(This is a sample cover image for this issue. The actual cover is not yet available at this time.)
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Aquatic Toxicology 105 (2011) 218–226
Contents lists available at ScienceDirect
Aquatic Toxicology
journal homepage: www.elsevier.com/locate/aquatox
Chronic exposure to dietary selenomethionine increases gonadal steroidogenesis
in female rainbow trout
Steve Wiseman a,∗ , Jith K. Thomas a , Eric Higley a , Olesya Hursky a , Michael Pietrock a,b , Jason C. Raine a ,
John P. Giesy a,b,c,d,e,f,g , David M. Janz a,b , Markus Hecker a,h
a
Toxicology Centre, University of Saskatchewan, Saskatoon, SK, Canada S7N 5B3
Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK, Canada S7N 5B4
Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia
d
Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, China
e
School of Biological Sciences, The University of Hong Kong, Hong Kong, China
f
Department of Zoology, Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824, USA
g
State Key Laboratory of Pollution Control and Resource Reuse & School of the Environment, Nanjing University, Nanjing, China
h
School of Environment and Sustainability, University of Saskatchewan, Saskatoon, SK, Canada S7N 5C8
b
c
a r t i c l e
i n f o
Article history:
Received 11 May 2011
Received in revised form 8 June 2011
Accepted 11 June 2011
Keywords:
Estradiol
Gonadotropin
Vitellogenesis
Selenium
Metalloid
Steroid hormone
a b s t r a c t
Selenomethionine (Se-Met) is the major dietary form of selenium (Se). Detrimental effects have been
associated with exposure to elevated dietary selenium. Previous studies have demonstrated effects of Se
on the endocrine system, in particular effects on cortisol and thyroid hormones. However, no information
is available regarding effects of Se on sex steroid hormones. In the present study, effects of dietary exposure to an environmentally relevant concentration (4.54 mg/kg wet weight (ww)) of Se-Met for 126 days
on concentrations of sex steroid hormones in blood plasma of female rainbow trout were determined.
Furthermore, the molecular basis for effects of Se-Met on plasma sex steroid hormone concentrations
was investigated. Concentrations of androstenedione (A), estrone (E1), and estradiol (E2) were 39.5-, 3.8-,
and 12.7-fold greater in plasma of treated females than the untreated controls, respectively. Testosterone
(T) was detected only in plasma of treated females. The greater E2 concentration stimulated greater transcript abundance of vitellogenin (vtg) and zona-radiata protein (zrp). Female rainbow trout exposed to
Se-Met had greater transcript abundance of key steroidogenic proteins and enzymes, including peripheral
benzodiazepine receptor (pbr), cytochrome P450 side-chain cleavage (P450scc), and 3␤-hydroxysteroid
dehydrogenase (3␤-hsd). Exposure to Se-Met did not affect transcript abundance of luteinizing hormone (lh) or follicle stimulating hormone (fsh). Similarly, there was no change in transcript abundance of
luteinizing hormone receptor (lhr) or follicle stimulating hormone receptor (fshr). Long-term exposure
to dietary Se-Met has the potential to stimulate vitellogenesis in female rainbow trout by directly stimulating ovarian tissue steroidogenesis. This is the first study to report effects of Se on sex steroid hormone
production in fish.
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
Selenium (Se) is an essential micronutrient required by all vertebrate species, including fish. In all living organisms, except for
higher plants and yeast, selenium is an integral component of
selenoproteins (Hesketh, 2008). While the specific biological role
of the majority of selenoproteins is unknown, they have been
found to be involved in protection from oxidative stress, DNA
synthesis and repair, oxidation and reduction reactions, thyroid
hormone activation/inactivation, and Se transport (reviewed in
Janz, 2011). Selenium exists as inorganic (selenite, selenate) and
∗ Corresponding author. Tel.: +1 306 966 4912; fax: +1 306 970 4796.
E-mail address: steve.wiseman@usask.ca (S. Wiseman).
0166-445X/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.aquatox.2011.06.012
organic (seleno-amino acids and selenoproteins) forms, with the
seleno-amino acid, selenomethionine (Se-Met) being the predominant dietary source of Se to fish (Fan et al., 2002).
Dietary concentrations of 0.1–0.5 ␮g/g dry weight (dw) are
required to maintain normal Se-dependent physiological processes. However, when dietary concentrations exceed 3.0 ␮g/g dw
there is the potential for rapid concentration-dependent bioaccumulation to concentrations that can be toxic (Hamilton, 2004;
Lemly, 1997; reviewed in Janz et al., 2010). Developmental toxicities, including deformities, impaired growth, and mortalities have
been observed in larval bluegill (Lepomis macrochirus) exposed to
elevated Se-Met or selenite (Woock et al., 1987) and in northern pike (Esox lucius) exposed to metal mining effluent containing
elevated Se concentrations (Muscatello et al., 2006). Exposure to
elevated Se concentrations has been linked to increased body mass
Author's personal copy
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
and body length in fathead minnow (Pimephales promelas) and
burbot (Lota lota) exposed to metal mining effluent containing elevated Se concentrations (Bennett and Janz, 2007; Driedger et al.,
2009), and in zebrafish (Danio rerio) exposed to Se-Met (Thomas
and Janz, 2011). Significantly altered swimming performance and
greater whole body concentrations of triglycerides and glycogen
were observed in zebrafish exposed to 3.7 ␮g/g dw or greater of
dietary Se-Met (Thomas and Janz, 2011). Until recently, the propensity for Se to substitute for sulfur in methionine during protein
synthesis has been viewed as a central mechanism of Se toxicity, especially during embryo development (reviewed in Janz et al.,
2010). However, oxidative stress is also manifested during Se intoxication (reviewed in Janz et al., 2010). For example, exposure to
selenite increased oxidative stress in juvenile rainbow trout (Miller
et al., 2007) and primary cultures of rainbow trout hepatocytes
(Misra and Niyogi, 2009).
