Estrogen expands breast cancer stem-like cells through paracrine FGF/Tbx3 signaling The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Fillmore, C. M., P. B. Gupta, J. A. Rudnick, S. Caballero, P. J. Keller, E. S. Lander, and C. Kuperwasser. “Estrogen expands breast cancer stem-like cells through paracrine FGF/Tbx3 signaling.” Proceedings of the National Academy of Sciences 107, no. 50 (December 14, 2010): 21737-21742. As Published http://dx.doi.org/10.1073/pnas.1007863107 Publisher National Academy of Sciences (U.S.) Version Final published version Accessed Wed May 25 19:02:29 EDT 2016 Citable Link http://hdl.handle.net/1721.1/84629 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Detailed Terms Estrogen expands breast cancer stem-like cells through paracrine FGF/Tbx3 signaling Christine M. Fillmorea,b, Piyush B. Guptac,1, Jenny A. Rudnickb,d, Silvia Caballerob,d, Patricia J. Keller b,d, Eric S. Landerc,e, and Charlotte Kuperwassera,b,d,2 a Genetics Program, Sackler School of Graduate Biomedical Sciences, Tufts University School of Medicine, Boston, MA 02111; bMolecular Oncology Research Institute, Tufts Medical Center, Boston, MA 02111; cBroad Institute of MIT/Harvard and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142; dDepartment of Anatomy and Cellular Biology, Sackler School of Graduate Biomedical Sciences, Tufts University School of Medicine, Boston, MA 02111; and eDepartment of Systems Biology, Harvard Medical School, Boston, MA 02115 Edited by Geoffrey M. Wahl, Salk Institute for Biological Studies, La Jolla, CA, and accepted by the Editorial Board October 26, 2010 (received for review June 17, 2010) M ore than 70% of breast cancers express high levels of the estrogen receptor (ERα), and many of these tumors require estrogen for sustained growth and progression. In recent years, multiple reports have shown that subpopulations of socalled cancer stem cells (CSCs; also called stem-like cells or tumor-initiating cells) are also required for sustained tumor growth and progression, and may be responsible for cancer recurrence and metastasis (1). Whether such CSCs in ERα+ breast cancers are sensitive to estrogen is currently unknown. Breast CSCs, which are operationally defined based on the number of self-renewing cells required to initiate a tumor and drive long-term tumor growth when transplanted into mice, can be isolated from primary tumor tissue or cultured cells lines (2–7). In human breast cancers, CSCs appear to be enriched within cell subpopulations with a CD44+/CD24−/low/ESA+ surface marker profile, are better able to form colonies, or “tumorspheres,” under low-adherence conditions, and display increased resistance to chemotherapeutic compounds (2–7). The molecular mechanisms that regulate breast CSC frequency, localization, and maintenance remain poorly understood. However, a fair amount is known about the spatio-temporal signaling dynamics that govern the specification and maintenance of normal mammary gland stem cells. Embryonic development of the mouse mammary gland begins when Wnt and FGF signaling proteins, which are secreted by the underlying mesenchyme, induce placode formation and localize mammary epithelial fate specification (8). FGF ligands, acting through cognate receptors, activate the Tbx3 transcription factor in both the mesenchymal and mammary placodes. Tbx3, in a positive-feedback loop, activates additional FGF secretion and also Wnt signaling (9–12). During puberty, estrogen is responsible for maturation of the mammary gland by mediating ductal elongation (9–13). Interestingly, there is significant evidence to suggest that estrogen signaling does not act directly on adult mammary epithelial stem www.pnas.org/cgi/doi/10.1073/pnas.1007863107 cells but, rather, activates their proliferation through paracrine signaling (14, 15). These data imply a two-component mammary stem cell niche in which estrogen signaling in the ERα+ nonstem cell compartment stimulates the proliferation of cells within the ERα− stem cell compartment. In breast cancer, it is unclear whether stem-like cells are also regulated by specific hormone-growth factor paracrine signaling pathways. In this study, we discovered that estrogen regulates breast CSC numbers through the FGF/Tbx3 signaling pathway, which happens also to regulate normal embryonic breast stem cells. Results Estrogen Stimulation Induces Expansion of Breast Cancer Stem-Like Cell Subpopulations. To study the signaling pathways that regulate breast CSC expansion and maintenance, we needed an experimental system that allowed for consistent modulation of breast CSC numbers through defined signaling perturbations. Tumor initiation by the MCF7 cell line appears to rely on estrogen signaling; these cells are very poor at forming tumors in ovariectomzed mice (16). However, we and others have found that MCF7 cells can proliferate in vitro in the absence of estrogen (E2) if serum (even charcoal-stripped serum) is supplemented in high enough concentrations (Fig S1A). MCF7 cells grown under these conditions maintain a low percentage of CSCs as gauged by flow cytometry (Fig. S1B) and are likewise poor at forming tumors in ovariectomized mice. Yet, intact ovaries or estrogen supplementation allows even an estrogen-deprived MCF7 line to form tumors, suggesting that estrogen induces the survival or expansion of MCF7 CSCs. To determine whether estrogen could indeed induce CSC expansion, we treated MCF7 cells as well as other estrogen receptorpositive (ER+) cell lines (T47D, HCC1428) with 1 nM 17-βestradiol or ethanol (vehicle control) for 6 d, and evaluated the proportion of stem-like cells by flow cytometry and sphere formation assays. We found that after estrogen stimulation, the proportion of CD44+/CD24−/ESA+ stem-like cells was nearly eightfold higher in ERα+ cultures, whereas no significant change in the proportion of CD44+/CD24−/ESA+ cells was observed when the same culture conditions were imposed on cells that lacked ER expression (Fig. 1A and Fig. S1C). When we challenged Author contributions: C.M.F., P.B.G., J.A.R., and C.K. designed research; C.M.F., P.B.G., J.A.R., S.C., and P.J.K. performed research; C.M.F., P.B.G., and E.S.L. contributed new reagents/analytic tools; C.M.F., P.B.G., J.A.R., S.C., and C.K. analyzed data; and C.M.F., P.B.G., P.J.K., and C.K. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. G.M.W. is a guest editor invited by the Editorial Board. 