Antisense RNA polymerase II divergent transcripts are PTEFb dependent and substrates for the RNA exosome
The MIT Faculty has made this article openly available. Please share
how this access benefits you. Your story matters.
Citation
Flynn, Ryan A., Albert E. Almada, Jesse R. Zamudio, and Phillip
A. Sharp. "Antisense RNA polymerase II divergent transcripts are
P-TEFb dependent and substrates for the RNA exosome." PNAS
2011 108 (26) 10460-10465.
As Published
http://dx.doi.org/10.1073/pnas.1106630108
Publisher
National Academy of Sciences (U.S.)
Version
Final published version
Accessed
Thu May 26 06:47:19 EDT 2016
Citable Link
http://hdl.handle.net/1721.1/85106
Terms of Use
Article is made available in accordance with the publisher's policy
and may be subject to US copyright law. Please refer to the
publisher's site for terms of use.
Detailed Terms
Antisense RNA polymerase II divergent
transcripts are P-TEFb dependent and
substrates for the RNA exosome
Ryan A. Flynna,1,2, Albert E. Almadaa,b,1, Jesse R. Zamudioa, and Phillip A. Sharpa,b,3
a
David H. Koch Institute for Integrative Cancer Research, Cambridge, MA 02139; and bDepartment of Biology, Massachusetts Institute of Technology,
Cambridge, MA 02139
Contributed by Phillip A. Sharp, May 12, 2011 (sent for review March 3, 2011)
Divergent transcription occurs at the majority of RNA polymerase II
(RNAPII) promoters in mouse embryonic stem cells (mESCs), and
this activity correlates with CpG islands. Here we report the characterization of upstream antisense transcription in regions encoding transcription start site associated RNAs (TSSa-RNAs) at four
divergent CpG island promoters: Isg20l1, Tcea1, Txn1, and Sf3b1.
We find that upstream antisense RNAs (uaRNAs) have distinct
capped 5′ termini and heterogeneous nonpolyadenylated 3′ ends.
uaRNAs are short-lived with average half-lives of 18 minutes and
are present at 1–4 copies per cell, approximately one RNA per DNA
template. Exosome depletion stabilizes uaRNAs. These uaRNAs are
probably initiation products because their capped termini correlate
with peaks of paused RNAPII. The pausing factors NELF and DSIF
are associated with these antisense polymerases and their sense
partners. Knockdown of either NELF or DSIF results in an increase
in the levels of uaRNAs. Consistent with P-TEFb controlling release
from pausing, treatment with its inhibitor, flavopiridol, decreases
uaRNA and nascent mRNA transcripts with similar kinetics. Finally,
Isg20l1 induction reveals equivalent increases in transcriptional activity in sense and antisense directions. Together these data show
divergent polymerases are regulated after P-TEFb recruitment with
uaRNA levels controlled by the exosome.
non-coding RNA ∣ polymerase pausing
R
NA polymerase II (RNAPII) transcription is a highly regulated process controlling cell type and state. Recruitment of
chromatin modifying factors and RNAPII to promoters by DNA
binding transcription factors are key regulatory steps (1–3). However, genome-wide profiling of RNAPII indicates that this polymerase is bound and engaged in the early steps of transcriptional
initiation at most active and many inactive genes in human embryonic stem cells suggesting postinitiation modes of regulation
may occur more frequently than previously appreciated (4).
Moreover, divergent transcription, defined by detection of populations of low abundance small RNAs (19–25 nts) generated
by nonoverlapping (separated by approximately 250 bps) bidirectional transcription, was detected at the majority of transcriptional start sites (TSSs) in mouse embryonic stem cells (mESCs)
(5). Polymerases engaged in divergent transcription near promoters were simultaneously described in human lung fibroblasts (6).
Surprisingly, RNAPII only productively elongates in the proteincoding sense direction from these divergent promoters. Related
results have been reported for several other eukaryotic systems
(7–11). Altogether, these data suggest that control of RNAPII
elongation and RNA stability may be major points of transcriptional regulation and that mechanisms controlling these processes may dictate whether a stable RNA molecule is synthesized.
In recent years it has become clear that RNAPII pausing is a
major mode of transcriptional regulation (6, 12). The Negative
Elongation Factor (NELF) and DRB-Sensitivity Inducing Factor
(DSIF) protein complexes bind and arrest RNAPII 20–30 nts
downstream of the TSS (13). Recruitment of P-TEFb to a paused
RNAPII complex and subsequent phosphorylation of the RNA10460–10465 ∣ PNAS ∣ June 28, 2011 ∣ vol. 108 ∣ no. 26
PII carboxyl-terminal domain (CTD) at serine 2, DSIF, and
NELF results in the dissociation of NELF from the elongation
complex and continuation of transcription (13). More recently
it was recognized, in mESCs, that c-Myc stimulates transcription
at over a third of all cellular promoters by recruitment of P-TEFb
(12). Intriguingly in these same cells, NELF and DSIF have bimodal binding profiles at divergent TSSs. This suggests divergent
RNAPII complexes might be poised for signals controlling elongation and opens up the possibility that in the antisense direction
P-TEF-b recruitment may be regulating release for productive
elongation.
Cellular mechanisms for removal of improperly processed,
spliced, or aberrantly transcribed products likely account for the
instability of transcripts from divergent promoters. In Saccharomyces cerevisiae cryptic unannotated transcripts (CUTs) derived
from promoter-proximal regions are stabilized in the absence of
the exosome (7, 9, 14). The exosome, with 3′ to 5′ exonuclease
activity, is a multisubunit protein complex important for degradation and processing of mRNA, rRNA, snoRNA, and tRNA
(14–16). The phosphorylation state of the RNAPII CTD (17, 18)
and sequence elements within the RNA can influence targeting
of transcripts to the exosome (19). Upon exosome depletion in
human cells, promoter upstream transcripts (PROMPTs) are
stabilized farther upstream (approximately 1 kb) from antisense
TSSa-RNAs and are detected in both sense and antisense orientations in the upstream promoter region (8). However, it is unclear
how various promoter associated RNAs, including PROMPTs, relate to transcription from divergent mammalian promoters.
Although multiple studies have identified distinct RNA species
from mammalian promoters, the precise mapping of RNAs
produced from divergent CpG island promoters has not been
described. In light of these questions, we sought to investigate
RNAPII divergent transcription through a detailed biochemical
analysis of the antisense transcripts. We have characterized upstream antisense RNAs or uaRNAs from four divergent promoters in mESCs. We show that antisense RNAs are predominantly
5′ capped and have heterogeneous 3′ ends ranging in size from
40–1,100 bases in length. Both sense and antisense RNAPII complexes were involved in RNAPII pausing and both depend on
PTEF-b recruitment and phosphorylation for subsequent elongation. We further show that low steady-state levels of uaRNAs,
at least in part, are due to their targeting by the RNA exosome.