There is limited information describing effects of Se on the
endocrine system. Elevated whole body concentrations of cortisol
were observed in zebrafish exposed via the diet to 26.6 ␮g SeMet/g dw (Thomas and Janz, 2011). Altered cortisol concentrations
and greater concentrations of triiodothyronine (T3) and thyroxine
(T4) have also been reported in plasma of rainbow trout exposed to
waterborne selenite (Miller et al., 2007). Exposure of mammals to
Se can alter concentrations of steroid hormones in blood. Exposure to Se significantly increased concentrations of testosterone
(T) in serum and restored testicular activity of key steroidogenic
enzymes in male Wistar rats that were simultaneously exposed
to cadmium (El-Maraghy and Nassar, 2011). Production of 17-␤
estradiol (E2) was greater in bovine granulose cells exposed to Se
(Basini and Tamanini, 2000). In addition to effects on E2 and T, Se
can affect hormone receptor function, in particular the estrogen
receptor (ER). In vitro exposure of MCF-7 cells to Se resulted in less
transcript abundance of er-␣, inhibited ligand binding, and inhibited expression of ER-␣ target genes relative to that of controls (Lee
et al., 2005; Shah et al., 2005). In contrast, er-␤ transcript abundance was greater in cells exposed to Se (Lee et al., 2005). The goal
of the current study was to investigate whether long-term dietary
exposure to an environmentally relevant concentration of Se-Met
effects circulating sex hormone levels in female rainbow trout, and
to elucidate the mechanism of any observed effects.
2. Materials and methods
2.1. Chemicals
Seleno-l-methionine (purity >98%) was purchased from
Sigma–Aldrich (Oakville, ON, Canada). Deuterium-labeled standards, estrone-1-2,4,16,16-d4 (d4 -E1), 17␤-estradiol-2,4,16,16-d4
(d4 -␤E2), androstenedione-d7 , and testosterone-d5 were purchased from C/D/N Isotope (Pointe-Claire, QC, Canada).
219
daily (Martin Classic Sinking Fish Feed, Martin Mills Inc., Elmira,
ON, Canada).
Trout were randomly assigned to four 719 L tanks (two tanks
per treatment) supplied with continuous running water at a flow
rate of 4 L/min and maintained at approximately 6 ◦ C under a
12L:12D photoperiod. The initial stocking density was approximately 8–9 kg/m3 . During the exposure period trout were fed
approximately 1.5% body weight of food with or without Se-Met
6 days per week, split between 2 daily feedings to ensure complete consumption of food. For preparation of food containing Se, a
Se stock solution containing 1 g/L nominal concentration was prepared by dissolving 250 mg seleno-l-methionine (Sigma Aldrich
Canada, Ltd.) in 100 ml of nanopure water, and diluting 15 ml of
this stock solution in 375 ml of nanopure water. The resulting solution was subsequently mixed with 1 kg of commercial trout pellet
which had been crushed with the help of a blender. The resulting
“paste” was processed in a noodle maker to form spaghetti-like
pieces which after freezing at −70 ◦ C were broken into small pieces
of approximately 5 mm3 . Concentrations of Se in food were determined by inductively coupled plasma mass spectrometry (ICP-MS)
to be on average 4.54 mg Se/kg wet weight (ww). The concentration
of Se in untreated pellets used to feed the control fish was 1.10 mg
Se/kg ww. The duration of exposure was 126 days.
Following the exposure period, trout were netted and immediately anesthetized with 150 mg/L MS-222, and anesthesia was
reached within 1 min. Fish mass (g) and length (cm) were recorded
for determination of condition factor. Blood was collected from
the caudal vein by use of heparinized syringes, and stored at 4 ◦ C
overnight and then centrifuged at 2000 × g for 15 min at 4 ◦ C. Isolated plasma was frozen for subsequent hormone determination.
Ovary, brain (including pituitary gland), and liver was excised and
stored at −80 ◦ C until needed for analysis of transcript abundance.
Ovarian and liver tissue mass was recorded for determination of
gonadosomatic index (GSI) and hepatosomatic index (HSI). Muscle tissue was excised from the area posterior to the dorsal fin and
frozen at −80 ◦ C until quantification of Se-Met.
2.3. Quantification of Se
Muscle tissue was lyophilized and homogenized by use of a mortar and pestle. Aliquants of 100 mg of the homogenized samples
were cold digested in Teflon vials by use of 5 ml of ultra-pure nitric
acid and 1.5 ml hydrogen peroxide. After digestion, samples were
concentrated on a hot plate (<75 ◦ C) and reconstituted in 5 ml of
2% ultrapure nitric acid. Reconstituted samples were stored at 4 ◦ C
until analysis. Total concentrations of Se were measured by ICPMS following US EPA method ILM05.2D (Creed et al., 1994). The
method detection limit (MDL) was 0.5 ␮g Se/g dw. Recovery of Se
was determined by use of a certified reference material (TORT-2,
lobster hepatopancreas, NRC, Ottawa, ON, Canada). Mean moisture
content of muscle, calculated as the difference in mass between
fresh tissue and lyophilized tissue, was 74.3 ± 1.68%
2.2. Experimental protocol
2.4. Quantification of hormones in blood plasma
The studies reported here were approved by the University of
Saskatchewan’s Animal Research Ethics Board, and adhered to the
Canadian Council on Animal Care guidelines for humane animal
use. All experiments were conducted in the Aquatic Toxicology
Research Facility (ATRF) at the University of Saskatchewan’s Toxicology Centre. Female rainbow trout were approximately 1.5 year
of age and were randomly selected from an in-house stock reared
from eggs obtained from a commercial supplier (Troutlodge, Sumner, WA, USA). Prior to initiation of the study trout were reared in
1666 L tanks supplied with running water at approximately 6 ◦ C and
maintained under a 12L:12D photoperiod. Trout were fed approximately 2% body weight of a commercially available trout feed once
Concentrations of hormones in blood plasma were determined
as described previously with a few modifications (Chang et al.,
2009, 2010). Briefly, surrogate deuterium-labeled standards were
spiked into 450 ␮L of plasma and the samples were extracted two
times with 2.5 volumes of diethyl ether by vortex-mixing for 1 min
followed by centrifugation at 8000 × g for 5 min. The water phase
was discarded and the solvent phase was evaporated under nitrogen and the dried residue was dissolved in 200 ␮L methanol. For
androstenedione (A) and T, 100 ␮L of methanol solution was separated into a vial for quantification. For quantification of E2 and
estrone (E1) the remaining 100 ␮L aliquot of methanol solution was
Author's personal copy
220
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
Table 1
Sequence, annealing temperature, and corresponding target gene Genbank accession numbers of oligonucleotide primers used in quantitative real-time PCR.
