Genomic identification of candidate inclusion membrane proteins in Chlamydial species
and microscopic analysis
by
Nathanael A. Blake
A PROJECT
Submitted to
Oregon State University
University Honors College
in partial fulfillment of the requirements for the degree of
Honors Bachelors of Science in Microbiology (Honors Scholar)
Presented June 7, 2006
Commencement June 18, 2006
AN ABSTRACT OF THE THESIS OF
Nathanael A. Blake for the degree of Honors Bachelor of Science in Microbiology
presented on June 7, 2006. Title: Genomic identification of candidate inclusion
membrane proteins in Chlamydial species and microscopic analysis
Abstract approved: _______________________________________
Dr. Dan Rockey
The Chlamydiaceae are a family of obligate intracellular bacteria with a unique
biphasic developmental cycle. The replicating, metabolically active, intracellular phase
bacteria (RBs) grow within a cellular vacuole know as the inclusion. Since the proteins
the Chlamydiaceae secrete into this membrane are the means of host/parasite interaction,
they have long been of interest. In 1995 IncA was the first to be identified as localized to
the inclusion membrane, and many other Inc proteins have subsequently been discovered.
It was shown that most Inc proteins have a unique bi-lobed hydrophobic domain
approximately 40-80 amino acids long. This thesis used the recently published sequences
of several Chlamydial species to identify potential Inc proteins and determine their
relationship with established families of Incs in other species. Antibodies to one potential
Inc were prepared, and florescent microscopy was used to confirm its localization to the
inclusion membrane. Finally, possible future research is discussed.
Keywords: Chlamydia, Inclusion membrane proteins, protein localization
Corresponding e-mail: aure.entuluva@gmail.com
©Copyright by Nathanael A. Blake
June 7, 2006
All Rights Reserved
Genomic identification of suspected inclusion membrane proteins in Chlamydial species
and microscopic analysis
by
Nathanael A. Blake
A PROJECT
Submitted to
Oregon State University
University Honors College
in partial fulfillment of
the requirements for the
degree of
Honors Bachelors of Science in Microbiology (Honors Scholar)
Presented June 7, 2006
Commencement June 18, 2006
Honors Bachelor of Science in Microbiology project of Nathanael A. Blake presented on
June 7, 2006
APPROVED:
Mentor, representing Biomedical Sciences
Committee member, representing Microbiology
Committee member, representing Microbiology
Dean, University Honors College
I understand that my project will become part of the permanent collection of Oregon
State University, University Honors College. My signature below authorizes release of
my project to any reader upon request.
Nathanael A. Blake, Author
ACKNOWLEDGEMENTS
Dr. Dan Rockey deserves the greatest of thanks for this project. He provided
instruction, funding, encouragement when experiments failed, the occasional kick in the
pants when I was behind, and was an excellent mentor. Kevin Ahern deserves credit for
his guidance of the HHMI program at OSU, under which some of the work on this
project was conducted. I would also like to thank Sara Weeks for her vast amount of help
in general and her work on the florescent microscopy of Cpn369 in particular. Damir
Alzhanov, Hency Chu, and Jae Dugan all provided assistance and advice with this
project. Everyone else who has passed through the Rockey lab during my time there has
provided encouragement and technical assistance. Also, John Bannantine deserves my
gratitude for his production of the Cpn369 antibodies.
TABLE OF CONTENTS
Page
INTRODUCTION………………………………………………………………………...1
The Chlamydiales…………………………………………………………………1
Chlamydia trachomatis……………………………………………………1
Chlamydophila pneumoniae………………………………………………4
Chlamydia muridarum and Chlamydophila caviae……………………….5
Morphology and Developmental Cycle…………………………………………...5
The Inclusion Membrane………………………………………………………….6
THESIS STATEMENT…………………………………………………………………...8
MATERIALS AND METHODS………………………………………………………….9
Hydrophilicity Plots……………………………………………………………….9
Blast and Sequence Alignment……………………………………………………9
Antibody Production and Fluorescent Microscopy……………………………….9
Cloning…………………………………………………………………….9
Inducement and Protein Product Harvest………………………………..10
Polyclonal Antibody Production…………………………………………10
Cell Growth and Infection……………………………………………….11
Fluorescent Microscopy………………………………………………….11
RESULTS………………………………………………………………………………..13
Predicted Inc Proteins and Gene Families……………………………………….13
C. pneumoniae 369 Localization………………………………………………...20
DISCUSSION AND CONCLUSIONS………………………………………………….22
TABLE OF CONTENTS (Continued)
Page
Summary…………………………………………………………………………22
Points of Interest and Possibilities for Future Research…………………………22
BIBLIOGRAPHY………………………………………………………………………..24
LIST OF FIGURES AND TABLES
Page
Figure 1. The hydrophilicity plot of GPIC138………………………………………….15
Figure 2. The hydrophilicity plot of GPIC318………………………………………….16
Figure 3. The hydrophilicity plot of Cm496……………………………………………17
Figure 4. An illustration of a Chlamydial gene family…………………………………18
Table 1. Known and candidate inc genes identified by hydrophilicity profile within
each sequenced chlamydial genome……………………………………………………..19
Figure 5. Localization of Cpn369 to the inclusion membrane……………………….....21
DEDICATION
This is dedicated to my parents, Alan and Zsuzsa, who have put up with everything
from my pillaging of their kitchen before returning to Corvallis to my status as a
notorious rabble-rouser on campus. You have supported me faithfully through the last
four years. Thank you.