Finally, we characterize induction of antisense and sense tranAuthor contributions: R.A.F., A.E.A., J.R.Z., and P.A.S. designed research; R.A.F. and A.E.A.
performed research; R.A.F., A.E.A., J.R.Z., and P.A.S. analyzed data; and R.A.F., A.E.A., J.R.Z.,
and P.A.S. wrote the paper.
The authors declare no conflict of interest.
1
R.A.F. and A.E.A. contributed equally to this work.
2
Present address: Stanford University School of Medicine, Stanford, CA 94305.
3
To whom correspondence should be addressed. E-mail: sharppa@mit.edu.
This article contains supporting information online at www.pnas.org/lookup/suppl/
doi:10.1073/pnas.1106630108/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1106630108
Results
Divergent RNAPII Produces Low Abundant Capped Upstream Antisense RNAs (uaRNAs) with 3′ Heterogeneity. To test whether short
antisense TSSa-RNAs previously described (5) are derived from
longer transcripts and to determine the structure of their 5′ termini, we used rapid amplification of 5′ complementary DNA ends
(5′-RACE) to characterize divergent upstream antisense RNAs
from the Isg20l1, Tcea1, Txn1, and Sf3b1 genes in V6.5 mESCs
(Fig. 1). These genes were selected as representatives of divergent TSSs associated with CpG islands and spanning a range of
expression levels. The positions of oligonucleotides for specific
priming for the 5′-RACE overlapped sequences found in antisense TSSa-RNAs from each promoter. The dependence of
the specific 5′-RACE products on treatment with Tobacco Acid
Pyrophosphatase (TAP) indicated the presence of a capped structure (Fig. S1, lanes 2 and 3). The sequenced 5′-RACE products
for the antisense TSSs revealed RNAs initiated upstream of the
previously characterized antisense TSSa-RNAs for all four promoters (Fig. 1 and Fig. S2A, leftward arrows). Two predominant
uaRNA TSSs for Isg20l1 were identified with the most upstream
Fig. 1. Capped antisense RNA from divergent transcription initiate upstream of antisense TSSa-RNAs and display 3′ heterogeneity. UCSC Genome
browser view showing the location of detected 5′ and 3′ ends using rapid
amplification of cDNA ends (RACE) at four selected CpG island divergent promoter genes: Isg20l1, Tcea1, Txn1, and Sf3b1. 5′-RACE analysis was performed
on upstream regions containing more than one overlapping antisense TSSaRNA (5). Promoter regions are shown with the TSSs marked (arrows pointing
in the direction of transcription). Arrows depicting antisense transcription are
pointing to the left while sense TSSs are marked with arrows pointing to the
right. Sense TSSs (right arrows) were labeled according to UCSC genome
browser’s known genes from UniProt, RefSeq, and GenBank. These were independently confirmed by 5′-RACE for Isg20l1, Tcea1, and Txn1. 3′-RACE analysis yielded various uaRNA transcripts (green) for each divergent promoter.
These range in length from approximately 50 to 1,100 nts. ChIP-seq binding
profiles of RNAPII, H3K4me3, H3K79me2, TATA-binding protein (TBP), TSSaRNA reads (antisense ¼ blue; sense ¼ red), and CpG island regions (green)
are shown. ChIP-Seq data was obtained from the following published reports: RNAPII-8W16 (6), H3K4me3 and H3K79me2 (23), and TBP (22). We note
the absense of a sense RNAPII ChIP-seq peak at the annotated TSS of Tcea1,
likely explained in part to difficulties in mapping reads to this region since it
contains high similarity (99%) with a location on chromosome 15. Scale bars
are displayed at the top of each promoter region.
Flynn et al.
site 43 nts from the previously characterized clusters of antisense
TSSa-RNAs. The Tcea1 gene consists of two predominant antisense capped species with the most upstream 5′ terminus 37 nts
from the antisense TSSa-RNAs. One predominant capped 5′
terminus was mapped for both Txn1 and Sf3b1 that extended 18
and 15 nts upstream from the antisense TSSa-RNA, respectively.
The 5′ capped termini of these uaRNAs are likely generated by
RNAPII initiation events suggesting that the antisense TSSaRNAs are products of subsequent reactions during elongation.
The 5′ capped antisense RNA for each promoter align under a
peak of RNAPII density near the end of the CpG island (Fig. 1).
The segments between sense and antisense capped RNAs are on
average 200–250 bps, comparable to the length of nucleosomefree regions associated with CpG islands (20). To test if transcripts extended beyond the sites of antisense 5′ capped termini
for these four genes, Reverse Transcriptase-quantitative PCR
(RT-qPCR) with strand-specific RT primers was used to determine the orientation of RNA species in the upstream CpG island
promoter (Fig. S3). Because these transcripts might be of low
abundance, cellular RNAs were prepared with two rigorous
DNase treatment steps and only signals dependent on RT were
analyzed. Detectable antisense transcription at all four genes was
confined to the region downstream of the mapped uaRNA 5′ cap
site. This provides additional evidence for initiation at these cap
sites. Sense transcription within the CpG island upstream of the
antisense cap site was probed for at all four regions but only detected at Txn1 and was estimated by PCR cycles to be 80-fold less
abundant than the antisense product. The inability to detect significant sense or antisense RNA signal upstream of the mapped
uaRNA TSSs argues that the majority products from these regions initiate from the identified antisense TSSs.
We previously have characterized antisense RNAs from divergent TSSs by a selective enrichment protocol followed by Northern blot and observed a family of short RNAs spanning 30 to
200 nts (5). To more precisely define such RNAs, a 3′-RACE
protocol was used to characterize the 3′ ends of uaRNAs from the
four divergent promoters. In this approach, adaptor sequences
were ligated onto the free 3′-OH of large fractionated RNAs,
followed by cDNA synthesis and PCR amplification using targetspecific primers. The amplified products were cloned and sequenced to confirm their origin and define their 3′ termini. Multiple nonpolyadenylated 3′ ends were observed for uaRNAs at
each TSS and were aligned to their respective promoters (Fig. 1).
As few as five distinct antisense RNA 3′ ends were detected for
Txn1 and as many as eight at Tcea1. The longest transcripts
cloned were 703, 546, 415, and 1,100 nts for Isg20l1, Tcea1, Txn1,
and Sf3b1, respectively. However, it is likely that additional 3′
ends exist because only a fraction of the 3′-RACE products were
cloned and sequenced (Fig. S4). All 3′-RACE products were dependent on RT for amplification (Fig. S4). Transcripts under
100 nts were detected in the large fractionated RNA preparation.