Target
Accession #
Sequence (5 –3 )
Annealing temp.
␤-Actin
AF157514
60
pbr
AY029216
star
AB047032
P450scc
S57305
3␤-hsd
S72665
vtg
U26703
zrp
AF407574
er-␣
AJ242740
er-␤
CA361379
gph-␣
NM 001146456
fsh-␤
AB050835
lh-␤
AB050836
fshr
AF439405
lhr
AF439404
F: AGAGCTACGAGCTGCCTGAC
R: GCAAGACTCCATACCGAGGA
F: AGCCTACCAAGCTCCGTGTA
R: CTAGATGAGGCAGGGCAGTC
F: TTCGTTAGTGTTCGCTGTGC
R: CCGTTCTCTGCCCTAACAAC
F: GCTTCATCCAGTTGCAGTCA
R: CAGGTCTGGGGAACACATCT
F: CCAGGAGAATGTGGTGTCCT
R: CCTCCTTCTTGGTCTTGCTG
F: TGTCTCTCTATGCCCCAAGC
R: CCACAGGTCTGTCCCTTCAT
F: CCCCTGTGACCCAGGCTCAA
R: TAATGGCATCACAATGGGCGG
F: CCCAGCCAGTCATACTACCT
R: GACCTTCTCCTCTGACGCTGACA
F: AGCCCTCTCCTCCACCCTACCA
R: ACAGCTGGCTGAGGAGGAGTT
F: ACAGGCTTCCACCAAGAGAA
R: AAGCTCTGGAAAAGCAGCAG
F: GCGAAACAACGGACCTGAACTAT
R: GGACCACTCCTTGAAGTTACACA
F: CTGCGTCACCAAGGAGCCGGTTT
R: GACAGTCAGGTAGGCGGATCGTT
F: TCAGTCACCTGACGATCTGCAA
R: TCCTGCAGGTCCAGCAGAAACG
F: CTTCTCAACCTCAATGAAATCTTC
R: GGATATACTCAGATAACGCAGCTT
60
60
60
60
60
60
60
60
60
60
60
60
60
Fig. 1. Concentrations of sex steroid hormones in blood plasma of female rainbow trout. Concentrations of (A) androstenedione, (B) testosterone, (C) estrone, and (D)
estradiol were quantified by high pressure liquid chromatography tandem mass spectrometry (LC–MS/MS). Concentrations are expressed as ng/ml. Bars represent the mean
concentration (±S.E.M.) of 12 (controls) or 22 (Se-Met exposed) trout. An asterisk denotes a statistically significant difference from the controls (t-test, p < 0.05). BDL indicates
a concentration less than the limit of quantification.
Author's personal copy
1.26 ± 0.08
1.96 ± 0.06*
Significantly different from the control group (t-test, p < 0.05). n = 12–24.
*
Liver mass (g)
3.61 ± 0.2
4.78 ± 0.24*
0.20 ± 0.04
0.59 ± 0.10*
Gonadosomatic index (GSI)
Ovary mass (g)
0.54 ± 0.07
1.41 ± 0.24*
1.21 ± 0.06
1.35 ± 0.03*
28.98 ± 0.73
26.17 ± 0.42*
Condition factor (k)
Fork length (cm)
302.17 ± 17.37
244.56 ± 10.84*
Statistical analyses were conducted using SPSS 19 (SPSS,
Chicago, IL, USA). All data are expressed as mean ± S.E.M. Normality
of each dataset was assessed by use of a the Kolomogrov–Smirnov
one-sample test and homogeneity of variance was determined by
use of a Levene’s test. Data was log transformed when necessary to
ensure homogeneity of variance. Non-transformed data are shown
in all figures. Changes in plasma hormone concentrations and target
Body mass (g)
2.6. Statistical analyses
Control
Se-Met
Total RNA was extracted from approximately 30 mg of ovarian,
brain, or liver tissue with the RNeasy Plus Mini Kit (Qiagen, Mississauga, ON, CA) according to the manufacturer’s protocol. Purified
RNA was quantified with a NanoDrop ND-1000 Spectrophotometer (Nanodrop Technologies, Welmington, DE, USA). RNA integrity
was checked on a 1% denaturing formaldehyde–agarose gel with
ethidium bromide and visualized under ultraviolet (UV) light on a
VersaDoc 4000MP imaging system (Bio-Rad, Mississauga, ON, CA).
Purified samples of RNA were stored at −80 ◦ C until analysis. Firststrand cDNA synthesis was performed using an iScriptTM cDNA
Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions by use of 1 ␮g total RNA. The cDNA samples were stored at
−80 ◦ C until further analysis.
Real-time PCR was performed in 96-well PCR plates by use of an
ABI 7300 Real-Time PCR System (Applied Biosystems). Sequences
of the gene-specific PCR primers are presented (Table 1). A separate 45 ␮L PCR reaction mixture consisting of Power SYBR® Green
master mix (Applied Biosystems), cDNA, gene-specific primers, and
nuclease free water was prepared for each cDNA sample and primer
pair. A final reaction volume of 20 ␮L was transferred to each well
and reactions were performed in duplicate. The PCR reaction mixture was denatured at 95 ◦ C for 10 min before the first PCR cycle.
The thermal cycle profile was as follows: denature for 10 s at 95 ◦ C
and extension for 1 min at 60 ◦ C for a total of 40 PCR cycles. Target gene transcript abundance was quantified by normalizing to
␤-actin according to the method of Simon (2003).
Exposure group
2.5. Real-time PCR
Table 2
Mean body mass, fork length, condition factor, ovary mass, liver mass, gonadosomatic index, and hepatosomatic index of female rainbow trout exposed to either a control or Se-Met spiked diet.
evaporated and re-dissolved in 100 ␮L of aqueous sodium bicarbonate (100 mmol/L, pH adjusted to 10.5 with sodium hydroxide).
Next, 100 ␮L of dansyl chloride (1 mg/ml in acetone) was added and
the samples were vortex-mixed for 1 min and incubated at 60 ◦ C
for 5 min. Finally, 1 ml of 18 M water was added and the samples
were extracted 3 times with 2 ml of hexane, dried under a stream
of nitrogen, and reconstituted with 100 ␮L of acetonitrile before
LC–MS/MS analysis.
