doi: 10.1046/j.l471-8286.2003.00415.x
Molecular Ecology Notes (2003) 3,253-255
PRIMER NOTE
N ew microsatellite markers for the endem ic Mediterranean
seagrass Posidonia oceanica
F. A L B E R T O ,* L . C O R R E IA ,* S . A R N A U D - H A O N D ,* C . B IL L O T ,*^ C . M . D U A R T E + a n d E . S E R R Ä O *
*CCMAR — Center for Marine Sciences, F.C.M.A.- University Algarve, Gambetas, P-8005-139, Faro, Portugal, FIMEDEA
(CSIC-UIB), C/Miquel Marques 21, 07190 Esporles, Mallorca, Spain
Abstract
The seagrass Posidonia oceanica is endemic to the Mediterranean Sea, where it plays an
important role in coastal ecosystem dynamics. Because of this important role and concerns
about the observed regression of some meadows, population genetic studies of this species
have been promoted. However, the markers used until now were not polymorphic enough
to efficiently assess the level and spatial pattern of genetic variability. Hypervariable
molecular markers were obtained by screening a genomic library enriched for microsatellite
dinucleotide repeats. Among 25 primer pairs defined, eight amplified polymorphic micro­
satellites with an encouraging level of variability at the two geographical scales sampled.
Keywords: clonal plant, dinucleotides, m icrosatellites, Posidoniaceae, seagrass
Received 4 December 2002; revision accepted 17 January 2003
The endem ic seagrass Posidonia oceanica plays an im portant
role in coastal ecosystem dynam ics in the M editerranean
Sea. H ow ever, anthropogenic p erturbations such as pollu­
tion, m odifications of coastal areas or introduction of new
species have led to w idespread regression of the species
(e.g. D uarte 2002). The threats to this species have led to an
interest in genetic studies, aim ed at elucidating the genetic
variability an d the level of gene flow w ithin an d betw een
populations, as a basis for conserving an d m anaging P.
oceanica along M editerranean coasts.
Posidonia oceanica is a clonal p lant th at can reproduce
either sexually by seed p roduction or asexually by vegeta­
tive propagation of rhizom es. The first studies based on
allozym es an d RAPD techniques revealed very low poly­
m orphism , preventing the efficient stu d y of genetic vari­
ability a n d gene flow (C apiom ont et al. 1996; Procaccini
& M azella 1996). Six p o lym orphic m icrosatellites w ere
isolated (Procaccini & W aycott 1998), m ostly presenting
trinu cleo tid e (but som etim es irregular) m otifs, w hich
w ere lim ited in their capacity to resolve genetic structure
relative to th a t expected from hyperv ariab le m arkers
(Procaccini & M azzella 1998; Procaccini etal. 2001). In
C orrespondence: F. Alberto. Fax: (351)-289 818353, Tel. (351)-289800928; E-mail: falberto@ ualg.pt
^Present address: CIRAD-BIOTROP, A venue A gropolis, T A 40/
03, 34398 M ontpellier C edex 5, France.
© 2003 Blackwell Publishing Ltd
o rd er to determ ine w hether the low level of genetic vari­
ability of the species suggested by the use of these m arkers
is unam biguously attributable to a biological feature of this
clonal species, or, rather, reflects the lim itations of the micro­
satellites isolated, w e isolated new m icrosatellites w ith
dinucleotide repeats.
G enom ic D N A w as isolated from a fresh m eristem atic
p o rtion of P. oceanica leaves, follow ing stan d ard cetyltrim e­
thyl am m o n iu m brom ide (CTAB) extraction procedures,
a n d w as digested w ith Afal (Rsal) (A m ersham Pharm acia
Biotech). Total digested D N A w as purified an d ligated into
annealed Afal ad ap to rs (AdapF: 5'-TCTTGCTTACGCGTGGACTA-3' an d A dapR: 5'-TAGTCCACGCGTAAGC A AG AGC AC A -3').
The enrichm ent procedure u sed streptavidin-coated
m agnetic particles (M agnesphere, Prom ega) an d follow ed
the protocol from Billote et al. (1999) b ased on m odifica­
tions from the original (Kijas et al. 1994). A 5'-biotinylated
w ith a p ro b e 3'-dideoxyC w as u se d to av o id p ro d u ctio n
of chim eric clones (Koblízková etal. 1998). The enriched
single-stranded D N A w as am plified by polym erase chain
reaction (PCR) using the A daptF as a prim er to recover
d o uble-stranded DNA. The d o uble-stranded D N A w as
quantified an d ligated into the pGEM-T Easy vector
(Promega). The ligation w as transform ed into Escherischia
coli cells (strain D H 5a). A bout 730 colonies containing an
insert of P. oceanica w ere transferred from the agar plates
254 PRIMER
NOTE
Table 1 C haracterization of eight m icrosatellite loci, including locus nam e, repeated m icrosatellite m otif, G enBank accession n um ber, annealing tem perature (Ta), approxim ate allele size
(bp) and n u m b er of alleles detected on a sam ple of nine populations, n um ber of alleles a n d expected (HE) a n d observed (iT0) heterozygosity estim ated in one n atu ral p opulation are given
for each locus
(°C)
(P m )
A pprox.
