wing
patterning. Dev. Biol. 295, 178–193 (2006).
© 2015 Macmillan Publishers Limited. All rights reserved
LETTER RESEARCH
Extended Data Figure 1 | Endogenous Dpp expression in imaginal
discs. a–f, Wing (a, b), eye–antenna (c, d), and leg (e, f) imaginal discs
from UAS-GFP/+; dpp-GAL4/+ larvae are dissected and stained with
anti-Dpp antibody. GFP (green) indicates dpp-GAL4-expressing cells.
Note that dpp-GAL4 is not expressed in the morphogenetic furrow of the
third instar eye–antenna disc (arrow in d). Dotted lines show outlines of
imaginal discs. Blue: DNA. Scale bars, 100 μ m. Anterior is left.
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
Extended Data Figure 2 | Dpp and p-Mad expression in dppd12 clones. a–h, Control (a, b, e, f) and dppd12 mutant (c, d, g, h) clones are stained with
anti-Dpp (a–d) and anti-p-Mad (e–h) antibodies. Clones are marked by the absence of GFP (green). Disc boundaries are indicated by dotted lines. Scale
bars, 50 μ m. Anterior is to the left.
© 2015 Macmillan Publishers Limited. All rights reserved
LETTER RESEARCH
Extended Data Figure 3 | FLP/FRT-mediated conditional dpp-null
allele. a, A flowchart describing the establishment of an FLP/FRTmediated conditional dpp-null allele. Grey and white boxes indicate
untranslated region (UTR) and dpp coding sequences, respectively. FRT
sequences flank the first coding exon (exon 5). Since this exon contains the
Dpp start codon and almost half of its coding sequence (the first 288/588
amino acids), FLP/FRT mediated recombination is predicted to yield a
null allele. b, dppFO-GFP heterozygous, dppFO heterozygous, and dppFO
homozygous adult flies. Importantly, dppFO homozygous animals have
normal adult morphology.
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
Extended Data Figure 4 | Validation of an FLP/FRT-mediated
conditional allele. a, FRT 5′ -loxP and FRT 3′ genomic regions are
sequenced. b, Southern blot analysis of dppFO-GFP. Genomic DNAs
from w1118 and dppFO-GFP are digested by ClaI and are subjected to
Southern blot analysis using a GFP probe. c, Molecular confirmation of
the FLP/FRT-mediated dpp FLP-OFF system. As expected, an FLP-OFF
product (2,349 bp PCR fragment) is only detected in the dppFO/dppFO;
dpp-GAL4/UAS-FLP lane. Asterisk indicates a non-specific PCR product.
d, Biochemical evidence of the FLP/FRT-mediated dpp FLP-OFF system.
y,w,hs-FLP; dppFO/dppFO larvae are incubated at 37 °C for 30 min at 96 h
AEL to eliminate Dpp expression. After 24 h, wing discs are homogenized
in SDS sample buffer and analysed by western blot analysis with anti-Dpp.
Non-specific bands are indicated by an asterisk. Anti-α -tubulin is used
as a loading control. e, A system to visualize the efficiency of FLP/FRTmediated recombination. f–k, dppFO/+; dpp-GAL4/UAS-FLP,Act5c(-FRT)
lacZ controls (f, g, h) and dppFO/dppFO; dpp-GAL4/UAS-FLP,Act5c(-FRT)
lacZ (i, j, k) wing discs are stained with anti-Dpp and β -galactosidase
antibodies. The lineage of dpp-GAL4-expressing cells is visualized by
anti-β -galactosidase staining. Scale bar, 100 μ m. Anterior is left.
© 2015 Macmillan Publishers Limited. All rights reserved
LETTER RESEARCH
Extended Data Figure 5 | p-Mad staining of wing discs lacking dpp
function in the dorsal compartment. a–d, dppFO/ap-GAL4,UAS-GFP;
UAS-FLP/+ (a, b) and dppFO/dppFO,ap-GAL4,UAS-GFP; UAS-FLP/+
(c, d) are dissected and stained with anti-p-Mad antibody. The dorsoventral boundaries are indicated by green dotted lines. Yellow dotted lines
show the disc areas. Scale bar, 50 μ m.
© 2015 Macmillan Publishers Limited. All rights reserved
RESEARCH LETTER
Extended Data Figure 6 | Elimination of Dpp from specific regions of
wing discs. a–f, Anti-Dpp antibody staining of wild-type (a), dppFO,
ci-GAL4,en-GAL4/dppFO; UAS-FLP/+ (b), dppFO,en-GAL4/dppFO;
UAS-FLP/+ (c), dppFO,ci-GAL4/dppFO; UAS-FLP/+ (d), dppFO,ap-GAL4/dppFO;
UAS-FLP/+ (e), and dppFO,nub-GAL4/dppFO; UAS-FLP/+ (f). Gal4expressing domains are highlighted in grey in each illustration. Wing disc
boundaries are shown by dotted lines. Scale bar, 100 μ m. Anterior is left.
© 2015 Macmillan Publishers Limited. All rights reserved
LETTER RESEARCH
Extended Data Figure 7 | Spatiotemporal Dpp removal from the
anterior region of wing discs. a, A strategy for temporal Dpp elimination
from the anterior compartment of wing discs using the GAL80ts system.
At 18 °C, Gal4 activity is blocked by Gal80. When flies are kept at 29 °C
(non-permissive temperature for GAL80ts), Gal4 induces expression of
FLP and GFP. b, Timing of temperature shift. Larvae are reared at 18 °C,
and are transferred to 29 °C at the indicated time points before dissection.
c–f, dppFO/ci-GAL4,UAS-GFP; UAS-FLP,tub-GAL80ts/+ controls are
stained with anti-Dpp. Gal4 activity is monitored by GFP expression.
Scale bar, 100 μ m. g, Size comparison between wing discs: dppFO/ci-GAL4,
UAS-GFP; UAS-FLP,tub-GAL80ts/+ (0 (n = 21) and 72 h (n = 40) before
dissection) and dppFO/dppFO,ci-GAL4,UAS-GFP; UAS-FLP,tub-GAL80ts/+
(0 (n = 36), 18 (n = 33), 24 (n = 40), 36 (n = 33), 48 (n = 80) and 72 h
(n = 43) before dissection). Mean ± s.d. * P < 0.001, not significant (NS),
two-sided Student’s t-test.
© 2015 Macmillan Publishers Limited. All rights reserved