Separation and quantification of hormones was conducted by
use of an Agilent 1200 series high pressure liquid chromatography (HPLC) system (Santa Clara, CA, USA) connected to an API 3000
triple-quadrupole tandem mass spectrometer (MS/MS) system (PE
Sciex, Concord, ON, Canada). For E2 and E1, the mobile phase was
acetonitrile (solvent B) and 0.1% formic acid (solvent A) with a
gradient elution of A:B = 40:60 (0–1 min), 5:95 (1–15 min), 5:95
(15–25 min) at a flow rate of 250 ␮L/min. A and T chromatography
was performed by use of 0.1% formic acid (solvent C) and methanol
(solvent D) with a gradient elution of C:D = 65:35 (0–2 min), 45:55
(2–10 min), 0:100 (10–18 min) at a flow rate of 250 ␮L/min. Extracts
were separated at room temperature on a Betasil C18 column
(100 mm × 2.1 mm, 5 ␮m particle size; Thermo, Waltham, MA, USA)
before MS/MS analysis. All data were acquired and processed by
use of ABI Sciex Analyst 1.4.1 software (Applied Bioscience, Foster
City, CA, USA). The limit of quantification (LOQ) for E2 and E1 was
0.125 ng/ml, and the LOQ for A and T was 0.5 ng/ml. Where hormone concentrations were less than the LOQ a value of one half the
LOQ was used for statistical purposes.
221
Hepatosomatic index (HSI)
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
Author's personal copy
222
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
Fig. 2. Transcript abundance of vitellogenin and zona-radiata protein in livers of
female rainbow trout. Transcript abundance of (A) vitellogenin (vtg) and (B) zonaradiata protein (zrp) was determined by quantitative real-time PCR. Bars represent
the mean fold transcript abundance (±S.E.M.) of 8 trout relative to the controls.
An asterisk denotes a statistically significant difference from the controls (t-test,
p < 0.05).
gene transcript abundance were determined by two sample t-test.
Differences were considered statistically significant at p < 0.05.
Fig. 3. Transcript abundance of estrogen receptors in livers of female rainbow trout.
Transcript abundance of (A) estrogen receptor-␣ (er-␣) and (B) estrogen receptor␤ (er-␤) was determined by quantitative real-time PCR. Bars represent the mean
fold transcript abundance (±S.E.M.) of 8 trout relative to the controls. An asterisk
denotes a statistically significant difference from the controls (t-test, p < 0.05).
nificantly greater in trout exposed to Se-Met than the untreated
controls (Table 2).
3.3. Plasma hormones
3. Results
3.1. Concentrations of Se in muscle
Three individuals from the control and Se-Met exposure groups
were randomly selected for analysis of the Se concentration in
muscle. The concentration of Se in muscle of Se-Met fed trout
(8.84 ± 0.67 ␮g/g dw) was significantly greater (p = 0.01, n = 3) than
the concentration in control trout (2.28 ± 0.05 ␮g/g dw).
3.2. Growth and somatic indices
There were no mortalities in either the control group or those
exposed to Se-Met, but trout exposed to Se-Met were significantly
smaller than the unexposed controls. Both body mass (p = 0.01) and
fork length (p = 0.02) of trout exposed to Se-Met were significantly
less than those of controls. The condition factor (k) of trout exposed
to Se-Met was significantly greater than of the controls (p = 0.04).
Masses of ovaries (p = 0.002) and GSI (p = 0.001) were significantly
greater in trout exposed to Se-Met than in controls (Table 2).
Although maturation stage of the ovaries was not determined,
macroscopic examination did not reveal differences in maturation
stage. Average mass of liver (p = 0.004) and HSI (p = 0.001) was sig-
Concentrations of hormones in plasma of trout exposed to SeMet were significantly (all values p < 0.0001) greater than those
in controls (Fig. 1). Concentrations of A were approximately 40fold greater in trout exposed to Se-Met, with mean concentrations
of 0.41 ± 0.07 ng/ml in control trout and 16.3 ± 2.97 ng/ml in trout
fed Se-Met. The concentration of T was less than the MDL in control trout, while the mean concentration was 4.5 ± 0.82 ng/ml in
trout exposed to Se-Met. The mean concentration of E1 was 3.8fold greater in trout exposed to Se-Met than that in the controls.
Concentrations of E1 were 0.08 ± 0.007 and 0.31 ± 0.07 ng/ml in
control trout and those fed Se-Met, respectively. Concentrations of
E2 were 13-fold greater in trout exposed to Se-Met than in the controls, with mean concentrations of 0.40 ± 0.04 and 5.1 ± 1.07 ng/ml
in unexposed and exposed trout, respectively.
3.4. Estrogen receptors and vitellogenic proteins transcript
abundance
Abundances of ER isoform transcripts and E2-responsive genes
transcripts were significantly different between controls and SeMet exposed trout. Specifically, the abundance of er-␣ (p = 0.005)
transcripts was 2.2 ± 0.29 fold greater in trout fed Se-Met than in
Author's personal copy
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
223
Fig. 4. Transcript abundance of steroidogenic enzymes in ovaries of female rainbow trout. Transcript abundance of (A) peripheral benzodiazepine receptor (pbr), (B) steroidogenic acute regulatory protein (star), (C) cytochrome P450 side chain cleavage (p450 scc), and (D) 3␤-hydroxysteroid dehydrogenase (3␤-hsd) was determined by quantitative
real-time PCR. Bars represent the mean fold transcript abundance (±S.E.M.) of 8 trout relative to the controls. An asterisk denotes a statistically significant difference from
the controls (t-test, p < 0.05).
the controls (Fig. 2). Conversely, abundance of er-␤ (p = 0.02) transcripts was 1.8 ± 0.05 fold less in trout exposed to Se-Met than in
the unexposed trout. Abundances of vitellogenin (vtg) (p = 0.03)
and zona-radiata protein (zrp) (p = 0.04) transcripts were significantly greater by 205 ± 79 fold and 9.8 ± 3.8 fold, respectively, in
trout exposed to Se-Met in the diet (Fig. 3).