This probably reflects imperfect fractionation as similar patterns
of transcripts were observed for all four genes. Because of this
fractionation step, the relative levels of the various length RNAs
cannot be estimated from the 3′-RACE products.
We compared the DNA sequences encompassed by uaRNAs
with the location of RNAPII, TATA-binding protein (TBP) and
chromatin modifications associated with active transcription
determined by ChIP-seq in V6.5 mESCs (5, 21, 22) (Fig. 1). The
shorter uaRNAs fell within the peak of bound RNAPII; however,
the longest transcripts extended farther downstream. It is likely
that the density of RNAPII in these downstream regions is
below the threshold signal considered positive in the ChIP-seq
analysis. Histone H3 lysine 4 trimethylation (H3K4me3) and
TBP mark transcription initiation and H3 lysine 79 dimethylation
(H3K79me2) correlates with elongation. The TBP density denoting the preinitiation complex was detected as a broad peak directly
between the divergent RNAPII complexes. The H3K4me3 profile
PNAS ∣
June 28, 2011 ∣
vol. 108 ∣
no. 26 ∣
10461
BIOCHEMISTRY
scription from the divergent promoter of the Isg20l1 gene to show
that PTEF-b activation at both sense and antisense RNAPII complexes occur with similar kinetics.
generally extended the full length of the uaRNAs in the antisense
direction with the exception of the longest Sf3b1 transcript. In
contrast, ChIP-seq signal for H3K79me2 is absent in antisense
transcribed regions for the four genes. This lack of signal might be
due to limits in the sensitivity of the technique, but the same chromatin modification is clearly present in the sense direction downstream of the TSS for these four genes. This suggests differential
activity of elongation complexes in the two directions.
To relate levels of uaRNAs to antisense TSSa-RNAs that were
previously measured at 1 copy per 10 mESCs (5), RT-qPCR
probes noted in Fig. S2A (“qPCR amplicon”) were used for absolute quantification. Copy number defined by molar equivalents
as compared to a standard signal in the form of ssDNA was
determined per ES cell equivalent of total RNA. The uaRNAs
are present at 4.5, 1.8, 1.1, and 1.7 copies per cell for Isg20l1,
Tcea1, Txn1, and Sf3b1, respectively (Fig. S2B). These results
indicate that uaRNAs are roughly 10-fold more abundant than
previously characterized antisense TSSa-RNAs; present at approximately one copy per copy of genome sequences.
uaRNAs Are Substrates of the Exosome. Because previous studies
have linked the exosome to nuclear surveillance of unannotated
or cryptic transcripts, uaRNA stabilization and 3′ termini were
assayed upon exosome depletion. Exosc5 was targeted for knockdown with an shRNA-lentiviral delivery construct and depletion
was confirmed 48 h after infection (Fig. S5). RT-qPCR was used
to determine relative steady-state levels of uaRNAs (upstream
antisense probe) and spliced sense mRNA (exon1-exon2 probe)
between knockdown (shExosc5) and empty vector control
(pLKO.1) for all four genes. Across multiple biological replicates,
Exosc5 depletion led to a 2.5–3.5-fold increase in uaRNA levels,
while spliced sense mRNAs were also slightly elevated yet below
statistical significance (Fig. 2A). Next, we assayed for uaRNAs by
DNA Southern blot of 3′-RACE products in control and exosome-depleted cells. After optimization of minimal PCR cycles
and multiple probe validation of signal (Fig. S6B), the most abundant uaRNA forms for each gene were observed. In Exosc5
knockdown samples, the numbers and abundance of long RNAs
increased compared to control virus infected cells further supporting uaRNAs as substrates for the exosome (Fig. 2B). These
results show that upstream antisense RNAPII elongates to produce heterogeneous RNAs that are substrates for the exosome.
RNAPII Pausing Factors Regulate uaRNA Transcription. The RNAPII
pausing factors that associate with promoter proximal stalled
RNAPII are composed of NELF (NELF-A,B,C/D, and E) and
DSIF (Supt4h and Supt5h). In addition, RNAPII acquires phosphorylation at Ser5 on the carboxyl-terminal domain early in
transcription and this modification peaks in abundance around
the pause site. We first aligned ChIP-seq profiles of RNAPIISer5P, Supt5h, and NELF-A determined in V6.5 mESCs to
uaRNA transcribed regions. For all four genes, the peaks of
RNAPII-Ser5P, Supt5h, and NELF-A directly overlap the uaRNA
TSS supporting postinitiation regulation by RNAPII pausing in
the antisense direction (Fig. 3A). To test whether RNAPII upstream complexes are poised for transcription in both directions,
we performed shRNA-mediated knockdown of NELF-A, NELF-E
and Supt4h, with each providing potent targeted mRNA loss
(Fig. 3B). Depletion of either NELF subunit resulted in near twofold increases in uaRNA and spliced mRNA transcripts for all four
genes across six biological replicates (Fig. 3C). Supt4h knockdown
also resulted in twofold increases for both uaRNAs and spliced
mRNA transcripts. Together these data argue NELF and DSIF
complexes are equivalently active in binding and regulating paused
RNAPII complexes in both directions at divergent promoters.
P-TEFb Regulates Elongation of uaRNAs. P-TEFb promotes RNAPII
elongation in the sense direction for most if not all genes; how10462 ∣
www.pnas.org/cgi/doi/10.1073/pnas.1106630108
A
B
Fig. 2. uaRNA transcripts are substrates for the exosome. (A) Relative levels
of uaRNA (gray amplicon in Fig. S2A, dark gray) and spliced mRNA (exon1-2
probe, light gray) transcripts in mESCs infected with virus containing an
shRNA targeting Exosc5 (shExosc5) and assayed by RT-qPCR (probes shown
in Table S3). Transcript levels were normalized to virus-infected cells without
shRNA, empty vector (pLKO.1), and normalized to β-actin levels. Values
represent four biological replicates and error represents the respective SEM.