1 Present address: Whitehead Institute for Biomedical Research, Cambridge, MA 02142; and Department of Biology, Massachusetts Institute of Technology, Cambridge MA 02139. 2 To whom correspondence should be addressed. E-mail: charlotte.kuperwasser@tufts.edu. This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1007863107/-/DCSupplemental. PNAS | December 14, 2010 | vol. 107 | no. 50 | 21737–21742 MEDICAL SCIENCES Many tumors contain heterogeneous populations of cells, only some of which exhibit increased tumorigenicity and resistance to anticancer therapies. Evidence suggests that these aggressive cancer cells, often termed “cancer stem cells” or “cancer stem-like cells” (CSCs), rely upon developmental signaling pathways that are important for survival and expansion of normal stem cells. Here we report that, in analogy to embryonic mammary epithelial biology, estrogen signaling expands the pool of functional breast CSCs through a paracrine FGF/FGFR/Tbx3 signaling pathway. Estrogen or FGF9 pretreatment induced CSC properties of breast cancer cell lines and freshly isolated breast cancer cells, whereas cotreatment of cells with tamoxifen or a small molecule inhibitor of FGFR signaling was sufficient to prevent the estrogen-induced expansion of CSCs. Furthermore, reduction of FGFR or Tbx3 gene expression was able to abrogate tumorsphere formation, whereas ectopic Tbx3 expression increased tumor seeding potential by 100fold. These findings demonstrate that breast CSCs are stimulated by estrogen through a signaling pathway that similarly controls normal mammary epithelial stem cell biology. these MCF7 cultures to form tumorspheres, we found that the estrogen pretreated cultures formed sevenfold more tumorspheres than the ethanol-pretreated cultures (Fig. 1B). Moreover, we observed that the addition of the potent estrogen antagonist, 4hydroxy tamoxifen (4OHT), could prevent the 17-β-estradiol induced expansion of CD44+/CD24−/ESA+ cells and sphere formation, indicating that these changes in marker expression and sphere formation were mediated through ER signaling. We next evaluated the ability of estrogen-pretreated MCF7 cultures to form tumors by injecting cells pretreated with estrogen in vitro for 6 d into the mammary glands of ovariectomized NOD/ SCID mice in dilution series. Estrogen-pretreated cells were able to form tumors in mice 100-fold more efficiently when compared with the vehicle (EtOH+DMSO) treated cells (P = 0.001, Fig. 1C). Histological examination of tissue sections revealed that MCF7 cells pretreated in vitro with estrogen formed invasive ductal carcinomas (Fig. 1D). We also examined the injection sites of MCF7 cells pretreated with ethanol that had not formed tumors and observed viable cells within the mammary glands that formed only benign epithelial structures, suggesting that lack of tumor growth was not due to immune clearance of cells or increased cell death. These results indicate that estrogen-induced expansion of cancer stem-like cells in vitro leads to a functional increase in breast CSCs and tumorigenic phenotypes in vivo. Estrogen Expands Breast CSCs via Paracrine-Acting Protein Factors. No. cells injected 1.25 EtOH + DMSO 1 nM E2 1 nM E2 + 10 M PD173074 0.75 1x106 1/4 3/4 2/4 0.25 0 1x105 1x104 1/10 2/10 5/10 * 6/10 * 3/10 1/10 EtOH 16 14 12 10 8 6 4 * 1nM E2 1nM E2 +100nM 4OHT P < 0.0001 * P = 0.001 D In vitro pre-treatment 17- -estradiol 1x106 EtOH 2 0 EtOH 100nM 4OHT untreated 1nM E2 1nM E2 +100nM 4OHT 1nM E2 pre-treated - Cells injected Spheres per 1000 cells In vitro pre - treatment 1.75 untreated B C P < 0.0001 * 2.25 1x105 A MCF7 % CD44+/CD24-/ESA+ Because ER activity appeared necessary for the expansion of breast CSCs in response to estrogen, we next examined the levels of ERα expression in the CD44+/CD24−/ESA+ stem-like MCF7 subpopulation. Using both immunofluorescence on freshly sorted cytospun cells and four-color flow cytometry, we found that ≥70% of the cells in the bulk fraction (CD44+/CD24+/ESA+) were strongly ERα+, whereas only 20–25% of the CD44+/ CD24−/ESA+ stem-like cells had detectable nuclear ERα staining (Fig. 2 A and B and Fig. S2A). We also observed that ERα+ cells in the CD44+/CD24−/ESA+ population had much lower 100µm 100µm 100µm Fig. 1. Estrogen increases cancer stem cells in ERα+ cell lines. (A) Average percentage of CD44+/CD24−/ESA+ cells in the ERα+ cell line MCF7 following 6d treatment with either 1 nM 17-β-estradiol (E2) or vehicle (EtOH); n = 5 biological replicates. Data are mean ± SEM. (B) MCF7 tumorsphere formation presented as the average number of spheres per 1,000 cells plated ± SEM; n = 3 biological replicates. Representative phase contrast micrographs of MCF7 spheres are shown. (C) Tumor formation of MCF7 cells pretreated with EtOH and DMSO (vehicles), E2, or E2 and PD173074 injected in limiting dilution into ovariectomized mice. *Nonparametric χ2 statistic was used to test the expected vs. observed frequencies of tumor formation at limiting dilution with a level of 0.001 (critical value, 10.83). (D) Representative H&E-stained sections of mammary glands injected with EtOH-pretreated or 1 nM estrogen (E2)pretreated MCF7 cells are shown. 21738 | www.pnas.org/cgi/doi/10.1073/pnas.1007863107 levels of staining than ERα+ cells from the bulk fraction (Fig. 2B, histogram). Given these results, we hypothesized that in analogy to the normal mammary gland, paracrine factors released by the ERα+ cells in response to estrogen stimulation might induce the expansion of CD44+/CD24−/ESA+ stem-like cells. To evaluate this hypothesis, we harvested conditioned media from MCF7 cells that were pretreated with either vehicle (EtOH) or 1 nM 17β-estradiol. We observed that MCF7 cultures fed estrogenconditioned media for 6 d contained 20-fold more CD44+/ CD24−/ESA+ cells than matched cultures fed vehicle conditioned media (Fig. S2B, P < 0.002). In addition, expansion of this subpopulation was significantly attenuated if the conditioned medium was boiled before treatment of recipient lines (P < 0.05), indicating that the factors promoting stem-like cell expansion were heat labile and thus likely to be secreted proteins. We tested whether conditioned media from estrogen-treated MCF7 cells could increase CSC numbers in three ERα− breast cancer lines, SUM149, SUM159, and BT-20. We observed that exposure to conditioned media from estrogen-treated MCF7 cells induced a