Genomic identification of candidate inclusion membrane proteins in Chlamydial
species and microscopic analysis
INTRODUCTION
The Chlamydiales
The members of the order Chlamydiales are ubiquitous obligate intracellular
bacteria with hosts ranging from amoebas to humans (18). The order is rapidly
expanding as more species are examined for the presence of “Chlamydia-like organisms”
(27). As they have adapted to the intracellular environment, they have undergone genetic
reduction (39)
The species most commonly pathogenic to humans are Chlamydia trachomatis
and Chlamydophila pneumoniae. Both genera (Chlamydia and Chlamydophila) include
species that infect other vertebrates. Generally these species are host-specific, with the
exception of Chlamydophila psittaci, which is a potentially lethal zoonotic infection that
can be acquired from birds (18).
Other species of interest in this thesis are Chlamydia muridarum, which is found
in mice and is useful in research due to its close similarities to C. trachomatis, and
Chlamydophila caviae, which infects Guinea pigs and serves as a model for C.
trachomatis genital infection in humans (18, 29).
Chlamydia trachomatis
The most commonly known species of the Chlamydiae is C. trachomatis, whose
various strains are leading causes of blindness and vision loss, as well as of sexually
transmitted infections.
2
The ocular serovars of C. trachomatis (A, B, Ba, and C) are the world’s leading
cause of preventable blindness (48). They infect the epithelial cells of the eye, and a
majority of infections do not become chronic. However, the disease is endemic in the
third world, which accounts for its toll (20). The disease usually begins as one of
childhood, with persistent infection and reinfection instigating a damaging inflammatory
response from the body (3). The damage is caused not by the pathogen itself so much as
by the body’s reaction to it. The inflammatory response leads to tissue damage, which
with repeated or persistent infection, accumulates to the point of permanent damage. It
can lead to damage to the palpebral conjunctiva and turning the eyelashes inward (8, 14,
22). The disease spreads though the shedding of Chlamydia during active infection,
which particles are then transmitted person-to-person and by flies (17, 16, 4).
C. trachomatis is also the world’s most common sexually transmitted pathogen,
with an estimated 86 million new cases each year (21). As with the ocular strains,
infections are often asymptomatic (especially in females) (42). Though inevitable, as the
internal structure of the female anatomy makes infection less likely to be noticed, this is
unfortunate because the consequences of untreated infection are graver in females than
males.
Symptoms of an infection include urethritis (painful swelling or inflammation of
the urethra), an unusual discharge from the genital tract, and pelvic pain in females (43).
Theses symptoms are also typical of other STDs, so diagnosis requires laboratory testing.
Further increasing the problem is the fact that C. trachomatis often co-infects with other
STDs, as it shares the same risk factors.
3
In females, untreated infection of the fallopian tubes can cause pelvic
inflammatory disease, a painful and serious condition. Up to half a million cases occur
each year in the U.S. It often leads to infertility and ectopic pregnancy when untreated
(49). Pelvic inflammatory disease has also been linked to perihepatitis (7). Additionally,
infection with C. trachomatis has been associated with cervical cancer (2).
In males, untreated C. trachomatis infections may lead to infertility, though its
role in the etiology is debated (30).
As with the ocular strains, the damage from infection generally arises over time
due to persistent infections or reinfection. The Chlamydia have developed means by
which to resist the body’s attempts to eradicate them (13). The release of interferongamma in response to infection is one of the major responses to Chlamydia. Among the
effects is the degradation of tryptophan, which is an essential amino acid. Thus the
Chlamydia is literally starved into submission, as the RBs (reticulate bodies) cannot
differentiate into EBs (elementary bodies) without tryptophan. RBs respond to
tryptophan starvation by assuming aberrantly enlarged forms, apparently in an attempt to
outlast the body’s immune response (7, 10). In laboratory experiments, these have been
shown to persist for several years, replicating by cell to cell transmission (23).
One of the differences between serovars that determines tissue tropism is that
while the ocular strains no longer have a functional tryptophan synthase gene, the genital
strains do. Thus, the genital strains are able to resist tryptophan starvation by
manufacturing tryptophan from indole, a similar chemical (19).
The LGV (Lymphogranuloma venereum) biovar of C. trachomatis consists of
serovars L1, L2, and L3, which are responsible for a less common (especially in the
4
Western world) but very virulent form of Chlamydial STD (26). These serovars have a
tropism for lymphoid cells and are able to cause systemic infection. The tissue
destruction is progressive and potentially highly damaging (25).