Asterisks represent significance of p < 0.05 in two-sided t test. (B) 3′-RACE
followed by Southern blot analysis of control and shExosc5 treated mESC
RNA. The Southern blots were probed with probe 1 shown in Fig. S6A. Minus
RT lanes refer to 3′-RACE experiments with no reverse transcriptase added in
the RT step of the procedure. Migration of 100bp molecular weight ladder
(NEB) is marked on the left.
ever, its role in antisense transcription at divergent promoters
has not been examined. We used flavopiridol, a small molecule
drug with high specificity for CDK9 inhibition to test P-TEFb’s
requirement for RNA synthesis at divergent TSSs. uaRNA,
spliced mRNA, and nascent mRNA transcripts (exon1-intron1
probe) were measured at all four genes in mock (DMSO) or
1 μM flavopiridol-treated mESCs. Treatment with this flavopiridol concentration for 1 h was previously shown to not affect global RNAPII-Ser5P levels while dramatically reducing RNAPIISer2P and Supt5h phosphorylation in these cells, indicating a
block of transcriptional elongation but not initiation (12). In flavopiridol-treated cells, the nascent mRNA transcripts for all four
genes were reduced to 5–12% of mock-treated controls confirming a block in elongation (Fig. 4A). Interestingly, steady-state
uaRNA transcript levels decreased to 19–25% of mock-treated
controls using RT-qPCR probes that require transcription of
approximately 150 nts or longer from the uaRNA TSS. Spliced
mRNA levels were unchanged suggesting stable transcripts over
this time course. We next determined uaRNA decay rates using
flavopiridol treatment over a 1 h time course (Fig. 4B). Half-lives
of 27, 19, 14, and 13 min were estimated for uaRNAs from
Isg20l1, Tcea1, Txn1, and Sf3b1, respectively (Fig. S7).
The large decrease in uaRNA levels following loss of CDK9
activity supports P-TEFb dependent release from paused polymerase and bidirectional recruitment of P-TEFb at CpG island
promoters. To confirm P-TEFb-dependent transcription, RNA
produced from divergent TSSs for all four genes was measured
following removal of flavopiridol. The uaRNAs (Fig. 4C, left
Flynn et al.
A
A
B
B
C
C
Fig. 3. Pausing factors at the antisense RNAPII complex regulate uaRNA levels. (A) UCSC Genome browser views of the four divergent promoter regions
displaying ChIP-seq binding profiles (13) of RNAPII-Ser5P, Supt5h, NELF-A,
and the full length antisense RNA transcripts. Each region diagrammed spans
2 kb and scale bars represent 500 bp. (B) Relative gene expression of Nelf-A,
Nelf-E, and Supt4h in control and shRNA knockdown mESC after 48 h of selection measured by Taqman RT-qPCR assay. Values represent six biological
replicates and error represents the respective SEM. (C) Transcript changes
in shNELF-A, shNELF-E, and shSupt4h mESC lines as determined by RT-qPCR.
uaRNA and spliced mRNA levels are represented by blue and red bars, respectively (probes shown in Table S3). Values represent six biological replicates
and error shows the respective SEM. Asterisks represent significance of
p < 0.05 in two-tailed t test.
panel) and nascent mRNA transcripts (Fig. 4C, right panel) recovered with similar kinetics and reached control steady-state levels by 30 min after flavopiridol removal. The similar recovery
rates at both TSSs further supports P-TEFb acting on both divergent RNA polymerases to promote elongation.
Fig. 4. uaRNAs are P-TEFb-dependent transcripts and have short half-lives.
(A) Relative levels of spliced mRNA (red), nascent RNA (exon1-intron1 probe,
green), and uaRNA (blue) transcripts, as measured by RT-qPCR, after a 1 μM
flavopiridol treatment for 1 h. (B) uaRNA transcript levels assayed by RT-qPCR
from amplicon shown in Fig. S2A over a 1 h time course with 1 μM flavopiridol. (C) uaRNA (left panel) and nascent sense RNA (right panel) levels assayed
by RT-qPCR over an hour 1 μM flavopiridol treatment followed by a phosphate buffered saline (PBS) wash off of flavopiridol at the indicated times.
Isg20l1, Tcea1, Txn1, and Sf3b1 RNA transcripts are shown in blue, red, green,
and purple, respectively. All values are relative to mock (DMSO) treated cells
and normalized to β-Actin. Values represent two biological replicates with
the error representing the respective SEMs. All probe sequences are shown
in Table S3.
event from antisense RNAPII complexes at divergent promoters.
Further, RNAPII-Ser5P, NELF, and DSIF profiles at divergent
TSSs suggest that these antisense RNAPII complexes are poised
for transcription elongation. Correspondingly, we find that depletion of NELF and DSIF, factors known to promote the pausing of
RNAPII, modestly increases steady-state uaRNA levels. This is
consistent with the model that the two divergent and paused com-
Isg20l1, is one of two homologs of an apoptosis-enhancing
exonuclease. To determine how divergent paused RNAPII complexes respond to gene activation, doxorubicin, a DNA intercalator and inducer of double stranded breaks (23), was used to
induce apoptosis in mESCs. Treatment with 1 μM doxorubicin
for 1.5, 4, and 6 h was followed by measurement of Isg20l1 uaRNA, nascent mRNA, and spliced mRNA levels. Isg20l1 transcriptional output in either direction did not significantly change with
1.5 h of treatment. However, both uaRNA and spliced mRNA
transcripts had equivalent induction levels of 8- and 12-fold following 4- and 6-h treatments, respectively (Fig. 5). The nascent
mRNA transcripts showed only a twofold increase at 6 h of treatment indicating tightly coordinated pre-mRNA processing. Divergent TSS products for thioreductase 1, Txn1, which are not
expected to respond to DNA damage, did not change with treatment and served as an additional control for transcription fidelity
during cellular stress. These results support a model for gene activation at divergent CpG island promoters proceeded by stimulation of elongation in both directions.
Discussion
The detection of capped 5′ termini on uaRNAs for all four studied promoters strongly supports a distinct and specific initiation
Flynn et al.
BIOCHEMISTRY
Transcriptional Induction of Isg20l1 Similarly Increases mRNA and uaRNA Levels. Interferon-stimulated 20 kDa exonuclease-like 1,
Fig. 5. Divergent sense and antisense transcription induced with similar kinetics. mESCs were treated with 1 μM doxorubicin for 1.5, 4, and 6 h after
which total RNA was collected. RT-qPCR analysis to determine the relative
fold change of nascent, spliced mRNA, and uaRNA transcription followed.
Changes in transcript levels for two genes, Isg20l1 and Txn1, green and blue
bars, respectively, are shown. Values represent biological triplicates and error
of the respective SEM. All probes are shown in Table S3.
PNAS ∣
June 28, 2011 ∣
vol. 108 ∣
no. 26 ∣
10463
plexes are composed of similar factors controlling initial progression into elongation. In addition, we demonstrate that inhibition
of P-TEFb activity with flavopiridol decreases both uaRNA and
nascent mRNA transcript levels. P-TEFb phosphorylates the
RNAPII-CTD, DSIF, and NELF promoting elongation and its
inhibition blocks elongation (13). Because uaRNAs are shortlived, yet detectable in total RNA, upstream antisense RNAPII
must be released from the paused state with kinetics comparable
to their half-lives.
That RNAPII complexes are poised or stalled in the sense and
antisense direction begs the question of how this process contributes to the local chromatin structure and overall gene activity.