statistically significant expansion of the CD44+/CD24−/ ESA+ stem-like cells in all three cell lines, yielding cultures that were more efficient at forming tumorspheres (Fig. 2 C and D). In sum, these data suggest that estrogen acts to induce secretion of paracrine acting proteins, which in turn increase percentages of CD44+/CD24−/ESA+ populations and corresponding cancer stem-like cell properties in many breast cancer cell lines. Estrogen Induces FGF9/FGFR3 Signaling to Increase Cancer Stem-Like Numbers. To identify the secreted proteins mediating breast cancer stem-like cell expansion following estrogen treatment, we examined the conditioned media from either 17-β-estradiol– treated or vehicle-treated MCF7 cells and quantitatively assayed for 164 secreted growth factors and cytokines using an antibodybased protein array. In addition to known estrogen-induced factors, we observed that the secretion of every assayed FGF family member (FGF2/bFGF, FGF4, FGF6, FGF7, and FGF9) was increased at least twofold upon estrogen treatment compared with ethanol-treated controls (Fig. S2C). Notably, FGF9, which is induced by estrogen in endometriosis and during embryonic mammary placode formation (17), was increased 14-fold following estrogen treatment of MCF7 cells. We next tested whether FGF signaling was necessary for the estrogen-induced expansion of the breast CSC-enriched subpopulation. Accordingly, we treated MCF7 cells with a chemical inhibitor of FGFR signaling, PD173074, together with either estrogen or conditioned medium from estrogen-pretreated cells. By flow cytometry, we observed that inhibition of FGF signaling prevented either estrogen or conditioned medium from estrogenpretreated cells to elicit an increase in CD44+/CD24−/ESA+ cells (Fig. 3A). In contrast, the addition of recombinant FGF9 to serumfree cultures was sufficient to increase the CD44+/CD24−/ESA+ subpopulation (Fig. S2D) and to promote tumorsphere formation to levels comparable to those in estrogen-treated sphere cultures (Fig. 3B). FGF9 and estrogen appeared to have a synergistic effect on increasing MCF7 CSCs (Fig. 3A). When we tested two other ligands from the FGF family, FGF2 and FGF10, we saw that although these factors did not increase the basal levels of CD44+/ CD24−/ESA+ cells in the cell line, they were able to slightly increase the effect of estrogen (Fig. S2E). In contrast, feeding candidate growth factors, including EGF, HRG, IGFII, BMP6, and SDF1β, failed to increase the proportion of CSCs in the presence or absence of estrogen supplementation (Fig. S2E). There are four FGF receptors, and MCF7 cells express high levels of FGFR3 (Fig. S3A), which binds with high affinity to FGF9 (17). To rule out a nonspecific effect of the PD173074 compound, we examined whether the knockdown of FGFR3 in MCF7 cells might also abolish estrogen-induced expansion of the breast cancer stem-like cell populations. Accordingly, we inhibited FGFR3 expression using lentiviral infection with targeted shRNAs. We observed a 76% reduction in FGFR3 protein Fillmore et al. B CD44+/CD24 -/ESA+ ER ESA CD44 Negative Bulk Stem 10µm Bulk Stem Shpere formation % CD44+/CD24-/ESA+ 700 EtOH Conditioned Medium ER D * MCF7 BT-20 SUM149 SUM159 None CD24 E2 SUM159 Shpere formation C 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 Gated on ESA+ ER ESA 600 500 400 300 200 100 0 None EtOH E2 Conditioned Medium expression in MCF7 cultures transduced with shFGFR3 (Fig. S3B). Similar to treatment with PD173074, inhibition of FGFR3 expression in MCF7 cells led to a fourfold reduction in the proportion of CD44+/CD24−/ESA+ cells and a twofold reduction in sphere formation in response to estrogen treatment (Fig. S3C and Fig. 3C) without reducing estrogen-induced proliferation in adherent cultures (Fig. S3D). To functionally assess whether inhibition of FGF signaling in the presence of estrogen affected tumor formation, MCF7 cells were pretreated for 6 d in vitro with estrogen in the presence of PD173074 and injected into mice. Tumor-initiating potential conferred by 17-β-estradiol pretreatment alone was abolished in the presence of FGFR-inhibition (Fig. 1C, P = 0.001). These data indicate that estrogen expands breast cancer stem cell numbers at least in part through the FGF/FGFR signaling pathway. To determine whether the FGF signaling pathway also regulates stem-like cell populations in ERα− breast cancer cell lines, we added either recombinant FGF9 or PD173074 to SUM149, SUM159, and BT-20 cultures. Treatment with FGF9 induced an average 2.5-fold expansion of the stem-like cells and enhanced tumorsphere formation, whereas inhibition of FGFR signaling with PD173074 decreased the proportion of CD44+/CD24−/ ESA+ stem-like cells by eightfold and reduced sphere formation (Fig. 3D and Fig. S3E). In addition, SUM159 cells pretreated in vitro with PD173074 or FGF9 were injected orthotopically into immunocompromised mice to evaluate tumor initiation. Indeed, PD173074 pretreatment significantly inhibited SUM159-derived tumor growth in vivo (P < 0.02, Fig. 3E). We also isolated patient-derived breast carcinoma cells, and treated these cells with either FGF9 or PD173074 in sphere culture. We observed a modest 1.2-fold increase in tumorsphere formation in response to treatment with FGF9 but a statistically significant twofold reduction in sphere formation in the presence of PD173074 (P < 0.01, Fig. 3F). Similarly, when we dissociated freshly isolated tumors from human-in-mouse tumor generated tissues (SI Materials and Methods), we found that these cells grew significantly fewer sphere colonies in the presence of PD173074 than in the presence of FGF9 (Fig. S3F). Collectively, these data demonstrate that FGF/FGFR signaling is an important regulator of breast cancer stem-like cells. Estrogen and FGF Signaling Induce Tbx3 Expression. The Tbx3 transcription factor has been reported to activate FGF signaling but also act downstream of FGF signaling, where it is required for propagation of FGF and Wnt signals in the rudimentary mammary epithelium (8–10). Therefore, we wanted to determine whether levels of Tbx3 correlated with estrogen or FGF signalFillmore et al. 200 180 160 140 120 100 80 60 40 20 0 SUM149 None EtOH E2 Conditioned Medium Fig. 2. Paracrine factors produced in response to estrogen expand ERα− breast CSCs. (A) Immunofluorescence of sorted cytospun MCF7 cells for ERα (green) and ESA/EpCAM (red) expression, counterstained for nuclei with DAPI (blue). (B) Cytometric plots of ERα expression in CD44+/CD24+/ESA+ cells (red, bulk), and in CD44+/CD24−/ESA+ stem-like cells (green), which comprise 2% of the culture. (C) Average percentage of CD44+/CD24−/ESA+ cells in ERα− SUM149, SUM159, and BT20 cultures following treatment with conditioned media from either ethanol (EtOH) or E2-pretreated MCF7. MCF7 cells are shown for reference, *P < 0.0001, n = 4 biological replicates. Data are mean ± SEM. (D) Tumorsphere-forming potential of SUM149 or SUM159 cultures described in C; n = 4 biological replicates. Data are mean ± SEM. ing. Accordingly, we examined Tbx3 expression in MCF7 cultures treated with combinations of estrogen, tamoxifen, FGF9, or PD173074. Indeed, Tbx3 mRNA and protein expression were increased in MCF7 cells treated with estrogen and further increased by FGF9 stimulation (Fig. 4 A and B). This induction was effectively inhibited by 4OHT or PD173074. Tbx3 protein was also visualized by immuno-fluorescence, revealing nuclear localization for the Tbx3 transcription factor in 60% of the MCF7 culture following estrogen treatment (Fig. 4C). We also examined the FGF-Tbx3 signaling axis in ERα− SUM149, SUM159, and BT-20 breast cancer cells treated with recombinant FGF9 or PD173074. Consistent with the findings in MCF7 cells, Tbx3 mRNA and protein expression was induced in response to FGF9 treatment (Fig. 4 D and E). Although treatment of the cultures with PD173074 did not affect the basal Tbx3 mRNA levels, protein levels appeared to be modestly decreased. Taken together, these data indicate that: (i) estrogen stimulates expansion of tumorigenic breast cancer cells in part through FGF signaling, (ii) inhibition of FGF/FGFR signaling decreases tumorigenic breast stem-like cells, and (iii) estrogen causes induction of Tbx3 expression breast cancer cells and is a likely mechanism through which FGF signaling is perpetuated. Tbx3 Expression Is Sufficient for Breast CSC Expansion. Because Tbx3 is known to be necessary for the specification and expansion of normal mammary stem cells, we next examined whether Tbx3 might also be necessary for the expansion of breast cancer stemlike cells. Using an RNAi knock-down approach in three different breast cancer cell lines (MCF7, SUM149, and SUM159), we were able to reduce endogenous Tbx3 mRNA and protein levels 60– 85% (Fig. S4 A and B). It is known that the DUSP6 phosphatase is activated following FGF signaling, and that the spatiotemporal expression pattern of DUSP6 in the developing mammary gland is similar to that of Tbx3 (10). Therefore, we also assayed expression of DUSP6 and found that DUSP6 mRNA expression was reduced an average of 2.4-fold in the shTbx3 transduced cultures. These results are analogous to observations in embryonic mammary epithelial cells showing that FGF signaling is required for Tbx3 and DUSP6 expression and that Tbx3 expression is important for further FGF production and signal propagation (8–10). To assess the role of Tbx3 in breast CSC maintenance, we performed flow cytometry and tumorsphere assays on cells exhibiting the greatest inhibition of Tbx3 expression. We found no significant difference in the proliferation rates of SUM149, SUM159, or MCF7 breast cancer cells upon Tbx3 knockdown (Fig. S4 C and D). However, the ability of MCF7 cells transduced with shTbx3 to increase the proportion of CD44+/CD24−/ESA+ PNAS | December 14, 2010 | vol. 107 | no. 50 | 21739 MEDICAL SCIENCES CD44+/CD24+/ESA+ A 60 40 20 Average tumor volume (mm^3) s hG 700 600 500 7 6 5 FGF9 Vehicle e FGF9 PD173074 E2 + PD * * 4 3 * 2 ** FG D ** SUM159 SUM149 sh F 300 200 100 * 0 3 4 Time (weeks) 5 E2+ 4OHT 4OHT PD E2+ PD C E2+ FGF9 ESA Tbx3 DAPI EtOH 10µm 2.5 2 1.5 1 0.5 0 -0.5 -1 -1.5 -2 -2.5 1nM E2 E2 4OHT E2+ 4OHT PD E2+ PD E2+ FGF9 ** 1 BT20 400 2 B E2 EtOH FR SUM159 untreated FGF9 pre-treat PD173074 pre-treat E2 Actin 0 3 FP EtOH+ DMSO Percent Tbx3+ Nuclei 80 A Tbx3 140 Patient-derived tumor sphere fomration Sphere formation 100 * * mRNA level (log2) D 120 0 E E2 conditioned medium 450 400 350 300 250 200 150 100 50 0 120 mRNA level (log2) * 1nM E2 C B ** PD173074 Sphere formation no inhibitor 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 % CD44+/CD24-/ESA+ % CD44+/CD24-/ESA+ A 3 Tbx3 2.5 2 1.5 1 0.5 0 SUM149 SUM149 + FGF9 + PD 100 80 * 60 E 1.6 1.8 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 1.4 SUM159 - 1.2 1 +FGF9 +PD Tbx3 0.8 0.6 -Actin 0.4 0.2 SUM149 0 SUM159 SUM159 + FGF9 + PD - -0.2 -0.4 BT20 + FGF9 BT20 + PD +FGF9 +PD Tbx3 -Actin 40 20 0 untreated DMSO PD173074 FGF9 6 Fig. 3. FGFR signaling is necessary for estrogen CSC expansion. (A) Average percentage of CD44+/CD24−/ESA+ cells in MCF7 cultures treated with 1 nM 17β-estradiol (E2) or E2-conditioned medium in the presence of the FGFR inhibitor PD173074. n = 6 Biological replicates for fresh media, *P < 0.0001; n = 4 biological replicates for conditioned media, **P < 0.005, Data are mean ± SEM. (B) MCF7 cells pretreated E2, FGF9 (100 ng/mL), or E2 and PD173074 were seeded for tumorspheres and resulting spheres, Data are mean ± SEM, n = 4 biological replicates. *P = 0.01 either E2 or FGF9 vs. EtOH. (C) Sphere formation of estrogen-pretreated MCF7 cultures transduced with indicated small hairpins. (D) Flow-cytometric analysis of CD44+/CD24−/ESA+ cells in ERα− SUM149, SUM159, BT20 cultures following treatment with either recombinant human FGF9 or the FGFR inhibitor, PD173074. MCF7 cells treated with E2 are shown as reference. Data are mean ± SEM; n = 4 biological replicates. *P < 0.004 FGF9 vs. vehicle; **P < 0.0005 PD vs. vehicle. (E) Tumor formation of 104 SUM159 cells pretreated with DMSO, FGF9, or PD173074 injected orthotopically into mice; n = 12 for each treatment. *P < 0.02 DMSO vs. PD. Data are mean ± SEM. (F) Tumorsphere formation of breast cancer cells isolated from a primary human breast cancer (TUM177) treated with FGF9 or the FGFR inhibitor PD173074, *P = 0.01 DMSO vs. PD. Data are mean ± SEM. cells or increase sphere formation following estrogen was significantly attenuated (Fig. 5 A and B). Likewise, a 20–50% reduction in cancer stem-like cells and tumorsphere formation was observed in shTbx3 transduced SUM149 and SUM159 lines (Fig. 5 A and B). Furthermore, Tbx3 was inhibited using two different hairpins in patient-derived cancer cells and also resulted in a significant reduction in sphere formation (Fig. 