C. trachomatis has also been associated with reactive arthritis, though the precise
mechanisms by which it induces disease are not yet fully elucidated (38).
Chlamydophila pneumoniae
As per the name, C. pneumoniae is a significant cause of community
acquired pneumonia worldwide. Most infections are asymptomatic, but it is still
responsible for 10% of all pneumonia cases. Over 50% of the population has been
infected at some point (28). It is generally thought that infection with C. pneumoniae can
instigate asthma attacks, but whether it plays any role in causing the disease remains
controversial (28).
In 1988, the then recently described C. pneumoniae was linked to heart disease in
the forms of myocardial infection and arthrosclerosis (38). This has proven a hot-topic
for research, because of the devastating effects of these conditions, but the extent to
which the pathogen is implicated in the causation or exacerbation of the disease remains
unclear.
This organism may also be a causative agent in several neurological diseases; it is
possible that C. pneumoniae is associated with strokes, but the evidence remains is not
yet definitive (9, 15). It has also been associated with multiple sclerosis, though whether
it is an etiological agent or merely an opportunistic infection isn’t known (45, 47, 50, 44).
There is also debate within the scientific community over the possible association of C.
pneumoniae with Alzheimer’s disease (34).
5
Thus, the tantalizing prospect of further elucidating the etiology of these
important diseases makes C. pneumoniae an important research subject.
Chlamydia muridarum and Chlamydophila caviae
C. muridarum was formerly classified as the mouse biovar of C. trachomatis, but
the recent taxological rearrangement of the Chlamydiaceae declared it a separate species.
It is of interest because it can establish infection in mice that mimics C. trachomatis
genital infection in humans (18).
C. caviae used to be considered a strain of C. psittaci, but has since been
reclassified as its own species (18). The pathogen infects Guinea pigs, causing
conjunctivitis and other syndromes, and has also been used to infect Guinea pig genital
tracts to model C. trachomatis infections in humans (24).
Morphology and Developmental Cycle
The Chlamydiaceae are small, obligate intracellular parasites with a unique
biphasic lifecycle. The infectious stage of the organism is the EB, which is a small (less
than 35 micrometers in diameter), dense, electron-rich, extracellular, spore-like structure
that exists only to survive in the extracellular environment and infect a host cell. The EB
is incapable of metabolizing or reproducing (36).
The RB (reticulate body) forms from the EB after uptake into the cell in a vacuole
that becomes the inclusion membrane. Its traits are the opposite of those of the EB. It is
much larger (100 micrometers in diameter), non-infectious, metabolically active, and it
replicates itself by binary fission (36).
6
RBs differentiate back into EBs, and the cell eventually lyses, releasing both EBs,
which go on to infect other cells, and those RBs that never differentiated, which simply
die. This cycle takes between 48 and 72 hours, depending on the species and strain.
The Inclusion Membrane
Within the host cell the Chlamydia grow and differentiate inside a vacuole
surrounded by the inclusion membrane. The inclusion membrane originates as the
phagosomal vacuole that takes up the EB from the cell surface. Fusion with lysosomes is
blocked and the vacuole migrates to the Golgi, where it pirates vesicles and recycles their
components for inclusion in the Chlamydial inclusion membrane (31).
The Chlamydia also produce proteins that are inserted into the inclusion
membrane that play a variety of roles. IncA was the first protein demonstrated to be
localized to the inclusion membrane (35). Subsequently many more inc genes were
discovered, and it was determined that almost all posses a unique bi-lobed hydrophobic
domain approximately 40-80 amino acids long. With the sequencing of chlamydial
genomes, identification of this motif within a predicted chlamydial protein allowed for it
to be identified as a probable Inc (5, 6).
As of yet, comparatively few Inc proteins have been characterized, but they
clearly play critical roles in the life of the bacterium. IncA has been shown to be
necessary for the fusion of multiple inclusions into one, and IncG (which is cotranscribed with other incs within two hours after infection) has been implicated in
interacting with host cell signaling pathways (46, 40, 41). Additionally, transfection with
C. caviae incA has been shown to block infection by C. caviae and reduce susceptibility
7
to infection with C. trachomatis; but transfection with C. trachomatis incA had no such
effects (1).
Incs are suspected to be key factors in everything from preventing lysosomal
fusion to facilitating the uptake of ATP from the host cell, and further research on them is
crucial to understanding the Chlamydiaceae.
8
THESIS STATEMENT
Inclusion membrane proteins play an important role in the survival and
development of Chlamydiae. These proteins can be identified by hydrophilicity plots of
the amino acid sequence of genes. Comparison of potential Inc genes to those of other
species using the NCBI BLAST program allows for the construction of probable gene
families. The localization of these genes to the inclusion membrane can be confirmed by
florescent microscopy using antibodies generated against the protein.
9
MATERIALS AND METHODS
Hydrophilicity Plots
The genomes of C. caviae and C. muridarum were accessed through the TIGR
website (32, 33, 11, 12). The amino acid sequences of all ORFs without an assigned
function were entered into MacVector (produced by Accelrys Software Inc). Using the
program a Kyte/Doolittle hydrophilicity analysis was then calculated and the results
plotted.