In Drosophila cells, roughly two-thirds of all changes in gene expression upon NELF depletion were down-regulation likely due
to loss of RNAPII pausing that allows nucleosome assembly at
the promoter (24, 25). However, one-third of all changes in gene
expression were increases in transcript levels upon NELF depletion. We observed an increase in uaRNA and nascent mRNA
levels upon NELF depletion. It could be that the mechanism
and function of RNAPII pausing at our four divergent promoters
are similar to the latter class described above. For example, mammalian promoters are frequently CpG-rich, and this tends to destabilize nucleosomes promoting nucleosome-free regions at the
5′-end of genes. Therefore, the impact of RNAPII pausing mechanisms to occlude nucleosome assembly may not be significant
at divergently transcribed CpG-rich promoters.
Activation of the Isg20l1 divergent promoter upon doxorubicin
treatment yielded simultaneous induction of transcription with
similar levels and kinetics of spliced mRNA and uaRNA. These
results were compelling because it illustrates the requirement for
additional regulatory steps post P-TEFb recruitment to differentiate the sense and antisense RNAPII complexes for production of
stable transcripts. In the sense direction, signals for continued
productive elongation could involve the recruitment of P-TEFbtype activities by elongation complexes and/or pre-mRNA processing machinery and maintenance of Ser-2P. For example,
P-TEFb has been shown to interact with the SR proteins involved
in the recognition of exonic sequences (26). These signals may not
be present in the antisense direction.
Antisense transcription from divergent promoters produce
uaRNAs that range from 1–4 copies/cell with relatively short
half-lives. Because the uaRNAs are 10-fold more abundant than
the 20–25 nt antisense TSSa-RNAs, the latter are likely derived
during the synthesis or processing of longer uaRNA through the
endonucleolytic cleavage activities of the Transcription Factor II
S (TFIIS) (27) or the RNA exosome, respectively (28).
The mapping of uaRNA 3′ ends revealed heterogeneous populations possibly arising from nascent transcripts, or RNAPII
termination, processing and/or degradation by the exosome. Analysis using 3′-RACE Southern blots on control and exosomedepleted cells revealed that uaRNA 3′ termini are distinct and
longer in exosome-depleted cells. The 2–4-fold increase in uaRNA levels upon exosome depletion is modest but certainly in line
with a previous study (8) that reports an average 1.5-fold increase
in RNA originating 1 kb upstream of known TSSs. This increase is
consistent with a dynamic and rapid turnover of antisense transcripts.
1. Ptashne M, Gann A (1997) Transcriptional activation by recruitment. Nature
386:569–577.
2. Kuras L, Struhl K (1999) Binding of TBP to promoters in vivo is stimulated by activators
and requires Pol II holoenzyme. Nature 399:609–613.
3. Roeder RG (2005) Transcriptional regulation and the role of diverse coactivators in
animal cells. FEBS Lett 579:909–915.
4. Guenther MG, Levine SS, Boyer LA, Jaenisch R, Young RA (2007) A chromatin landmark
and transcription initiation at most promoters in human cells. Cell 130:77–88.
5. Seila AC, et al. (2008) Divergent transcription from active promoters. Science
322:1849–1851.
6. Core LJ, Waterfall JJ, Lis JT (2008) Nascent RNA sequencing reveals widespread pausing
and divergent initiation at human promoters. Science 322:1845–1848.
10464 ∣
www.pnas.org/cgi/doi/10.1073/pnas.1106630108
Both the act of divergent transcription and the rapidly cycling
promoter associated RNA could have multiple functions. In addition to possibly maintaining chromatin structure at promoter
regions, it is possible that the nascent RNA tethered to RNAPII
and/or disengaged could participate in regulation of local chromatin structure. For example, nascent RNAs transcriptionally
engaged upstream of the cyclin D1 gene are thought to recruit
TLS, a RNA binding transcriptional regulatory factor sensitive
to DNA damage (29). In contrast, disengaged short sense RNAs
found at the 5′ ends of Polycomb target genes have been reported
to form stem-loop structures, which can bind Suz12 to promote
silencing of the gene. (30). These two examples, among many
others, suggest that uaRNAs could be involved in control of gene
expression.
Materials and Methods
Cell Culture Conditions. V6.5 (C57BL/6-129) mouse embryonic stem cells
(mESCs) (Koch Institute Transgenic Facility) were grown under standard ES
cell culture conditions (31).
Lentiviral Infection and Total RNA Preparation. The shRNA targeting plasmids
for knockdown of mRNA and empty plasmid (control) were ordered from
Open Biosystems/Thermo Scientific (Table S1). The lentivirus infection protocol is available in SI Materials and Methods.
RT-qPCR of RNA Transcripts. To assess mRNA knockdown and for other PCR
analysis, complementary DNA (cDNA) was generated using the QuantiTect
Reverse Transcription Kit (Qiagen) according to the manufacturer’s protocol
with the following modification: a 5 min genomic DNA (gDNA) elimination
step. TaqMan gene expression assays (Applied Biosystems) were used to determine levels of mRNA transcripts after shRNA knockdown (Table S1). The
ABI 7500 Real-Time PCR System was used with the accompanying software to
analyze quantitative PCR (qPCR) data. Details of other qPCR experiments are
described in SI Material and Methods. For absolute quantitation, ssDNA Ultramer Oligonucleotides (IDT) were designed (Table S2) to contain the 5′-end
of uaRNA transcripts (SI Material and Methods).
Rapid Amplification of 5′ Complementary DNA Ends (5′-RACE) Total RNA was
prepared using the standard Qiazol (Qiagen) protocol. Total RNA (10 μg)
was DNase treated with the Turbo DNA-Free kit (Ambion). Table S4 contains
primers used for 5′-RACE with the FirstChoice RLM-RACE Kit (Ambion) with
several modifications. The 5′-RACE procedure is described in SI Materials and
Methods.
Rapid Amplification of 3′ Complementary DNA Ends (3′-RACE). Large (>200 nts)
RNA was prepared using the mirVana miRNA Isolation Kit (Ambion). A similar
ligation-mediated approach as described for 5′-RACE was used (details in SI
Materials and Methods).
Flavopiridol and Doxorubicin Treatment of mECSs. Flavopiridol (Sigma) and
doxorubicin (Sigma) were resuspended to a final concentration of 10 mM
in DMSO and stored at −80 °C until used (SI Materials and Methods).
ACKNOWLEDGMENTS. We thank Grace Zheng, Mohini Jangi, and Allan Gurtan
for discussion and critical review of this manuscript. We thank Pete Rahl and
Richard Young for generously sharing ChIP-seq data. This work was supported by US Public Health Service grants R01-GM34277 from the National
Institutes of Health (NIH) to P.A.S. and partially by Cancer Center Support
(core) Grant P30-CA14051 from the National Cancer Institute. A.E.A. was
supported by NIH/NIGMS Pre-Doctoral Training in Biological Sciences Grant
GM007287.