3.5. Abundance of steroidogenic protein transcripts
Abundances of transcripts of key steroidogenic proteins/enzymes were significantly (all values p < 0.004) greater
in trout exposed to Se-Met than in the controls (Fig. 4). Specifically,
abundances of transcripts of peripheral-type benzodiazepine
receptor (pbr), cytochrome P450 cholesterol side chain cleavage
(P450scc), and 3␤-hydroxysteroid dehydrogenase (3␤-hsd) were
greater by 5.9 ± 0.86, 4.0 ± 0.88, and 4.4 ± 1.51-fold, respectively,
in trout exposed to Se-Met than in the controls. The abundance
of the steroidogenic acute regulatory protein (star) transcripts
was greater in the trout fed Se-Met, but the difference was not
statistically significant.
3.6. Transcript abundance of gonadotropins and gonadotropin
receptors
There were no statistically significant differences in abundances
of transcripts of fsh or lh subunits, or the fsh and lh receptors between controls and trout fed Se-Met (Fig. 5). Specifically,
there were no statistically significant difference in abundances
of transcripts of glycoprotein hormone ␣-subunit (gph-␣), or the
␤-subunit of lh and fsh between controls and trout fed Se-Met.
The abundances of mRNA of neither follicle stimulating hormone
receptor (fshr) nor luteinizing hormone receptor (lhr) were different between ovaries collected from control and trout fed Se-Met
(Fig. 6).
4. Discussion
In the current study fish were exposed to a dietary Se-Met concentration of 4.54 mg/kg ww, which is similar to concentrations
of Se in fish and invertebrates collected from Se affected sites
(Lemly, 1997; Fan et al., 2002; Hamilton, 2004; Muscatello et al.,
2006). The effects of chronic exposure of female rainbow trout
to environmentally relevant concentrations Se-Met on endocrine
functions as well as body and gonad growth reported here are the
first reports of effects of Se on these parameters in fish. The lesser
body mass and fork length of trout fed Se-Met is in contrast to the
greater body mass and fork length of juvenile burbot and fathead
minnows collected from areas where they were exposed to Se in
aquatic systems (Bennett and Janz, 2007; Driedger et al., 2009) and
zebrafish exposed to dietary Se-Met (Thomas and Janz, 2011). However, in another chronic exposure study no effects on growth were
observed in the cutthroat trout (Oncorhynchus clarki bouvieri) fed
11.2 mg/g body weight Se-Met over a 2.5 year period (Hardy et al.,
2009). The magnitude of k of trout fed Se-Met was greater than that
of the controls. This result is in contrast with the results of other
studies where no change in k was observed for trout exposed to
Author's personal copy
224
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
Fig. 6. Transcript abundance of gonadotropin receptors in ovaries of female rainbow
trout. Transcript abundance of (A) follicle stimulating hormone receptor (fshr) and
(B) luteinizing hormone receptor (lhr) was determined by quantitative real-time
PCR. Bars represent the mean fold transcript abundance (±S.E.M.) of 8 trout relative
to the controls. An asterisk denotes a statistically significant difference from the
controls (t-test, p < 0.05).
Fig. 5. Transcript abundance of gonadotropins in brains (including pituitaries) of
female rainbow trout. Transcript abundance of (A) glycoprotein hormone ␣-subunit
(gth-␣), (B) follicle stimulating hormone ␤-subunit (fsh-␤) and (C) luteinizing
hormone ␤-subunit (lh-␤) was determined by quantitative real-time PCR. Bars
represent the mean fold transcript abundance (±S.E.M.) of 8 trout relative to the
controls. An asterisk denotes a statistically significant difference from the controls
(t-test, p < 0.05).
waterborne selenite for 30 days (Miller et al., 2007) and zebrafish
exposed to dietary Se-Met for 90 days (Thomas and Janz, 2011).
Trout fed Se-Met did have greater HSI and GSI. However, Miller et al.
(2007) did not observe changes in HSI or GSI of juvenile rainbow
trout exposed to waterborne selenite for either 4 or 30 days. The
greater GSI is suggestive of ovarian maturation, including growth
of vitellogenic oocytes (Tyler et al., 1990). As discussed below, there
was greater vtg transcript abundance in Se-Met exposed trout. This
suggests that the Se-Met exposed trout allocated more energy for
gonad maturation than growth. Synthesis of VTG is also likely a reason for the greater HSI. In addition, because liver is a primary site
of glycogen synthesis and storage, and triglyceride synthesis, the
greater HSI of Se-Met exposed trout may be due to their glycogen
and triglyceride content. Greater whole body glycogen and triglyceride concentrations in zebrafish exposed to dietary Se-Met were
recently reported by Thomas and Janz (2011).
Concentrations of A, T, E1, and E2 in plasma were significantly
greater in rainbow trout exposed to dietary Se-Met. This is the
first study to report effects of Se-Met on circulating sex steroid
concentrations in fish. Similar stimulating effects of Se-Met on E2
production were observed in bovine granulosa cells (Basini and
Tamanini, 2000), and on serum T concentrations in male Wistar
rats co-exposed to Se-Met and cadmium (El-Maraghy and Nassar,
2011). Therefore, the results of this study confirm the effects of
Se-Met observed in mammals, and suggest that the mechanism(s)
whereby Se-Met stimulates greater concentrations of plasma E2
may be conserved across different vertebrate groups.