Blast and Sequence Alignment
For those ORFs whose predicted products possessed a bi-lobed hydrophobic
domain characteristic of Inc proteins, the DNA sequence was then entered into the NCBI
nucleotide-nucleotide BLAST, with the E value and sequence alignment used to
determine the possible relationship to other proteins. Additionally, the genes upstream
and downstream of the suspected Incs were entered into BLAST to further elucidate the
relationships.
Antibody Production and Fluorescent Microscopy
Cloning
C. pneumoniae 369 was identified as a member of a family of candidate Incs. An
approximately 500 bp section of the gene, coding for a hydrophilic region (cytosolic side)
of the predicted protein, was amplified using PCR (Primers ordered from SigmaGenosys. Forward primer sequence: ccgcgaattccccgaatcactccccgaa, reverse primer
sequence: gcgcctgcagttagaagtgtgctttgcctggg). Electrophoresis with a 1% agarose gel was
used to visualize the product, which was then excised and purified with a QIAGEN Gel
Extraction Kit. The purified samples was then digested using EcoR1 and Pst1, and the
10
DNA ligated into the PMAL C2 plasmid (New England Biolabs), which was then used to
transform XL1 E. coli cells. Following transformation, the cells were plated onto LB
Ampicillin plates and grown overnight at 37 degrees C. Colonies were then picked,
replated, and screened for the insert using PCR.
Inducement and Protein Product Harvest
E. coli cells positive for the Cpn369 insert were grown in 500 ml LB broth to an
OD600 of approximately 0.5 and then induced with 1.5 ml of 100 mM IPTG for 2 hours.
The cells were pelleted, resuspended in lysis buffer, and frozen at -20 overnight.
They were then thawed and sonicated on ice (4 x 30 sec. pulses with 1 minute
between pulses). The solution was spun down at 10k RPM and the supernatant removed.
One hundred ml cold column buffer + tween was then added to the supernatant, along
with 10 ml washed maltose resin to bind the recombinant protein. This was rocked for 2
hours in an ice bucket, the maltose resin/protein beads were then spun down and the
buffer pulled off. It was washed successively with 100 ml column buffer + tween and
100 ml column buffer. Twenty ml column buffer was added and the beads were loaded
into a column and washed with column buffer. The recombinant protein was then eluted
with column buffer plus 10 mM maltose.
The protein concentrations of the samples were assayed at OD280 and the
positives were pooled and dialyzed in cold 1 x PBS.
Polyclonal Antibody Production
BALB/c mice were immunized intraperitoneally with 50 mg of the purified
recombinant Inc protein. The antigen was emulsified in incomplete Freund’s adjuvant.
Three weeks later, mice were given a booster immunization of the same antigen-adjuvant
11
preparation. Humoral immune responses of each mouse were evaluated by preparative
immunoblot analysis using the stimulating antigen. A second boost was performed and
three weeks later, test bleeds were again evaluated. They were then bled and the antibody
pooled.
Cell Growth and Infection
McCoy cells were grown to a confluency of 40% on coverslips (Bellco Glass, Inc,
Vineland, NJ) in Minimal Essential Medium (MEM) supplemented with 10% fetal
bovine serum (Gibco) and 10ug/mL gentamicin at 37C, 5% CO2.
Elementary bodies were diluted in SPG (solution of 0.25M sucrose, 10mM
sodium phosphate, 5 mM L-glutamic acid) and added to the cells at an MOI of 0.5. The
infected cells were centrifuged at 500g or 2000 rpm at room temp for 1hr. (Note: before
adding EB inoculum the cells were washed once with Hanks Balanced Salt Solution
(HBSS) (Cellgro). After centrifugation the inoculum was removed and MEM with
1ug/mL of cyclohexamide was added to wells with coverslips. The infected cells were
allowed to incubate at 37C, 5% CO2 for 50 hpi and then fixed with methanol.
Fluorescent Microscopy
Coverslips were incubated with 1 mL of FA block (2% BSA in PBS) for 10
minutes. Primary mouse anti-369 antibody was diluted 1:100 in FA block, added to
coverslips and incubated for 1 hr at room temp. The coverslips were then washed 3 times
with 1XPBS. Secondary antibody anti-mouse IgG rhodamine (Southern Biotechnology
Associates, Inc) was diluted 1:1000 in FA block, added to the coverslips, and allowed to
incubate for 1 hr at room temp in the dark. Then the cells were washed 3 times with 1X
PBS and then 1XPBS was added a 4th time.
12
These coverslips were then mounted on DAPI + Vectashield (Vectashield, Vector
Laboratories), which stains DNA. Pictures were taken at 1000X magnification using a
Leica fluorescence microscope. Images were captured using a SPOT digital camera
imaging system (Diagnostic Instruments). Images were processed using Photoshop CS
version 8.0 (Adobe Software) in conjunction with SPOT software. The anti-Cpn369 was
red and the DAPI (4’,6’-diamino-2-phenylindole) was blue.