7. Xu Z, et al. (2009) Bidirectional promoters generate pervasive transcription in yeast.
Nature 457:1033–1037.
8. Preker P, et al. (2008) RNA exosome depletion reveals transcription upstream of active
human promoters. Science 322:1851–1854.
9. Neil H, et al. (2009) Widespread bidirectional promoters are the major source of
cryptic transcripts in yeast. Nature 457:1038–1042.
10. Fejes-Toth K, et al. (2009) Post-transcriptional processing generates a diversity of
5′-modified long and short RNAs. Nature 457:1028–1032.
11. Taft RJ, et al. (2009) Tiny RNAs associated with transcription start sites in animals. Nat
Genet 41:572–578.
12. Rahl PB, et al. (2010) c-Myc regulates transcriptional pause release. Cell
141:432–445.
Flynn et al.
22. Marson A, et al. (2008) Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell 134:521–533.
23. Nitiss JL (2009) Targeting DNA topoisomerase II in cancer chemotherapy. Nat Rev Cancer 9:338–350.
24. Gilchrist DA, et al. (2008) NELF-mediated stalling of Pol II can enhance gene expression
by blocking promoter-proximal nucleosome assembly. Genes Dev 22:1921–1933.
25. Gilchrist DA, et al. (2010) Pausing of RNA polymerase II disrupts DNA-specified nucleosome organization to enable precise gene regulation. Cell 143:540–551.
26. Lin S, Coutinho-Mansfield G, Wang D, Pandit S, Fu XD (2008) The splicing factor SC35
has an active role in transcriptional elongation. Nat Struct Mol Biol 15:819–826.
27. Nechaev S, et al. (2010) Global analysis of short RNAs reveals widespread promoterproximal stalling and arrest of Pol II in Drosophila. Science 327:335–338.
28. Lebreton A, Tomecki R, Dziembowski A, Seraphin B (2008) Endonucleolytic RNA cleavage by a eukaryotic exosome. Nature 456:993–996.
29. Wang X, et al. (2008) Induced ncRNAs allosterically modify RNA-binding proteins in cis
to inhibit transcription. Nature 454:126–130.
30. Kanhere A, et al. (2010) Short RNAs are transcribed from repressed polycomb target
genes and interact with polycomb repressive complex-2. Mol Cell 38:675–688.
31. Boyer LA, et al. (2006) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441:349–353.
BIOCHEMISTRY
13. Peterlin BM, Price DH (2006) Controlling the elongation phase of transcription with
P-TEFb. Mol Cell 23:297–305.
14. Houseley J, LaCava J, Tollervey D (2006) RNA-quality control by the exosome. Nat Rev
Mol Cell Biol 7:529–539.
15. Mitchell P, Petfalski E, Shevchenko A, Mann M, Tollervey D (1997) The exosome: A conserved eukaryotic RNA processing complex containing multiple 30 → 50 exoribonucleases. Cell 91:457–466.
16. Schmid M, Jensen TH (2008) The exosome: A multipurpose RNA-decay machine. Trends
Biochem Sci 33:501–510.
17. Gudipati RK, Villa T, Boulay J, Libri D (2008) Phosphorylation of the RNA polymerase II
C-terminal domain dictates transcription termination choice. Nat Struct Mol Biol
15:786–794.
18. Vasiljeva L, Kim M, Mutschler H, Buratowski S, Meinhart A (2008) The Nrd1-Nab3-Sen1
termination complex interacts with the Ser5-phosphorylated RNA polymerase II
C-terminal domain. Nat Struct Mol Biol 15:795–804.
19. Anderson JR, et al. (2006) Sequence-specific RNA binding mediated by the RNase PH
domain of components of the exosome. RNA 12:1810–1816.
20. Ramirez-Carrozzi VR, et al. (2009) A unifying model for the selective regulation of inducible transcription by CpG islands and nucleosome remodeling. Cell 138:114–128.
21. Kagey MH, et al. (2010) Mediator and cohesin connect gene expression and chromatin
architecture. Nature 467:430–435.
Flynn et al.
PNAS ∣
June 28, 2011 ∣
vol. 108 ∣
no. 26 ∣
10465
Supporting Information
Flynn et al. 10.1073/pnas.1106630108
SI Materials and Methods
Lentiviral Infection and Total RNA Preparation. For Lentivirus pro-
duction, 293T cells were plated in six-well dishes at
6 × 105 cells∕well. Forty-eight hours after cotransfection of viral
and shRNA plasmids into 293Tcells, lentivirus was harvested and
used directly to infect mESCs in a six-well plate at
2 × 105 cells∕well. The infection media was 1∶2, viral media:
mESC media with 2 mM polybrene. Infected mESCs were then
selected for 24 hours with 2 μM puromycin. Total RNA was
collected using the RiboPure Kit (Ambion/Applied Biosystems)
according to the manufacturer’s protocol.
RT-qPCR of RNA Transcripts. All other qPCR experiments were
performed with Power SYBR Green PCR Master Mix (Applied
Biosystems). Primers to detect uaRNAs, promoter RNAs, spliced
mRNA (exon 1-2 junction, probe), and nascent mRNA (exon1intron1, probe) are shown in Table S3. Analysis of relative transcript levels was calculated using the delta-delta Ct method. Once
internal controls of β-Actin, GAPDH, and 28S rRNA were shown
to be comparable standards, β-Actin was chosen as the internal
control for all experiments. Error between biological replicates
was calculated using SEM. Statistical significance was determined
using a two-tailed, paired t test. P-values of <0.05 were reported
for all RT-qPCR analysis.
Standard curves (for absolute quantification of uaRNAs) were
generated with qPCR using uaRNA-specific primers to amplify
ssDNA Ultramer Oligonucleotides. mESCs were collected,
counted using a Coulter Counter (Millipore), and total RNA was
prepared to determine average RNA concentration per mESC. A
quantified number of cells were subjected to qPCR using the
uaRNA primer pairs and resulting qPCR signal was converted
to copy number based on the ssDNA molar equivalents.
Rapid Amplification of 5′ Complementary DNA Ends (5′-RACE). The
following modifications were made to the FirstChoice RLMRACE Kit (Ambion). First, T4 RNA Ligase 1 (ssRNA Ligase)
was heat-inactivated for 15 minutes at 65 °C. Second, SuperScript
III (SSIII, Invitrogen) was used for cDNA synthesis according to
the manufacturer’s protocol. Reverse transcription was performed with a target-specific primer, gsp1, at a 0.25 μM final con-
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
centration. In addition, two subsequent nested PCR reactions
using HotStarTaq (Qiagen) was performed with two forward primers, Po and Pi , 5′-RACE adaptor-specific primers (Ambion),
and two reverse target-specific primers, gsp-2 and gsp-3, at a
0.4 μM final concentration (Table S4). PCR 1 and PCR 2 were
amplified for 20 and 25 to 30 cycles, respectively. PCR reaction
products were run on a 2% agarose gel, extracted using a QIAquick Gel Extraction Kit (Qiagen), and sequenced using Sanger
methods.