The greater concentration of each hormone in the plasma of
trout exposed to Se-Met is likely to have been due to greater
steroidogenesis. This hypothesis is supported by the greater transcript abundance of the cholesterol transport protein PBR, and the
greater abundance of transcripts of the steroidogenic enzymes,
P450scc and 3␤-HSD. Greater steroidogenesis could be due to
effects of Se on synthesis and secretion of gonadotropin hormones. In mammals, stimulation of ovarian steroidogenesis occurs
Author's personal copy
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
when gonadotropin releasing hormone (GnRH) triggers secretion
of the gonadotropins, LH and FSH (Richards, 1994; Thomas et al.,
2005). These peptide hormones enter circulation and bind to their
respective ovarian receptors (FSHR and LHR) and stimulate oocyte
maturation and steroidogenesis (Levavi-Sivan et al., 2010; Zohar
et al., 2010). In salmonids, FSH promotes early oocyte maturation
through vitellogenesis and LH promotes final oocyte maturation
(Levavi-Sivan et al., 2010; Patiño and Sullivan, 2002; Swanson et al.,
2003; Tyler et al., 1997; Zohar et al., 2010). Greater E2 and T production in mid to late cortical alveolus stage follicles from coho salmon
(Oncorhynchus kisutch) exposed to FSH is related to greater star and
3␤-hsd transcript abundance (Luckenbach et al., 2011). In the current study, the greater concentration of E2 in blood plasma and the
greater transcript abundances of vtg and zrp suggest that concentrations of FSH may have been greater in trout fed Se-Met. However,
there was no difference in abundance of transcripts of the ␣ (gph-␣)
or ␤-subunit of FSH and LH between control and Se-Met exposed
fish. This result is consistent with Se-Met not stimulating synthesis of FSH or LH. However, in primary cultures of pituitary cells
from female Masu salmon (Oncorhynchus masou), greater secretion
of FSH and LH was not matched by greater abundance of mRNA
of either the gph-␣ or the ␤-subunit of FSH and LH during early
oogenesis (Furukuma et al., 2008). Because plasma FSH and LH concentrations were not determined in the current study any effects of
Se-Met on plasma concentrations of these hormones are unknown.
Greater ovarian steroidogenesis might result from sensitivity of
steroidogenic tissue to circulating FSH and LH. In salmonids, greater
abundances of fshr and lhr transcripts ultimately led to greater
sensitivity to FSH and LH and a greater abundance of mRNA of
steroidogenic enzymes (Kusakabe et al., 2006; Luckenbach et al.,
2011; Planas and Swanson, 1995). In the current study, there was
no difference in ovarian fshr or lhr transcript abundance between
the control and trout exposed to Se-Met which is consistent with
exposure to Se not stimulating greater amounts of gonadotropin
receptors. Thus, it is unlikely that ovaries from trout exposed to
Se-Met were more sensitive to circulating FSH or LH. There is limited information about the regulation of gondotropin receptors in
fish. It is possible that transcript abundance of fshr or lhr is not representative of cellular receptor content. Such a mismatch between
transcript and protein abundances has been demonstrated for other
steroid receptors, including the rainbow trout glucocorticoid receptor (Sathiyaa and Vijayan, 2003).
The greater GSI and concentration of E2 in plasma of trout
exposed to Se-Met is consistent with these animals undergoing vitellogenesis. The mean circulating concentration of E2 was
4.8 ng/ml in trout fed Se-Met, which is within the range of E2
concentrations observed during pre-vitellogenesis in this species
(Tintos et al., 2006). The greater abundance of vtg and zrp transcripts
in livers of trout exposed to Se exposed supports this hypothesis.
Synthesis of VTG and ZRP in the liver is regulated by cytoplasmic ER signaling (Nagler et al., 2010). Two subtypes of the ER, ER-␣
and ER-␤, each of which has 2 isoforms (ER-␣ 1/2; ER-␤ 1/2) are
expressed in rainbow trout liver (Nagler et al., 2007). The role of
each ER isoform in vitellogenesis is unclear, but both subtypes are
involved, with ER-␤ likely playing a more prominent role (LeañosCastañeda and Van Der Kraak, 2007; Marlatt et al., 2008; Nelson
and Habibi, 2010; Nelson et al., 2007). The greater abundance of
er-␣ transcript in trout fed Se-Met is likely due to the greater
concentration of plasma E2. E2 increases hepatic er-␣ transcript
abundance in rainbow trout via post-transcriptional stabilization
(Boyce-Derricott et al., 2009, 2010). The mechanism that caused
the lesser er-␤ transcript abundance in trout exposed to Se-Met is
unknown. Exposure to E2 had no effect on er-␤ transcript abundance in male rainbow trout, but increased transcript abundance
in immortal rainbow trout liver cell lines (Boyce-Derricott et al.,
225
2009). Similarly, there was no effect of E2 on er-␤ transcript abundance in largemouth bass (Micropterus salmoides, Sabo-Attwood
et al., 2005). Other studies have demonstrated that E2 causes
greater abundance of er-␤ transcript in goldfish, and that this induction leads to a greater abundance of er-␣ (Nelson and Habibi, 2010).
It is unknown whether these transcriptional responses are due to
direct effects of Se-Met on the expression of ER. Selenium decreased
expression of ER-␣ in mammalian MCF-7 cells (Lee et al., 2005;
Shah et al., 2005). Conversely, expression of ER-␤ was greater in
cells exposed to Se (Lee et al., 2005). It is possible that the decrease
in er-␤ transcript abundance is a direct effect of Se, but additional
studies are required to investigate this effect.
The results of this study suggest that long-term dietary exposure
of immature female rainbow trout to an environmentally realistic
dietary concentration of Se-Met results in greater plasma concentrations of sex steroid hormones by stimulating steroidogenesis.
The greater steroidogenesis may not be due to greater synthesis of
FSH or LH, or their ovarian receptors. Rather, dietary Se-Met directly
stimulates ovarian steroidogenesis by increasing cholesterol transport into steroidogenic cells and increasing steroidogenic enzyme
expression. However, as transcript abundance of the gonadotropins
and their receptors may not accurately reflect their protein abundances, additional research is required to further elucidate the
mechanism of Se-Met effects on ovarian steroidogenesis. Regardless of the mechanism of action, the greater E2 concentration
resulting from the actions of Se-Met stimulates vitellogenesis. This
is the first study to demonstrate endocrine-disrupting effects of
Se-Met.
Acknowledgements
This work was supported by separate Natural Sciences and Engineering Research Council of Canada (NSERC) Discovery Grants to
J.P.G. [grant number 326415-07], M.P. [grant number 371538-09]
and D.M.J. [grant number 288163-10]. J.P.G. was also supported
by a grant from Western Economic Diversification Canada (grant
numbers 6971, 6807). The authors acknowledge the support of
an instrumentation grant from the Canada Foundation for Innovation. Prof. Giesy was supported by the Canada Research Chair
program, an at large Chair Professorship at the Department of Biology and Chemistry and State Key Laboratory in Marine Pollution,
City University of Hong Kong, The Einstein Professor Program of the
Chinese Academy of Sciences and the Visiting Professor Program
of King Saud University. The authors wish to thank the following
people for their assistance with tissue collection: Amber Tompsett,
Fengyan Liu, Jonathan Doering, Brett Tendler, Shawn Beitel and
Landon McPhee. We acknowledge the support of the Aquatic Toxicology Research Facility (ARTF) at the Toxicology Centre, University
of Saskatchewan, in providing space and equipment for the culturing of rainbow trout and the exposure portion of the study.