13
RESULTS
Predicted Inc Proteins and Gene Families
Hydrophilicity plots of the amino acid sequences of proteins from the C.
muridarum and C. caviae genomes were generated and examined for the bi-lobed
hydrophobic domain characteristic of Inc proteins. Figures 1, 2, and 3 provide examples
of this motif. Of the 1061 predicted proteins in C. caviae, 60 were determined to be
candidate Inc proteins; of the 921 in C. muridarum, 41 appear to be Incs.
The nucleotide sequences of these ORFs were then entered into nucleotidenucleotide NCBI BLAST searches to determine their relation to the proteins of other
Chlamydial species. Furthermore, the adjacent genes were examined to further determine
homology and gene families across species. Figure 4 gives an example of how genes
were conserved across species, while also showing how genetic rearrangement and gene
expansion (set against a backdrop of genetic reduction) have altered the gene order.
The results of the identification of probable Incs and their homologs are
summarized in Table 1. About 20 Inc proteins are conserved across all 4 species and
there are about 14 more conserved between C. pneumoniae and C. caviae (the count is
slightly complicated because Cpn and GPIC appear to have multiple copies of a few
genes). C. trachomatis and C. muridarum share an additional 19 that aren’t found in C.
caviae or C. pneumoniae.
Further considering the most closely related species, C. trachomatis has 3
candidate Incs that aren’t found in C. muridarum: Ct224 and Ct225, which are unique to
C. trachomatis; and Ct101, which has homologs in C. pneumoniae and C. caviae. C.
muridarum has two unique candidate Incs: Cm495 and Cm496.
14
In contrast, the Chlamydophila have much more genetic variation between their
constituent species than do the members of the Chlamydia. Counting duplicates within
each genome, C. pneumoniae has 31 unique candidate Incs and C. caviae has 20.
15
Figure 1. The hydrophilicity plot of GPIC138, a candidate Inc protein that is conserved
across Chlamydial species. This shows (approximately from amino acids 30-75) an
excellent example of the bilobed hydrophobic domain that is characteristic of Inc
proteins. GPIC138’s homologs are Ct484, Cm771, and Cpn602.
16
Figure 2. The hydrophilicity plot of GPIC318, a candidate Inc protein that is unique to
C. caviae. A nucleotide-nucleotide NCBI BLAST failed to turn up any significant
similarity to proteins in other Chlamydial species.
17
Figure 3. The hydrophilicity plot of a predicted Inc protein in C. muridarum. This gene
Cm496, is unique to the species, and one of only two (the other is Cm495) candidate Incs
that do not have a homolog in C. trachomatis.
18
Figure 4. An illustration of a Chlamydial gene family and probable genetic expansion in
C. pneumoniae CWL029, C. caviae GPIC, C. trachomatis, and C. muridarum. Cpn369
was demonstrated to be localized to the inclusion membrane. GPIC 425 is a homolog to
GPIC 426, and Cpn370 and Cpn 367 show homology to Cpn 369. Figure courtesy of
Dan Rockey.
19
Table 1. Known and candidate inc genes identified by hydrophilicity profile within
each sequenced chlamydial genome.
ORFs showing conservation between the species
ORFs unique to each species a
C. trach. C, mur.
C. pneumo.
C. caviae
C. trach./ C. mur. C. pneumo.
C. caviae
484
771
602
138
036/306
007
156
728
101
869
898
115/391
008
318
195
468
288
494
116/392
010
360
565
854
822
941
117/393
011
397
005
273
443
290
118/394
041
424
383
662
480
263
134/411
043
430
288
561
065
351
135/412
045
513
058
328
369/367/370
398/425/426
192/464
067
557
006
274
442
291
196/469
124
619
850
239
1008
753
214/486
126
620
101
312
470
223/ 130
622
232
503
291
491
224 / 131
633
147
424
150
616
225/ 132
702
618
908
753
1004
226/497
164
708
483
770
601
139
227/498
166
793
233
504
292
490
228/499
169
794
442
726
556
186
229/500
215
797
440
724
554
188
300/574
216
799
449
734
565
177
357/636
225
800
345
624
026
358/637
277
801
119
396
186/585
550
813/199
284
440
352
357
439
353
365
432
360
366
431
361
371
352/355
434/530/634/636/639
372
385
497
375
266/267
514
585
240
538
830
174
576
1054
829
583
1055
147
619
146
621
352
639
524
221
a. C. trachomatis and C. muridarum genes are listed together in this column, as the genomes are very
similar at these loci. Two C. muridarum orfs- 495 and 496- encode candidate Incs that are unique to this
species.
20
C. pneumoniae 369 Localization
Cpn369, a member of a gene family present in all four chlamydial species
discussed here, was selected to be tested for localization to the inclusion membrane. A
portion of the gene was inserted into the PMAl-C2 and production of the recombinant
protein was induced. After purification, this protein was used to produce polyclonal
antibodies in mice, which were then used in fluorescent microscopy to examine the
localization of Cpn369. Three pictures (figure 5) are included that demonstrate that the
protein is found on the surface of the inclusion.