5C). Notably, we were unable to maintain efficient knockdown of Tbx3 in any cell line for more than two passages following selection; therefore, we could not assess in vivo tumor seeding ability of shTbx3 cells. Consequently, we took an alternative approach and ectopically overexpressed Tbx3 in normal human mammary epithelial cells (HMECs) and MCF7 cancer cells to determine whether Tbx3 expression would suffice to promote stem-like cell behavior. Indeed, expression of Tbx3 resulted in a ∼twofold increase in the number of spheres formed by HMEC cells and increased the proportion CD44+/CD24−/ESA+ cancer stem-like cells in MCF7 cells by ninefold (Fig. 5D and Fig. S4E). Furthermore, overexpression of Tbx3 in MCF7 cells led to a robust twofold increase in tumorsphere formation (Fig. 5D). Consistent with the expansion of cancer stem-like cells, overexpression of Tbx3 in MCF7 cells resulted in a 100-fold increase in tumor21740 | www.pnas.org/cgi/doi/10.1073/pnas.1007863107 Fig. 4. FGF/Tbx3 signaling is intact human breast cancer cells. (A) Western blot of Tbx3 in MCF7 cultures treated with vehicle (EtOH+DMSO), 1 nM E2, 100 ng/mL FGF9, 100 nM 4OHT, or FGFR inhibitor 10 μM PD173074. (B) Quantitative RT- PCR of Tbx3 expression in the same MCF7 cells assayed in A. Data are represented as average delta (deltaCt) ± SEM; n = 4 experiments. (C) Immunofluorescence of MCF7 cells treated with 1 nM E2 or EtOH vehicle; ESA/EpCAM (green), Tbx3 (red), and DAPI (blue) show nuclear localization of Tbx3. Quantification is shown below. (D) Quantitative RT-PCR analysis of DUSP6 and Tbx3 expression in SUM149, SUM159, and BT-20 cultures treated with FGF9 or PD173074 relative to expression in cultures treated with DMSO. Data are represented as average delta (deltaCt) ± SEM; n = 4 biological replicates. (E) Western blot analysis of Tbx3 expression in SUM149 and SUM159 cells described in D. initiation compared with control cells (Fig. 5E, P = 0.001). Collectively, these findings indicate that Tbx3 is sufficient to promote normal and cancer stem-like cell phenotypes. Expression of FGFR3 and Tbx3 in Human Breast Cancers. Our results suggest that paracrine FGF signaling mediated through Tbx3 is important in regulating the proportion of CSCs within cultured breast cancer populations. To determine whether this mechanism might also operate within the context of primary human breast cancers, we queried a gene expression database that encompasses more than 18,000 human cancer gene expression microarrays (18, 19) for FGFR3 and TBX3 expression. We found that TBX3 was highly expressed in many subtypes of breast cancer when compared with normal tissue, and that Tbx3 expression correlated with ER-positive tumors. Furthermore, Tbx3 expression was highly correlated with metastatic recurrence at both 3 and 5 y, whereas Stage III tumors had a high correlation with genomic amplification of the Tbx3 locus (Figs. S5 and S6 A and B). These data are consistent with and support other recent findings that TBX3 is upregulated in human breast cancers (16). In addition, we found that breast tumors that responded to chemotherapy expressed significantly lower levels of Tbx3 than nonresponders, and that cell lines that are sensitive to chemotherapies likewise have much lower Tbx3 expression relative to chemotherapy-resistant cell lines (Fig. S6 C and D). Furthermore, ERα expression levels were strongly correlated with FGFR3 expression in a majority of primary tumor samples (P = 0.001, Fig. S5). These data are compatible with the notion that the E2/FGF/Tbx3 signaling axis is activated in many primary breast cancers. Discussion Here, we identify the estrogen/FGF/Tbx3 signaling axis as an important modulator of CSC properties both in vitro and in vivo. Fillmore et al. MCF7 Empty vector 80 60 * ** 20 # of cells injected 100µm 1x10 1x104 5 2/8 1/8 8/8 * 7/8 * 1x103 1x102 2/8 0/8 3/8 0/8 b (2 x3 ) T 100µm sh rl Tbx3 T sh EV sh C nt F7 M C M 14 9 E b (1 x3 ) 0 0 100µm 40 350 300 250 200 150 100 50 0 * EV Tbx3 100µm MCF7 sphere formation 20 100 300 250 200 150 100 50 0 While much of our data were collected using the experimental system of the ERα+ MCF7 cell line, we were able to observe upregulation of Tbx3 in many different primary human tumor datasets, suggesting the relevance of this pathway in primary tumor samples. In addition, we observed conservation of the FGF/FGFR3/Tbx3 signaling pathway in basal-type ERα− cell lines, as well in freshly dissociated patient tissue, indicating that this pathway may be important for growth of many subtypes of breast cancers other than the common ERα+ subtype. The experiments described here also demonstrate that the regulation of breast CSCs are influenced by the same regulatory pathways that control stem cells in the developing mammary gland. Although the underlying basis for this connection is unclear, several other groups have observed a conservation or reexpression of developmental signaling programs in cancers and cancer stem cells (20–22). Based on the results described here, we propose a model in which Tbx3 expressing cancer cells promote the expansion of CSCs through paracrine FGF signaling (Fig. S7). In ERα+ breast cancer cell lines, estrogen (E2) binds to the estrogen receptor to induce FGF9 secretion and Tbx3 expression in the non-CSC compartment. Expression of Tbx3 leads to further expression of Wnts and FGFs to perpetuate signaling, which ultimately leads to expansion of the CSC pool. In breast cancers that do not express ERα, Tbx3 expression stabilizes paracrine FGF and Wnt signaling to regulate cancer stem cell (CSC) subpopulations. This model is consistent with prior work showing that Wnt signaling is necessary for maintenance of subpopulations with stem-like properties in normal mammary tissues and breast cancer (23). Clearly, further studies will be required to determine whether Tbx3 expression is induced by Wnt signaling in cancer and whether inhibition of this pathway will have a clinical impact. The experiments described here demonstrate that estrogen can also influence the representation of breast CSCs within cancer cell populations, in part through its effects on the extracellular signaling milieu. Similar observations have been made in the normal mouse mammary gland, in which epithelial stem cell function is controlled in part through RANKL and Wnt4, which are secreted in response to both estrogen and progesterone (24, 25). Fillmore