size range
of alleles
(bp)
N o. of
alleles in 9
m eadow s of
P. oceanica
No. of
alleles in
Form entera
m eadow s
Locus
M icrosatellite
m otif
Prim er sequences (5'-3')
GenBank
accession
no.
Po-5
(g a )20
CACAATGGCCCGGTAGCA
AF547650
64-52
2.5
164-188
6
4
0.43
0.48
AF547651
55
1.5
151-179
8
4
0.60
0.94
AF547652
54
1.5
170-182
6
5
0.57
0.37
AF547653
55
1.5
186-258
21
8
0.75
0.80
AF547654
55
1.5
218-242
8
2
0.11
0.11
AY152814
55
1.5
137-171
13
3
0.57
0.77
AF547656
51
1.5
158-178
7
7
0.69
0.74
AF547657
55-50
1.5
185-197
4
3
0.21
0.17
M gCl2
H0
GTGGTTGCGTGCCTTCGGTTG
Po5-10
(g a )13
ATGAGACTCCCACAATAACA
© 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 253-255
CATGGGAAGGTATAGAAGC
Po5-39
(g a )13
CATTTGGCTGAGTCCCTTTC
GTCCAAGGCTTCCGTGATGG
Po5-10
(g a )24
AAAACCAACCCCCACGATAAG
AATCCAAAGGAACGACACTCA
Po5-19
(g a )16
GGCTCGATGGTGCATTTCAGC
GCCATTCTCCGCTCTGCTCC
Pol5
(g a )20
AAGCACGCCGCTTAAACCATA
CATGTTAGTAGGCAATATACTAGGC
Po4-3
(GA)10
ACAGAAACTACGAACCATCAG
TAAGGAGAAGGAGAAGGAAA
Po4-36
(AG)7N(AG)22
ATGAAATAGAGAGCÄAGTCA
TAAGCAGACATAAAGAGAGG
P R IM E R N O T E 255
into m icroplates containing 150 |iL LB-Ampicilin solution,
a n d w ere incubated for 4 h at 37 °C. Subsequently, the
grow n colonies w ere diluted 5x in Sigma W ater on new
m icroplates an d h eated for 10 m in to induce cell lysis. The
size of inserts w as estim ated by agarose gel electrophoresis
of PCR products of sta n d ard M13 an d reverse prim ers
flanking pGEM-T easy polylinker. Gels w ere p h o to ­
g rap h ed an d Alkaline S outhern transferred onto nylon
m em branes (Hybond-N ; A m ersham Pharm acia Biotech).
H ybridization w as carried o u t w ith a 32P-radiolabelled
(CT)15 probe (Cregan et al. 1994). A bout 20% of the clones
sequenced contained m icrosatellites. Plasm ids from the
p o sitive clones w ere extracted u sin g th e W izard Plus
m iniprepD N A (Promega) purification system . From these,
73 w ere sequenced com m ercially (MWG-Biotech AG) an d
25 prim er pairs w ere designed using p r i m e r 3 softw are
(Rozen & Skaletsky 2000).
M icrosatellite polym orphism w as analysed by specific
PCR at tw o population levels. Forty individuals random ly
collected inside an apparently hom ogeneous 800 m 2 area
of a m eadow located at 10 m d ep th in the island of Form entera (Balearic Islands, Spain) w ere first analysed to
assess the level of intrapopulation variability (num ber of
alleles, heterozygosity an d clonal resolution), an d then five
sam ples from nine geographically separated sites (from
Greece to Spain) w ere screened to estim ate allelic diversity
across a b roader geographical range.