21
Figure 5. Localization of Cpn369 to the inclusion membrane. McCoy cells were infected
with C. pneumoniae TWAR and methanol fixed at 50 hours post infection. They were
stained with anti-Cpn369 (as well as a red fluorescent secondary antibody, anti-mouse
IgG rhodamine), and DAPI, which binds to DNA and fluoresces blue. Cpn369 can be
seen on the outside but not the interior of several inclusions, identified with yellow
arrows.
22
DISCUSSION AND CONCLUSIONS
Summary
The genomes of C. caviae and of C. muridarum were screened for potential
inclusion membrane proteins by running a hydrophilicity plot on their amino acid
sequence. Suspected Inc proteins were then entered into an NCBI nucleotide-nucleotide
BLAST search to examine similarity to known Chlamydial proteins. The protein families
found aligned with the current taxonomical classifications of the Chlamydiace.
A partial sequence of one member of a family of Inc genes conserved across
species, Cpn369, was inserted into E. coli and the recombinant protein then purified.
This was used to make polyclonal antibodies in mice, which were then used in
fluorescent microscopy. The results of that procedure confirmed that Cpn369 was
localized to the inclusion membrane.
Points of Interest and Possibilities for Future Research
Although the genomes of C. trachomatis and C. muridarum are very similar, they
have different species tropisms. Given the role of some other Inc proteins in
pathogenesis, it might be fruitful to examine those which C. trachomatis has and C.
muridarum lacks, in order to see if they play a role in the virulence of the one over the
other..
Looking more generally at the Chlamydiales, there is interest in the interactions of
Inc proteins with host cell proteins and other Chlamydial proteins. Proposed methods for
elucidating these interactions include two-hybrid systems and transfection/infection. The
first will allow for far greater precision, but as has been shown with incA, valuable data
can be gleaned from transfection/infection experiments as well.
23
Additionally, understanding the homology between the genes of these Chlamydial
species is important because it may allow for the use of the safe species in some
experiments, rather than their human-infecting relatives.
24
BIBLIOGRAPHY
1. Alzhanov, D., Barnes, J., Hruby, D.E., Rockey, D.D. 2004. Chlamydial
development is blocked in host cells transfected with Chlamydophila caviae incA. BMC
Microbiology 2004, 4:24.
2. Anttila, T., Saikku, P., Koskela, P., Bloigu, A., Dillner, J., Ikaheimo, I. et al.,
(2001). Serotypes of Chlamydia trachomatis and risk for development of cervical
squamous cell carcinoma. Journal of the American Medical Association 285, 47-51.
3. Bailey, R., Duong, T., Carpenter, R., Whittle, H. & Mabey, D. (1999). The
duration of human ocular Chlamydia trachomatis infection is age dependent.
Epidemiology and Infection 123, 479 - 486.
4. Bailey, R., Osmond, C., Mabey, D. C. W., Whittle, H. C. & Ward, M. E. (1989).
Analysis of the household distribution of trachoma in a Gambian village using a Monte
Carlo simulation procedure. International Journal of Epidemiology 18, 944-955.
5. Bannantine, J. P., D. D. Rockey, and T. Hackstadt. 1998. Tandem genes of
Chlamydia psittaci that encode proteins localized to the inclusion membrane. Molecular
Microbiology. 28: 1017-1026
6. Bannantine, J. P., R. S. Griffiths, W. Viratyosin, W. J. Brown, and D. D. Rockey.
2000. A secondary structure motif predictive of protein localization to the chlamydial
inclusion membrane. Cellular Microbiology 2: 35-48
7. Beatty, W., Byrne, G., Morrison, R., Morphological and antigenic characterizations
of interferon gamma mediated persistent Chlamydia trachomatis infection in vitro. Proc.
Natl. Acad. Sci. USA, Vol 90, May 1993: 3998-4002
8. Bobo, L. D., Novak, N., Munoz, B., Hsieh, Y. H., Quinn, T. C. & West S. (1997).
Severe disease in children with trachoma is associated with persistent Chlamydia
trachomatis infection. Journal of Infectious Diseases 176, 1524-1530.
9. Bucurescu, G. & Stiertiz, D. D. (2003). Evidence of an association between
Chlamydia pneumoniae and cerebrovascular accidents. European Journal of Neurology
10, 449 - 452.
10. Byrne, G., Lehmann, L., Landry, G. Induction of tryptophan catabolism is the
mechanism for gamma-interferon-mediated inhibition of intracellular Chlamydia psittaci
replication in T24 cells. Infection and Immunity, Aug. 1986: 347-351
11. Chlamydophila caviae GPIC Genome Page
http://cmr.tigr.org/tigr-scripts/CMR/GenomePage.cgi?org_search=&org=gcp. Last
accessed June 1, 2006.