Rapid Amplification of 3′ Complementary DNA Ends (3′-RACE). Large
fractionated RNA (5 μg) was DNase-treated with the Turbo
DNA-Free Kit (Ambion). The ligation reaction was performed
with a 3′-RACE adaptor, synthesized with a 5′-phosphate and
a 3′-dideoxy-C (IDT) (Table S5) and used at a final 50 μM concentration for 3′ end ligation. All primers for 3′-RACE are listed
in Table S5. Reverse transcription was modified in the following
manner: the SSIII protocol for GC-Rich templates was used in
place of the standard and reverse transcription was performed
with an adaptor-specific primer, 3′-RACE Po , at 0.25 μM final
concentration. Two subsequent PCR reactions were performed
similarly as 5′-RACE, but instead with two forward target-specific
primers, gsp-1 and gsp-2, and two reverse adaptor-specific primers 3′-RACE Po and Pi .
Flavopiridol and Doxorubicin Treatment of mECSs. Flavopiridol was
added directly to the mESC culture media to a final concentration of 1 μM and allowed to incubate for 1, 5, 10, 15, 30, and
60 min in a tissue culture incubator at 37 °C. For the wash-off
experiments, flavopiridol treated mESCs were washed once with
37 °C 1× Phosphate Buffered Saline. Fresh mESC media was
added to the flavopiridol treated mESCs and they were placed
at 37 °C for 30, 60, or 90 min before total RNA was isolated
as described above. Doxorubicin was added directly to the mESC
culture media to a final concentration of 1 μM and incubated for
1.5, 4, or 6 h at 37 °C. After the specified time, RNA was isolated
as previously described and RT-qPCR was preformed to assay
transcript levels.
1 of 7
Fig. S1. uaRNAs contain a cap structure at the 5′ termini. All PCR products were collected from the gel, cloned into a TOPO vector, and transformed into
competent cells. Five colonies for each band show above were selected for sequencing. From these sequencing results, specific products from the upstream
antisense regions were only detected in the TAPþ lanes. For Tcea1, the addition of CIP prior to TAP treatment allowed for the detection of an additional
antisense 5′ end cap site likely explained by the increase in PCR efficiency upon removal of uncapped background RNA (lanes 2 and 4). Size markers are shown
to the left of each gel.
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
2 of 7
A
B
Fig. S2. Capped antisense RNA from divergent transcription initiate upstream of antisense TSSa-RNAs. (A) UCSC Genome browser view showing the location
of detected antisense TSSs using rapid amplification of 5′ cDNA ends (5′-RACE) at four selected CpG island promoter genes: Isg20l1, Tcea1, Txn1, and Sf3b1.
Arrows depicting antisense transcription are pointing to the left while sense TSSs are marked with arrows pointing to the right. Tracks: RNAPII ChIP-seq profiles
in mESCs (black), qPCR amplicon (gray), antisense (blue) and sense (red) TSSa-RNAs, and CpG island (green). Each genomic region displayed spans 2 kb and the
scale bar represents 500 bp. (B) Absolute quantification of the upstream antisense RNAs (uaRNAs) determined by qPCR using a ssDNA oligonucleotide standard.
The values represent biological triplicates and error bars are SEM.
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
3 of 7
Fig. S3. Strand-specific RT-qPCR on RNAs that originate in the upstream antisense or promoter regions. Promoter regions are diagrammed for Isg20l1, Tcea1,
Txn1, and Sf3b1, respectively. Sense TSSs are noted with a right facing arrow and set to position zero. Upstream antisense TSSs are noted with a left facing
arrow. All uaRNA identified are represented by red bars and the first 300 nts of each sense transcript is shown as green bars. Amplicons for the “upstream” and
“promoter” qPCR primers (Table S3) are shown for each gene as orange and yellow bars, respectively. Absolute quantitation was used to calculate copy number
from strand-specific RT-qPCR reactions and copy numbers appear in the table below each sense TSS. The (−) and (þ) strand columns represent transcripts
amplified from either the “−” or “þ” strand using a strand-specific RT primer, while the rows “upstream” and “promoter” correspond to the primer pair
used in the experiment.
Fig. S4. 3′-RACE products are reverse-transcriptase dependent. 3′-RACE products were separated on a 2% agarose gel and the specific bands that were cloned
and sequenced are marked with an asterisk (*) and shown in the UCSC Genome Browser in Fig. 1. The above gels are examples that yielded uaRNA sequences
shown in Fig. 1. Samples displaying -RT did not receive reverse-transcriptase during cDNA synthesis. Size markers are shown to the left of each gel.
Fig. S5. shRNA-mediated Exosc5 knockdown in V6.5 ES cells. Relative gene expression of Exosc5, component of the exosome, as determined by RT-qPCR using
Taqman probes (Table S1). Percent mRNA levels are shown compared to mock knockdown RNA samples. Values represent biological triplicates and error bars
represent SEM of the biological replicates.
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
4 of 7
A
B
Fig. S6. uaRNAs have 3′ heterogeneity and their lengths are altered upon exosome depletion. (A) Genome browser views of the four divergent promoter
regions displaying ChIP-Seq signal for RNAPII, the mapped uaRNA transcripts, and the southern blot probes used in B and in Fig. 2B. For each region, two probes
were designed to be either proximal (probe 1) or distal (probe 2) to the antisense TSS. (B) 3′-RACE followed by Southern blot analysis from either control
(pLKO.1) or knockdown (shExosc5) mESCs. For each uaRNA region, both probes described above were used to visualize the RNA species. A range of PCR cycles
was used during the 3′-RACE protocol to assay the most abundant transcripts as determined by the detection of the initial products. The number of cycles used
for control and knockdown samples are indicated below each blot.
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
5 of 7
Fig. S7. uaRNA half-life calculations. Scatter plot of the relative uaRNA transcript abundances over a one hour flavopiridol treatment. For each gene, a best fit
logarithmic curve was determined and equations corresponding to each gene are shown in the upper right-hand corner. Using the equations above, half-lives
were calculated and shown for each gene to the right.