References
Basini, G., Tamanini, C., 2000. Selenium stimulates estradiol production in bovine
granulosa cells: possible involvement of nitric oxide. Domest. Anim. Endocrinol.
18, 1–17.
Bennett, P.M., Janz, D.M., 2007. Bioenergetics and growth of young-of the-year
northern pike (Esox lucius) and burbot (Lota lota) exposed to metal mining
effluent. Ecotoxicol. Environ. Saf. 68, 1–12.
Boyce-Derricott, J., Nagler, J.J., Cloud, J.G., 2009. Regulation of hepatic estrogen receptor isoform mRNA expression in rainbow trout (Oncorhynchus mykiss). Gen.
Comp. Endocrinol. 161, 73–78.
Boyce-Derricott, J., Nagler, J.J., Cloud, J.G., 2010. Variation among rainbow trout
(Oncorhynchus mykiss) estrogen receptor isoform 3 untranslated regions and
the effect of 17beta-estradiol on mRNA stability in hepatocyte culture. DNA Cell
Biol. 29, 229–234.
Chang, H., Wan, Y., Hu, J., 2009. Determination and source apportionment of five
classes of steroid hormones in urban rivers. Environ. Sci. Technol. 43, 7691–7698.
Chang, H., Wan, Y., Naile, J., Zhang, X.W., Wiseman, S., Hecker, M., Lam, M.H.W.,
Giesy, J.P., Jones, P.D., 2010. Simultaneous quantification of multiple classes of
Author's personal copy
226
S. Wiseman et al. / Aquatic Toxicology 105 (2011) 218–226
phenolic compounds in blood plasma by liquid chromatography–electrospray
tandem mass spectrometry. J. Chromatogr. A 1217, 506–513.
Creed, J.T., Brockhoff, C.A., Martin, T.D., 1994. Determination of Trace Elements in
Water and Wastes by Inductively Coupled Plasma-Mass Spectrometry. Environmental Monitoring System Laboratory Office of Research and Development
U. S. Environmental Protection Agency. Method 200.8.
Driedger, K., Weber, L.P., Rickwood, C.J., Dubé, M.G., Janz, D.M., 2009. Overwinter
alterations in energy stores and growth in juvenile fishes inhabiting areas receiving metal mining and municipal wastewater effluents. Environ. Toxicol. Chem.
28, 296–304.
El-Maraghy, S.A., Nassar, N.N., 2011. Modulatory effects of lipoic acid and selenium
against cadmium-induced biochemical alterations in testicular steroidogenesis.
J. Biochem. Mol. Toxicol. 25, 15–25.
Fan, T.W.M., The, S.J., Hinton, D.E., Higashi, R.M., 2002. Selenium biotransformations
into proteinaceous forms by foodweb organisms of selenium-laden drainage
waters in California. Aquat. Toxicol. 57, 65–84.
Furukuma, S., Onuma, T., Swanson, P., Luo, Q., Koide, N., Okada, H., Urano, A., Ando,
H., 2008. Stimulatory effects of insulin-like growth factor 1 on expression of
gonadotropin subunit genes and release of follicle-stimulating hormone and
luteinizing hormone in masu salmon pituitary cells early in gametogenesis.
Zoolog. Sci. 25, 88–98.
Hamilton, S., 2004. Review of selenium toxicity in the aquatic food chain. Sci. Total
Environ. 326, 1–31.
Hardy, R.W., Oram, L.L., Moller, G., 2009. Effects of dietary selenomethionine on
cutthroat trout (Oncorhynchus clarki bouvieri) growth and reproductive performance over a life cycle. Arch. Environ. Contam. Toxicol. 58, 237–245.
Hesketh, J., 2008. Nutrigenomics and selenium: gene expression patterns, physiological targets, and genetics. Annu. Rev. Nutr. 28, 157–177.
Janz, D.M., DeForest, D.K., Brooks, M.L., Chapman, P.M., Gilron, G., Hoff, D., Hopkins,
W.D., McIntyre, D.O., Mebane, C.A., Palace, V.P., Skorupa, J.P., Wayland, M., 2010.
Selenium toxicity to aquatic organisms. In: Chapman, P.M., Adams, W.J., Brooks,
M.L., Delos, C.G., Luoma, S.N., Maher, W.A., Ohlendorf, H.M., Presser, T.S., Shaw,
D.P. (Eds.), Ecological Assessment of Selenium in the Aquatic Environment. , 1st
ed. CRC Press, Boca Raton, FL, pp. 141–231.
Janz, D.M., 2011. Selenium. In: Wood, C.M., Brauner, C.J., Farrell, A.P. (Eds.), Fish
Physiology, vol. 31A: Homeostasis and Toxicology of Essential Metals. Academic
Press, San Diego, CA, pp. 327–374.
Kusakabe, M., Nakamura, I., Evans, J., Swanson, P., Young, G., 2006. Changes in mRNAs
encoding steroidogenic acute regulatory protein, steroidogenic enzymes and
receptors for gonadotropins during spermatogenesis in rainbow trout testes. J.
Endocrinol. 189, 541–554.
Leaños-Castañeda, O., Van Der Kraak, G., 2007. Functional characterization of estrogen receptor subtypes ER alpha and ER beta, mediating vitellogenin production
in the liver of rainbow trout. Toxicol. Appl. Pharmacol. 224, 116–125.
Lee, S.O., Nadiminty, N., Wu, X.X., Lou, W., Dong, Y., Ip, C., Onate, S.A., Gao, A.C., 2005.
Selenium disrupts estrogen signaling by altering estrogen receptor expression
and ligand binding in human breast cancer cells. Cancer Res. 65, 3487–3492.
Lemly, D., 1997. A teratogenic deformity index for evaluating impacts of selenium
on fish populations. Ecotoxicol. Environ. Saf. 37, 259–266.