et al. ** EV Tbx3 Fig. 5. Tbx3 is necessary and sufficient for breast CSC expansion. (A) (Left) Average percentage of CD44+/CD24−/ESA+ cells in MCF7 cultures transduced with lentiviruses encoding short hairpins targeting a scrambled sequence (Cntrl), GFP, or Tbx3 and treated with 1 nM 17-β-estradiol (E2) or vehicle (EtOH). *P < 0.0015. (Right) Average percentage of CD44+/CD24−/ESA+ cells in SUM149 and SUM159 cultures transduced with lentiviruses encoding short hairpins targeting Tbx3 and treated with recombinant FGF9. Data are mean ± SEM; n = 4 biological replicates. *P < 0.003; **P < 0.007. (B) Normalized tumorsphere-forming potential of SUM159, SUM149, or MCF7 cultures transduced with hairpins targeting a scramble sequence (Cntrl) or Tbx3. Data as mean ± SEM; n = 4 experiments. *P < 0.001; **P < 0.005; ***P < 0.02. (C) Normalized tumorsphere formation of breast cancer cells isolated from a primary human breast cancer (TUM177) transduced with lentiviruses containing two different short hairpin sequences targeting Tbx3. *P < 0.002; **P < 0.0008. (D) Normalized sphere-forming ability of immortalized human mammary epithelia cells (HMEC) or MCF7 cells ectopically overexpressing human Tbx3; n = 4 experiments, 2 biological replicates. *P = 0.002; **P = 0.003. (E) Tumor formation of MCF7 cells overexpressing Tbx3 or empty vector (EV) injected in limiting dilution into NOD/SCID mice. *Nonparametric χ2 statistic was used as described in Fig. 1. The experiments described here as well as in other studies have demonstrated that normal and cancer breast stem cell pools lack abundant ERα expression (24–26, 12). This suggests that the successes of tamoxifen and aromatase inhibitors, such as letrozole, for the treatment estrogen-sensitive breast tumors may be attributed to the inhibition of paracrine factors released by ERα+ breast cancer cells but not to the eradication of ERnegative CSCs. Indeed, residual breast cancer cells in tumor tissues treated with letrozole exhibited a pronounced enrichment of cells exhibiting CSC phenotypes (27). This observation, combined with our findings, suggests that resistance to antiestrogen therapies and recurrence of ERα+ breast cancers could arise from genetic or epigenetic alterations that allow for the acquisition of FGF/Tbx3 activity in the absence of continued estrogen stimulation. In support of this notion, tamoxifen resistance by breast cancer cells is accompanied by increases in DUSP6 expression (28), as well as mesenchymal transdifferentiation (29). Furthermore, studies have shown that overexpression of FGF ligands subverts the requirement for estrogen to drive tumor formation (30–32). Although our experiments focused on breast cancer CSC expansion stimulated by FGF9, we found that other FGF ligands are also capable of influencing CSC numbers. We did not address here whether other FGFRs in addition to FGFR3 can contribute to breast CSC expansion. Nevertheless, an important prediction of our model is that the acquisition of resistance to anti-hormone therapies might be accompanied by an increase in FGF/FGFR/Tbx3 signaling and a concomitant increase in the proportion of CSCs. Therefore, targeting the FGF/FGFR/Tbx3 pathway may be a useful therapeutic strategy for hormonetherapy refractory luminal (ERα+) breast cancers. Materials and Methods Detailed methods are described in SI Materials and Methods. Cells and Tissue Culture. Cell line procurement and culture is described in SI Materials and Methods. All human breast tissue was obtained in compliance with the laws and institutional guidelines, as approved by the institutional institutional review board committee from Tufts University School of Medicine. An ER+, Her2− tumor was obtained from discarded material, and noncancerous breast tissue PNAS | December 14, 2010 | vol. 107 | no. 50 | 21741 MEDICAL SCIENCES rl sh sh Tb x3 nt C rl nt sh sh D Tbx3 *** M 15 9 SUM149 HMEC HMEC sphere formation 40 Patient-derived sphere fomration ** SU * 120 80 SU * C Tb x3 sh sh nt C C 100 * ** SUM159 shCntrl shTbx3 60 G FP rl 0 untreated + FGF9 7 6 5 4 3 2 1 0 Tb x3 1 0.5 120 Sphere fomration %CD44+/CD24-/ESA+ 2 1.5 sh MCF7 %CD44+/CD24-/ESA+ B ** * EtOH E2 2.5 nt ra ns du ce d em pt y ve ct or A was obtained from patients undergoing elective reduction mammoplasty at Tufts Medical Center. Cells were manipulated as described in SI Materials and Methods. L-glutamine and 10% charcoal-dextran–stripped FBS and fed to naive cells for a total of 6 d, with media changed every 2 d, after boiling for 5 min where specified. Flow Cytometry. Antibodies used are EpCAM (ESA)-FITC (clone VU-ID9, AbD Serotec), CD24-PE (clone ML5, BD Pharmingen), and CD44-APC (clone G44-26, BD Pharmingen). When staining for ERα-FITC (clone SP1, Abcam) cells were stained sequentially with EpCAM (clone VU- ID9, Abcam), rat–anti-mouse PerCP (BD Pharmingen) and CD24-PE/CD44-APC (BD Pharmingen) before cells were fixed in 4% paraformaldehyde and 0.1% Saponin and incubated with ERα-FITC. Western Blot and Immunofluorescence. Antibodies used for IF were ERα-FITC (clone SP1, Abcam), EpCAM (clone B29.1, Abcam), and Tbx3 (rabbit, Aviva). Antibodies used for Western blotting were Tbx3 (mouse, Abcam), FGFR3 (rabbit, Sigma), and β-actin (clone mAbcam 8226, Abcam). Tumorsphere Assays. Cells were trypsinized and mechanically separated and, when necessary, passed through 40-μm filters to obtain single cell suspensions that were plated at less than 10,000 cells per mL in super–low-attachment plates in normal growth media (with supplements where indicated). Quantification of mammosphere and tumorsphere numbers was accomplished using a Multisizer 3 Coulter Counter (Beckman-Coulter) that provided number and size distributions of particles between 40 μm and 336 μm. Isolation of RNA, Microarray, and Quantitative RT-PCR. Cells were harvested by trypsinization of fluorescence-activated cell sorting and pelleted by centrifugation, and RNA isolation was performed using the RNAeasy kit (Qiagen) in accordance with the manufacturer’s protocol. The RNA samples were then reverse transcribed using the iScript cDNA kit (Bio-Rad), and quantitative PCR was performed with Sybr green (Bio-Rad) on a Bio- Rad iCycler. Primers are listed in SI Materials and Methods. Conditioned Medium Experiments. Subconfluent MCF7 cultures grown in standard phenol red containing DMEM with 10% FBS were washed and switched to phenol-red–free DMEM + 10% charcoal-dextran