Table S1. Taqman primers and shRNAs used for mRNA knockdown
Gsym, Complex
Accession ID
Open Biosystems shRNA ID
Applied Biosystems Expression Assay
Supt4h, DSIF
Supt5h, DSIF
NELF-E, NELF
NELF-A, NELF
Exosc5, Exosome
GAPDH
NM_009296
NM_013676
NM_138580
NM_011914
NM_138586
NM_008084.2
RMM4534-NM_009296
RMM4534-NM_013676
RMM4534-NM_138580
RMM4534-NM_011914
RMM4534-NM_138586
N/A
Mm02527263_g1
Mm01170629_m1
Mm01134804_m1
Mm01217228_m1
Mm00506830_m1
4352932E
Table S2. ssDNA ultramer oligonucleotides for absolute copy number determination
Sequence (5′-3′)
Isg20l1
Tcea1
Txn1
Sf3b1
TTATTTCACGGACTTCTCACAACCCCAAGCCTGGAGGGGCTGCAGTTCCCCGA
GGCAGATCGGGATGTGCTCTTTGAGGCTTTAAGTCTTTGAAGGTTGCGGTTCACTAGGCGTCGGGTC
TGCTCATGCGCTTTAAGCCCTCGGCAATGCCTGTCCTGCGTCCCAGAGAACGCT
CTGCCGGAGGGGTTTCGATGGAACTCGTAGCAACCTACCGCCTACTGCCTGAT
CCCTCTGGCGTGAAAGCCGGACTCCGTCCAACTCCAGCTCGCCAGCAACGCGAG
TCCGGATAGGGCCGGAAGT
ATCTGACTTAGGTCTAGTTTGGGGCATGGGCAGTGTGATTACAGAAGGACTCTA
CGGTGTGAGAGAGGACCGTGATCTACCCCGGCGCTGTTCGCTGTTAAAGTGCC
CTTGAGGCAGCTGGAAGT
GACAGGCTTTGTCTGTACAGCCCTGGCTTCGGGAACTCTCTTTGTAGACCAGGC
TGGCCTCGAACTGCCTCTTCTCTTCCGAGTGCTTGAATTAACGGCACGTTACCC
ACCACTGGCCGGACAGGCTACAGCCCTCTTGGGAAGTAGCCATCCTCTTCCGCGTTTT
Table S3. Primers used in RT-qPCR for relative transcript level analysis
Gene—Location
Isg20l1—Upstream Antisense
Isg20l1—Exon1-Exon2
Isg20l1—Exon1-Intron1
Isg20l1—Promoter
Tcea1—Upstream Antisense
Tcea1—Exon1-Exon2
Tcea1—Exon1-Intron1
Tcea1—Promoter
Txn1—Upstream Antisense
Txn1—Exon1-Exon2
Txn1—Exon1-Intron1
Txn1—Promoter
Sf3b1—Upstream Antisense
Sf3b1—Exon1-Exon2
Sf3b1—Exon1-Intron1
Sf3b1—Promoter
β-Actin mRNA
28S rRNA
GAPDH
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
Forward Primer (50 → 30 )
Reverse Primer (50 → 30 )
CCTAGTGAACCGCAACCTTC
GGGTTGGTTTGCAACTAGGC
GGGTTGGTTTGCAACTAGGC
TGATCCTGCTCCTCCTCAGT
CTATCCGGACTCGCGTTG
GATGGACAAAATGGTGCAGA
GTTCGCATTGCCAAGAAGAT
GATCGCAGGAGACTGGAAAG
GCCTCAAGGGCACTTTAACA
GCCAAAATGGTGAAGCTGAT
TGGATCCATTTCCATCTGG
GCTGCCGAACAAGAACCTTA
GCGGAAGAGGATGGCTACT
GTGGACAAAATGGCGAAGAT
GTGGACAAAATGGCGAAGAT
TCCTTAAAAAGCCAGCGAAA
GACGAGGCCCAGAGCAAGAGAGG
AGCAGCCGACTTAGAACTGG
GTGTTCCTACCCCCAATGTGT
GACTTCTCACAACCCCAAGC
GCTCACAGGTTGGGGTAAGA
CCCAAAAGCTTACAGACCA
AGATCGGGATGTGCTCTTTG
CTTTAAGCCCTCGGCAATG
TTCATCTGTGCTCTGCTTGC
GCAGCACGGACCTGAAAG
GGGTTTCGATGGAACTCGTA
GGTCTAGTTTGGGGCATGG
TGATCATTTTGCAAGGTCCA
CCGAGAGTGTCCTCTTCAGC
TTGGCTCTTAGGGGTAGCTG
GTCTGTACAGCCCTGGCTTC
TGCCTTCTTGCCTTGAATTT
CTCGGTCGAGACCAGAGATG
GACAGGCTACAGCCCTCTTG
GGTGTTGAAGGTCTCAAACATG
TAGGGACAGTGGGAATCTCG
AATGTGATACCAGGAAATGAGCTT
6 of 7
Table S4. 5′-RACE primers
Isg20l1
Tcea1
Txn1
Sf3b1
Isg20l1
Tcea1
Txn1
Sf3b1
Gsp-1 (5′-3′)
Gsp-2 (5′-3′)
GCTCTTTGAGGCTTTAAGTCTTTGAAGG
TAGCAACCTACCGCCTACTGCC
GTGCCCTTGAGGCAGCTGGAAGTTGG
GGACAGGCTACAGCCCTCTTGG
Gsp-3 (5′-3′)
GAGGCTTTAAGTCTTTGAAGGTTGCGG
CTCTGGCGTGAAAGCCGGACTCC
GAGGCAGCTGGAAGTTGGCTCTTAGG
CAGCCCTCTTGGGAAGTAGCCATCC
CTTTGAGGCTTTAAGTCTTTGAAGGTTGC
CTACCGCCTACTGCCTGATCC
CCTTGAGGCAGCTGGAAGTTGGCTC
CTACAGCCCTCTTGGGAAGTAGC
Table S5. 3′-RACE primers and adaptor sequence
Gsp-1 (5′-3′)
Isg20l1
Tcea1
Txn1
Sf3b1
Po
Pi
Adaptor Sequence
Gsp-2 (5′-3′)
CGACGCCTAGTGAACCGCAACC
ACCGCAACCTTCAAAGACTTAAAGCC
ACGGAGTCCGGCTTTCACGCCAGAG
GGAGTCCGGCTTTCACGCCAGAG
GGCAGCTACCCCTAAGAGCC
CCTAAGAGCCAACTTCCAGCTGCC
CGCGGAAGAGGATGGCTACTTCC
CCAAGAGGGCTGTAGCCTGTCC
CGACTACCGCTACTTACTTGTGAC
CTTGTGACGCAAACGACCGAAACTAC
5′-/5Phos/rArArArGrUrArGrUrUrUrCrGrGrUrCrGrUrUrUrGrCrGr
UrCrArCrArArGrUrArArGrUrArGrCrGrGr UrArGrUrCrG/3ddC/-3′
Flynn et al. www.pnas.org/cgi/doi/10.1073/pnas.1106630108
7 of 7