Levavi-Sivan, B., Bogerd, J., Mañanós, E.L., Gómez, A., Lareyre, J.J., 2010. Perspectives on fish gonadotropins and their receptors. Gen. Comp. Endocrinol. 165,
412–437.
Luckenbach, J.A., Dickey, J.T., Swanson, P., 2011. Follicle-stimulating hormone regulation of ovarian transcripts for steroidogenesis-related proteins and cell
survival, growth and differentiation factors in vitro during early secondary
oocyte growth in coho salmon. Gen. Comp. Endocrinol. 171, 52–63.
Marlatt, V.L., Martyniuk, C.J., Zhang, D., Xiong, H., Watt, J., Xia, X., Moon, T., Trudeau,
V.L., 2008. Auto-regulation of estrogen receptor subtypes and gene expression
profiling of 17-estradiol action in the neuroendocrine axis of male goldfish. Mol.
Cell. Endocrinol. 283, 38–48.
Miller, L.L., Wang, F., Palace, V.P., Hontela, A., 2007. Effects of acute and subchronic exposures to waterborne selenite on the physiological stress response
and oxidative stress indicators in juvenile rainbow trout. Aquat. Toxicol. 83,
263–271.
Misra, S., Niyogi, S., 2009. Selenite causes cytotoxicity in rainbow trout
(Oncorhynchus mykiss) hepatocytes by inducing oxidative stress. Toxicol. In Vitro
23, 1249–1258.
Muscatello, J.R., Bennett, P.M., Himbeault, K.T., Belknap, A.M., Janz, D.M., 2006. Larval deformities associated with selenium accumulation in northern pike (Esox
lucius) exposed to metal mining effluent. Environ. Sci. Technol. 40, 6506–6512.
Nagler, J.J., Cavileer, T., Sullivan, J., Cyr, D.G., Rexroad, Iii, C., 2007. The complete
nuclear estrogen receptor family in the rainbow trout: discovery of the novel
ER␣2 and both ER isoforms. Gene 392, 164–173.
Nagler, J.J., Davis, T.L., Modi, N., Vijayan, M.M., Schultz, I., 2010. Intracellular, not
membrane, estrogen receptors control vitellogenin synthesis in the rainbow
trout. Gen. Comp. Endocrinol. 167, 326–330.
Nelson, E.R., Habibi, H.R., 2010. Functional significance of nuclear estrogen receptor
subtypes in the liver of goldfish. Endocrinology 151, 1668–1676.
Nelson, E.R., Wiehler, W.B., Cole, W.C., Habibi, H.R., 2007. Homologous regulation of
estrogen receptor subtypes in goldfish (Carassius auratus). Mol. Reprod. Dev. 74,
1105–1112.
Patiño, R., Sullivan, C.V., 2002. Ovarian follicle growth, maturation and ovulation: an
integrated perspective. Fish Physiol. Biochem. 26, 57–70.
Planas, J., Swanson, P., 1995. Maturation-associated changes in the response of the
salmon testis to the steroidogenic actions of gonadotropins (GTH I and GTH II)
in vitro. Biol. Reprod. 52, 697–704.
Richards, J.S., 1994. Hormonal control of gene expression in the ovary. Endocr. Rev.
15, 725–751.
Sabo-Attwood, T., Blum, J.L., Kroll, K.J., Patel, V., Birkholz, D., Szabo, N.J., Fisher, S.Z.,
McKenna, R., Campbell-Thompson, M., Denslow, N.D., 2005. Distinct expression and activity profiles of largemouth bass (Micropterus salmoides) estrogen
receptors in response to estradiol and nonylphenol. J. Mol. Endocrinol. 39,
223–237.
Sathiyaa, R., Vijayan, M.M., 2003. Autoregulation of glucocorticoid receptor by cortisol in rainbow trout. Am. J. Physiol. Cell Physiol. 284, 1508–1515.
Shah, Y.M., Kaul, A., Dong, Y., Ip, C., Rowan, B.G., 2005. Attenuation of estrogen receptor a (ERa) signaling by selenium in breast cancer cells via downregulation of
ER␣ gene expression. Breast Cancer Res. Treat. 92, 239–250.
Simon, P., 2003. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics 19, 1439–1440.
Swanson, P., Dickey, J.T., Campbell, B., 2003. Biochemistry and physiology of fish
gonadotropins. Fish Physiol. Biochem. 28, 53–59.
Thomas, F.H., Ethier, J.-F., Shimasaki, S., Vanderhyden, B.C., 2005. Follicle-stimulating
hormone regulates oocyte growth by modulation of expression of oocyte and
granulosa cell factors. Endocrinology 146, 941–949.
Thomas, J.K., Janz, D.M., 2011. Dietary selenomethionine exposure in adult zebrafish
alters swimming performance, energetics and the physiological stress response.
Aquat. Toxicol. 102, 79–86.
Tintos, A., Gesto, M., Alvarez, R., Miguez, J.M., Soengas, J.L., 2006. Interactive effects
of naphthalene treatment and the onset of vitellogenesis on energy metabolism
in liver and gonad, and plasma steroid hormones of rainbow trout Oncorhynchus
mykiss. Comp. Biochem. Physiol. C 144, 155–165.
Tyler, C.R., Pottinger, T.G., Coward, K., Prat, F., Beresford, N., Maddix, S., 1997.
Salmonid follicle-stimulating hormone (GtH I) mediates vitellogenic development of oocytes in the rainbow trout Oncorhynchus mykiss. Biol. Reprod. 57,
1238–1244.
Tyler, C.R., Sumpter, J.P., Witthames, P.R., 1990. The dynamics of oocyte growth during vitellogenesis in the rainbow trout (Oncorhynchus mykiss). Biol. Reprod. 43,
202–209.
Woock, S.E., Garrett, W.R., Partin, W.E., Bryan, W.T., 1987. Decreased survival
and teratogenesis during laboratory selenium exposures to bluegill Lepomis
macrochirus. Bull. Environ. Contam. Toxicol. 39, 998–1005.
Zohar, Y., Munoz-Cueto, J.A., Elizur, A., Kah, O., 2010. Neuroendocrinology of reproduction in teleost fish. Gen. Comp. Endocrinol. 165, 438–455.