stripped FBS supplemented with 1 nM 17-β-estradiol or EtOH for 6 d. Cultures were then washed five times with PBS and incubated with fresh serum-free phenolred–free DMEM. Conditioned medium (CM) was harvested 72 h later, passed through a 0.2-μm filter, and frozen at −80°C. For each experiment, at least three distinct batches of CM were combined and supplemented with 2 mM ACKNOWLEDGMENTS. We thank Ina Klebba and Dr. Lisa Arendt for surgical assistance and maintenance of the animal colony. We thank Allen Parmelee and Steve Kwok for expert technical assistance with cell sorting. We thank Josh LaBaer at Harvard Medical School (Boston, MA) for generously providing us with human Tbx3 cDNA. This work was supported grants from the American Cancer Society–New England Division–Broadway on Beachside Postdoctoral Fellowship PF-08-101-01-CSM (to P.J.K.), Breast Cancer Research Foundation (to C.K. and C.M.F.), Raymond and Beverly Sackler Foundation (to C.K.), and National Institutes of Health/National Cancer Institute Grant R01CA125554 (to C.K.). C.K. is a Raymond and Beverly Sackler FoundationScholar. 1. Clarke MF, et al. (2006) Cancer stem cells—Perspectives on current status and future directions: AACR Workshop on Cancer Stem Cells. Cancer Res 66:9339–9344. 2. Al-Hajj M, Wicha MS, Ito-Hernandez A (2003) Morrison SJ (2003) Clarke MF (2003) Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 100:3983–3988. 3. Ginestier C, et al. (2007) ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1: 555–567. 4. Ponti D, et al. (2005) Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 65:5506–5511. 5. Yu F, et al. (2007) let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell 131:1109–1123. 6. Fillmore CM, Kuperwasser C (2008) Human breast cancer cell lines contain stem-like cells that self-renew, give rise to phenotypically diverse progeny and survive chemotherapy. Breast Cancer Res 10:1–13. 7. Gupta PB, et al. (2009) Identification of selective inhibitors of cancer stem cells by high-throughput screening. Cell 138:645–659. 8. Robinson GW (2007) Cooperation of signalling pathways in embryonic mammary gland development. Nat Rev Genet 8:963–972. 9. Rowley M, Grothey E, Couch FJ (2004) The role of Tbx2 and Tbx3 in mammary development and tumorigenesis. J Mammary Gland Biol Neoplasia 9:109–118. 10. Eblaghie MC, et al. (2004) Interactions between FGF and Wnt signals and Tbx3 gene expression in mammary gland initiation in mouse embryos. J Anat 205:1–13. 11. Dillon C, Spencer-Dene B, Dickson C (2004) A crucial role for fibroblast growth factor signaling in embryonic mammary gland development. J Mammary Gland Biol Neoplasia 9:207–215. 12. Coleman-Krnacik S, Rosen JM (1994) Differential temporal and spatial gene expression of fibroblast growth factor family members during mouse mammary gland development. Mol Endocrinol 8:218–229. 13. Rosen JM, Humphreys R, Krnacik S, Juo P, Raught B (1994) The regulation of mammary gland development by hormones, growth factors, and oncogenes. Prog Clin Biol Res 387:95–111. 14. Brisken C, Duss S (2007) Stem cells and the stem cell niche in the breast: An integrated hormonal and developmental perspective. Stem Cell Rev 3:147–156. 15. Mallepell S, Krust A, Chambon P, Brisken C (2006) Paracrine signaling through the epithelial estrogen receptor alpha is required for proliferation and morphogenesis in the mammary gland. Proc Natl Acad Sci USA 103:2196–2201. 16. Noel A, Simon N, Raus J, Foidart JM (1992) Basement membrane components (matrigel) promote the tumorigenicity of human breast adenocarcinoma MCF7 cells and provide an in vivo model to assess the responsiveness of cells to estrogen. Biochem Pharmacol 43:1263–1267. 17. Wing LY, Chuang PC, Wu MH, Chen HM, Tsai SJ (2003) Expression and mitogenic effect of fibroblast growth factor-9 in human endometriotic implant is regulated by aberrant production of estrogen. J Clin Endocrinol Metab 88:5547–5554. 18. Rhodes DR, et al. (2004) ONCOMINE: A cancer microarray database and integrated data-mining platform. Neoplasia 6:1–6. 19. Yarosh W, et al. (2008) TBX3 is overexpressed in breast cancer and represses p14 ARF by interacting with histone deacetylases. Cancer Res 68:693–699. 20. Ben-Porath I, et al. (2008) An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet 40:499–507. 21. Hassan KA, Chen G, Kalemkerian GP, Wicha MS, Beer DG (2009) An embryonic stem cell-like signature identifies poorly differentiated lung adenocarcinoma but not squamous cell carcinoma. Clin Cancer Res 15:6386–6390. 22. Somervaille TC, et al. (2009) Hierarchical maintenance of MLL myeloid leukemia stem cells employs a transcriptional program shared with embryonic rather than adult stem cells. Cell Stem Cell 4:129–140. 23. DiMeo TA, et al. (2009) A novel lung metastasis signature links Wnt signaling with cancer cell self-renewal and epithelial-mesenchymal transition in basal-like breast cancer. Cancer Res 69:5364–5373. 24. Asselin-Labat ML, et al. (2010) Control of mammary stem cell function by steroid hormone signalling. Nature 465:798–802. 25. Joshi PA, et al. (2010) Progesterone induces adult mammary stem cell expansion. Nature 465:803–807. 26. Horwitz KB, Dye WW, Harrell JC, Kabos P, Sartorius CA (2008) Rare steroid receptornegative basal-like tumorigenic cells in luminal subtype human breast cancer xenografts. Proc Natl Acad Sci USA 105:5774–5779. 27. Creighton CJ, et al. (2009) Residual breast cancers after conventional therapy display mesenchymal as well as tumor-initiating features. Proc Natl Acad Sci USA 106: 13820–13825. 28. Cui Y, et al. (2006) Elevated expression of mitogen-activated protein kinase phosphatase 3 in breast tumors: A mechanism of tamoxifen resistance. Cancer Res 66: 5950–5959. 29. Hiscox S, et al. (2006) Tamoxifen resistance in MCF7 cells promotes EMT-like behaviour and involves modulation of beta-catenin phosphorylation. Int J Cancer 118: 290–301. 30. McLeskey SW, et al. (1993) Fibroblast growth factor 4 transfection of MCF-7 cells produces cell lines that are tumorigenic and metastatic in ovariectomized or tamoxifen-treated athymic nude mice. Cancer Res 53:2168–2177. 31. Zhang L, et al. (1997) MCF-7 breast carcinoma cells overexpressing FGF-1 form vascularized, metastatic tumors in ovariectomized or tamoxifen-treated nude mice. Oncogene 15:2093–2108. 32. Hajitou A, et al. (2000) Progression in MCF-7 breast cancer cell tumorigenicity: Compared effect of FGF-3 and FGF-4. Breast Cancer Res Treat 60:15–28. 