25
12. Chlamydia muridarum strain Nigg Genome Page.
http://cmr.tigr.org/tigr-scripts/CMR/GenomePage.cgi?org_search=&org=btc. Last
accessed June 1, 2006.
13. Dean, D., Suchland, R. J., and Stamm, W. E. (1998). Apparent long-term
persistence of Chlamydia trachomatis cervical infections - analysis by omp1 genotyping,
pp 31-34. In R. S. Stephens et al; (editors.) Chlamydial Infections. Proceedings of the
ninth international symposium on human chlamydial infection. International Chlamydia
Symposium, San Francisco, CA 94110, USA. ISBN 0-9664383-0-2
14. el-Asrar A. M., Geboes, K., Tabbara, K. F., al-Kharashi, S. A, Missotten, L. &
Desmet, V. (1998). Immunopathogenesis of conjunctival scarring in trachoma. Eye. 12,
453 - 460.
15. Elkind MS, Cole JW. Do common infections cause stroke? Semin Neurol. 2006
Feb;26(1):88-99.
16. Emerson P.M., Bailey R.L., Mahdi O.S., Walraven G.E., Lindsay S.W. (2000)
Transmission ecology of the fly Musca sorbens, a putative vector of trachoma.
Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 28 - 32.
17. Emerson, P. M., Lindsay, S. W., Walraven, G. E., Faal, H., Bogh, C., Lowe, K.,
Bailey, R. L. (1999). Effect of fly control on trachoma and diarrhoea. Lancet 353, 1401 1403.
18. Everett, K. D. E., Bush, R. M. & Andersen, A. A. (1999). Emended description of
the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam.
nov., each containing one monotypic genus, revised taxonomy of the family
Chlamydiaceae, including a new genus and five new species, and standards for the
identification of organisms. International Journal of Systematic and Evolutionary
Microbiology 49, 415 - 440.
19. Fehlner-Gardiner, C., Roshick, C., Carlson, J., Hughes, S., Belland, R.,
Caldwell, H., McClarty, G., Molecular basis defining human Chlamydia trachomatis
tissue tropism. The Journal of Biological Chemistry, Vol 277, No 30: 26893-26903
20. Frick, K., Basilion, E., Hanson, C. & Colchero, A. (2003). Estimating the burden
and economic impact of trachomatous visual loss. Ophthalmic Epidemiology 10, 121 132.
21. Gerbase, A. C., Rowley, J. T., Heymann, D. H., Berkley, S. F. & Piot P. (1998).
Global prevalence and incidence estimates of selected curable STDs. Sexually
Transmitted Infections 74, Suppl 1: S12 - 16.
26
22. Guzey, M., Ozardali, I., Basar, E., Aslan, G., Satici, A. & Karadede S. (2000). A
survey of trachoma: the histopathology and the mechanism of progressive cicatrization of
eyelid tissues. Ophthalmologica 214, 277 - 284.
23. Kutlin, A., Roblin, P. M., and Hammerschlag, M. R. (1998). Continuous
Chlamydia pneumoniae infection in vitro, pp 325-327. In R.S. Stephens et al., (eds)
Chlamydial Infections. Proceedings of the ninth international symposium on human
chlamydial infection. International Chlamydia Symposium, San Francisco, CA 94110,
USA. ISBN 0-9664383-0-2
24. Lutz-Wohlgroth, L. et. al. Chlamydiales in Guinea-pigs and Their Zoonotic
Potential Journal of Veterinary Medicine Series A. Volume 53 Page 185 - May 2006
25. Lynch, C. M., Felder, T. L., Schwandt, R. A. & Shashy, R. G. (1999).
Lymphogranuloma venereum presenting as a rectovaginal fistula. Infectious Diseases in
Obstetrics & Gynecology 7, 199 - 201.
26. Mabey D, Peeling RW. Lymphogranuloma venereum. Sex Transm Infect
2002;78:90–2.
27. Meijer, A. & Ossewarde, J. M. (2002). Description of a wider diversity within the
order Chlamydiales than currently classified. In: Stephens R. S. et al., (eds). Human
Chlamydial Infections. Proceedings of the Tenth International Conference on Human
Chlamydial infections. Publisher: International Chlamydia Symposium, San Francisco
USA, ISBN 0-9664383-1-0
28. Miyashita, N., Niki, Y., Nakajima, M., Fukano, H., Matsushima T. (2001).
Prevalence of asymptomatic infection with Chlamydia pneumoniae in subjectively
healthy adults. Chest 119, 416 - 419.
29. Mount, D.T., Bigazzi, P.E. and Barron, A.L., 1973. Experimental genital infection
of male guinea pigs with the agent of guinea pig inclusion conjunctivitis and transmission
to females. Infect. Immun. 8: 925-930.
30. Ness, R. B., Markovic, N., Carlson, C. L. & Coughlin, M. T. (1997). Do men
become infertile after having sexually transmitted urethritis? An epidemiologic
examination. Fertility and Sterility 68, 205 - 213.
31. Norkin, L. C., Wolfrom, S. A. & Stuart, E. S. (2001). Association of caveolin with
Chlamydia trachomatis inclusions at early and late stages of infection. Experimental Cell
Research 266, 229 - 238.