Prim ers w ere first tested using touchdow n PCR
(described below), an d the sam e PCR conditions as those
described above w ere used for am plifying sam ples from
n atural populations, except specific Ta optim ization for
som e of those nine loci (Table 1). The 10 pL PCR reaction
m ixture contained 10-50 ng of tem plate DNA, 1 |x m of each
locus specific prim er (Table 1), 60 |i m of each dCTP, dGTP
a n d dTTP, 10 |1M of dATP an d 0.08 |iL of [a33S]-dATP
(12.5 m C i/m L , 1250 Ci/nM ), 2.5 mM of MgCl2 (see Table 1
for locus optim izations), 1 |iL of lOx Taq D N A polym erase
PCR buffer (200 mM Tris-HCl p H 8.4), 500 mM KC1 an d 0.5
u nits of Taq D N A polym erase (Invitrogen, Life technolo­
gies). After a denaturing step of 4 m in at 94 °C, sam ples
w ere processed through 24 cycles consisting of 30 s at
94 °C, 30 s at 64 °C (reduced by 0.5 °C each subsequent
cycle) an d 30 s at 72 °C, an d 10 additional cycles consisting
of 30 s at 94 °C, 30 s at 52 °C an d 40 s a t 72 °C. A final elon­
gation step w as perform ed at 72 °C for 10 min. All PCRs
w ere perform ed on a G eneA m p therm ocycler 9700 (PE
A pplied Biosystems). PCR products w ere fractioned over a
denaturing 6% acrylam ide-bisacrylam ide gel and visualized
using autoradiography.
Of the 25 loci isolated, eight w ere polym orphic, exhibit­
ing from tw o to 12 alleles (Table 1). The num ber of alleles
© 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 253-255
a n d the level of heterozygosity w ere relatively high for
m ost of the m arkers (Table 1) an d allow ed detection of 24
genets am ong the 35 sam ples analysed from the n atural
pop u latio n of Form entera. N o deviation from H a rd y W einberg equilibrium an d no linkage disequilibrium w ere
detected w hen excluding from the sam ple the replicates of
the sam e clone (i.e. ram ets issued of the sam e genet).
A cknowledgem ents
This w ork w as su p p o rted b y the ESF/FCT th ro u g h a doctoral
(F.A.) and tw o postdoctoral (C.B. a n d S.A.) fellow ships, a n d by the
E uropean U nion project EVK3-CT-2000-00044 'M onitoring and
M anagem ent of E uropean Seagrass Beds (M & MS)'. W e thank E.
D iaz-Alm ela, R. Santiago a n d E. A lvarez for help w ith sam ple col­
lection, G Procaccini for p roviding east M editerranean sam ples
a n d Sara Teixeira for technical help.
References
Billote N , L agoda PJL, Risterucci A, B aurens F (1999) M icrosatel­
lite enriched libraries: applied m ethodology for the develop­
m ent of ISSR m arkers in tropical crops. Fruits, 54, 277-288.
C apiom ont A, Sandm eier M, Caye G, M einesz A (1996) E nzym e
polym orphism in Posidonia oceanica, a seagrass endem ic to the
M editeranean. Aquatic Botany, 54, 265-277.
C regan PB, B hagw at AA, A kkay MS, B om gw en J (1994) M icrosat­
ellite m apping and fingerprinting in soybean. M ethod. Molecular
and Cellular Biology, 5,49-61.
D uarte CM (2002) The future of seagrass m eadow s. Environmental
Conservation, 29,192-206.
Kijas JMH, Fow ler JCS, G arbett CA, Thom as MR (1994) Enrichm ent
of microsatellites from the citrus genom e using biotinylated oligo­
nucleotide sequences b o u n d to streptavidin-coated m agnetic
particles. Biotechniques, 16, 657-662.
Koblízková A, Dolezel J, M acas J (1998) Subtraction w ith 3' m odi­
fied oligonucleotides elim inates am plification artifacts in DN A
libraries enriched for m icrosatellites. Biotechniques, 25, 32-38.
Procaccini G, M azella L (1996) G enetic v ariability a n d re p ro ­
duction in tw o M editerranean seagrasses. In: Seagrass Biology.
Proceedings of an International Workshop, Rottnest Island, Western
Australia, pp. 85-92.
Procaccini G, M azzella L (1998) P opulation genetic structure and
gene flow in the seagrass Posidonia oceanica assessed using m icro­
satellite analysis. Marine Ecology Progress Series, 169,133-141.
Procaccini G, O rsini L, R uggiero MV, Scardi M (2001) Spatial
patterns of genetic diversity in Posidonia oceanica, a n endem ic
M e d ite rran e a n seagrass. Molecular Ecology, 10,1413-1421.
Procaccini G, W aycott M (1998) M icrosatellite loci identified in the
seagrass Posidonia oceanica (L.) Delile. Journal of Heredity, 89,562568.
Rozen S, Skaletsky HJ (2000) Prim er 3 on the W W W for general
users and for biologist program m ers. In: Bioinformatics Methods
and Protocols: Methods in Molecular Biology (eds K raw etz S,
M isener S), pp. 365-386. H u m an a Press, Totow a, NJ. (Code
available at http://w w w -genom e.w i.m it.edu/genom e_softw are/
o th e r /prim er3.htm l).