32. Read, T. D. et. al. Genome sequence of Chlamydophila caviae (Chlamydia psittaci
GPIC): examining the role of niche-specific genes in the evolution of the Chlamydiaceae.
Nucleic Acids Res. 2003 April 15; 31(8): 2134–2147.
27
33. Read, T. D. et. al. Genome sequences of Chlamydia trachomatis MoPn and
Chlamydia pneumoniae AR39. Nucleic Acids Res. 2003 Apr 15;31(8):2134-47.
34. Robinson, S. R., Dobson, C. & Lyons, J. (2004). Challenges and directions for the
pathogen hypothesis of Alzheimer's disease. Neurobiology of Aging 25, 629 - 637.
35. Rockey, D. D., Heinzen R. A., and Hackstadt T. 1995. Cloning and
characterization of a Chlamydia psittaci gene coding for a protein localized to the
inclusion membrane of infected cells. Molecular Microbiology 15: 617-626.
36. Rockey, D. D., A. Matsumoto. 2000. The Chlamydial Developmental Cycle.
Pages 403-425 in Prokaryotic Development. Edited by Y. V. Brun and L. J. Shimkets.
ASM Press, Washington D.C.
37. Rodel, J., Vogelsang, H., Prager, K., Hartmann, M., Schmidt, K. H. & Straube,
E. (2002). Role of interferon-stimulated gene factor 3gamma and beta interferon in HLA
class I enhancement in synovial fibroblasts upon infection with Chlamydia trachomatis.
Infection and Immunity 70, 6140 - 6146.
38. Saikku, P., Mattila, K., Nieminen, M. S., Huttunen, J. K., Leinonen, M., Ekman,
M. R. et al. (1988). Serological evidence of an association of a novel Chlamydia, TWAR,
with chronic coronary heart disease and acute myocardial infarction. Lancet 1988 vol 2,
983 - 986.
39. Sakharkar, K.R., Dhar, P.K., and Chow, V.T.K. (2004). Genome reduction in
prokaryotic obligatory intracellular parasites of humans: a comparative analysis. Int J
Syst Evol Microbiol 54 (2004), 1937-1941.
40. Scidmore-Carlson, M. A., Shaw, E. I., Dooley, C. A. et al., (1999). Identification
and characterization of a Chlamydia trachomatis early operon encoding four novel
inclusion membrane proteins. Molecular Microbiology 33, 753 - 765.
41. Scidmore, M. A. (2002). 14-3-3 interactions are altered in C. trachomatis infected
cells. pp 61 - 64 In: Proceedings of the 10th international symposium on human
chlamydial infections. International Chlamydia Symposium San Francisco ISBN 09664383-1-0
42. Sellors J, Howard M, Pickard L, Jang D, Mahony J, Chernesky M. (1998).
Chlamydial cervicitis: testing the practice guidelines for presumptive diagnosis.
Canadian Medical Association Journal 158, 41 - 46.
43. Skerk, V., Schonwald, S., Strapac, Z., Beus, A., Francetic, I., Krhen, I., Lesko,
V. & Vukovic, J. (2001). Duration of clinical symptoms in female patients with acute
urethral syndrome caused by Chlamydia trachomatis treated with azithromycin or
doxycycline. Journal of Chemotherapy 13, 176 - 181.
28
44. Sriram S, Ljunggren-Rose A, Yao SY, Whetsell WO Jr. Detection of chlamydial
bodies and antigens in the central nervous system of patients with multiple sclerosis. J
Infect Dis. 2005 Oct 1;192(7):1219-28.
45. Sriram, S., Stratton, C. W., Yao, S., Tharp, A., Ding, L., Bannan, J. D. et al.
(1999). Chlamydia pneumoniae infection of the central nervous system in multiple
sclerosis. Annals of Neurology 46, 6 - 14.
46. Suchland, R. J., J. P. Bannantine, D. D. Rockey and W. E. Stamm. 2000.
Isolates of Chlamydia trachomatis that occupy nonfusogenic inclusions lack IncA, a
protein localized to the inclusion membrane. Infection and Immunity. 68: 360-367
47. Swanborg, R. H., Whittum-Hudson, J. A. & Hudson, AP. (2003). Infectious
agents and multiple sclerosis--are Chlamydia pneumoniae and human herpes virus 6
involved? Journal of Neuroimmunology 136, 1 - 8.
48. Thylefors, B., Negrel, A. D., Pararajasegaram, R. & Dadzie, K. Y. (1995). Global
data on blindness. Bulletin of the World Health Organisation 73, 115 - 121.
49. Westrom, L. V. (1996). Chlamydia and its effect on reproduction. Human
Reproduction 11, 23 - 30.
50. Yao, S. Y., Stratton, C. W., Mitchell, W. M. & Sriram, S. (2001). CSF oligoclonal
bands in MS include antibodies against Chlamydophila antigens. Neurology 56, 1168 1176