21742 | www.pnas.org/cgi/doi/10.1073/pnas.1007863107 Fillmore et al. Supporting Information Fillmore et al. 10.1073/pnas.1007863107 SI Materials and Methods Cells and Tissue Culture. SUM cell lines were obtained from Dr. Stephen Ethier (Karmanos Institute, Detroit) and are commercially available (Asterand). MCF7, HCC1428, T47D, and BT-20 cell lines were purchased from ATCC. MCF7, HCC1428, T47D, and BT-20 cells were cultured in DMEM with 10% calf serum or in phenol-red–free DMEM, 2 mM L-glutamine, and 10% charcoal-dextran–stripped FBS for experiments with estrogen stimulation. SUM149PT and SUM159PT cells were cultured in Ham’s F-12 medium with 5% calf serum, insulin (5 μg/mL), and hydrocortisone (1 μg/mL). All cell lines were grown at 37 °C in a 5% CO2 incubator. Estrogen (17-β-estradiol) was dissolved in ethanol to a stock concentration of 1 μM; PD173074 (Sigma) was dissolved in DMSO to a stock concentration of 10 mM. All treatments, including those with conditioned media, lasted 6 d. All human breast tissue procurement for these experiments was obtained in compliance with the laws and institutional guidelines, as approved by the institutional institutional review board committee from Tufts University School of Medicine. An ER+, Her2− tumor was obtained from discarded material, and noncancerous breast tissue was obtained from patients undergoing elective reduction mammoplasty at Tufts Medical Center. Breast tissues were minced and enzymatically digested overnight with a mixture of collagenase and hyaluronidase as previously described (1, 2). Digested cells were plated briefly in serum (1–2 h) to deplete mammary fibroblasts from the organoid fraction of mammary fibroblasts. The organoids were dissociated to a single cell suspension by trypsinization and filtered with a 40-μm filter (BD Biosciences) to remove residual clustered cells. Immediately after dissociation, cells were assayed for mammospheres formation or were infected with lentivirus and then assayed. For the human-in-mouse tumors, mammary epithelial cells from three different patient samples were spin infected with lentivirusencoding MyrP110α, kRasG12V, p53R175H, and CCND1 and implanted into humanized mouse mammary glands (1). Flow Cytometry. Subconfluent cultures were trypsinized into single cell suspension, counted, washed with PBS, and stained with antibodies specific for the following human cell-surface markers: EpCAM (ESA)-FITC (clone VU-ID9, AbD Serotec), CD24-PE (clone ML5, BD Pharmingen); and CD44-APC (clone G44-26, BD Pharmingen). For each staining reaction, 100,000 cells were incubated with 4 μL of each antibody for 15 min at room temperature. Unbound antibody was washed off and cells were analyzed on a BD FACSCaliber no more than 1 h poststaining. Isotype controls included mouse IgG1-FITC, mouse IgG2aκ-PE, and mouse IgG2bκ-APC (BD Pharmingen). When staining for ERα-FITC (clone SP1, Abcam) cells were stained sequentially with EpCAM (clone VU-ID9, Abcam), rat–anti-mouse PerCP (BD Pharmingen), and CD24-PE/CD44-APC (BD Pharmingen) before cells were fixed in 4% paraformaldehyde and 0.1% Saponin and incubated with ERα-FITC. Animals and Surgery. All animal procedures were conducted in accordance with relevant national and international guidelines and according to the animal protocol approved by the Tufts University Institutional Animal Care and Use Committee. NOD/ SCID mice were purchased from Jackson Labs. Female mice 5–7 wk of age were ovariectomized and allowed to recover for 4 wk before tumor cell injection. For tumor-seeding studies, the indicated numbers of MCF7 cells pretreated for 6 d with vehicle (EtOH), 1 nM 17-β-estradiol (E2), or 1 nM 17-β-estradiol and Fillmore et al. www.pnas.org/cgi/content/short/1007863107 the FGFR inhibitor PD173074 (E2+ PD) were suspended in 1:1 (vol/vol) culture medium: Matrigel (BD Biosciences) mixture and injected into the fourth inguinal mammary gland. For SUM159 pretreatment experiments, intact 8-wk-old female NOD/SCID mice were injected into the fourth inguinal mammary gland (n = 12 for each group) with 10,000 cells pretreated for 6 d with PD173074 or with FGF9. Tumorsphere Assays. Viable dissociated single cells (∼30,000/mL) were plated in 6-cm ultra–low-attachment plates (Corning) in the indicated media. Tumorspheres and mammospheres were allowed to form for 5 or 8 d, respectively, after which spheres were collected for analysis. Quantification of mammosphere and tumorsphere numbers was accomplished using a Multisizer 3 Coulter Counter (Beckman-Coulter) that provided number and size distributions with an overall sizing range of 40 μm to 336 μm. Tumorspheres and mammospheres were collected and pelleted at 800 rpm for 5 min and resuspended in 1 mL freshly filtered growth media, diluted in 20 mL 6:4 isoton II:glycerol diluent (Beckman-Coulter), and run in triplicate on the Multisizer 3. Conditioned Medium Experiments. Subconfluent MCF7 cultures were treated with 1 nM 17-β-estradiol or EtOH for 6 d in phenolred–free DMEM and 10% charcoal-dextran–stripped FBS (Invitrogen). Cultures were washed five times with PBS and incubated with fresh serum-free, phenol-red–free DMEM. Conditioned medium (CM) was harvested 72 h later, passed through a 0.2-μm filter, and frozen at −80 °C. For each experiment, at least three distinct batches of CM were combined and supplemented with 2 mM L-glutamine and 10% charcoal-dextran stripped FBS and fed to naive cells for a total of 6 d, with media changed every 2 d, after boiling for 5 min where specified. Cytokine Array and Quantification. Serum-free CM was collected as described above. Human cytokine arrays (2000 series, RayBiotech) were exposed to conditioned medium from MCF7 cultures pretreated with either ethanol (vehicle) or estrogen and processed in accordance with the manufacturer’s protocols. Exposed films of chemiluminescence signal obtained from dot blots were scanned, and the pixel intensity for each cytokine was quantified and normalized to IgG loading controls using ImageJ software (National Institutes of Health). Western Blot and Immunofluorescence. For immunfluorescence (IF), cells were fixed in 4% paraformaldehyde and 0.1% saponin and permeabilized with 0.1% BSA and 0.25% Triton-X, both in PBS. Coverslips were mounted with Vectashield mounting medium plus DAPI (Vector Labs). Antibodies used for IF were ERα-FITC (clone SP1, Abcam), DUSP6 (clone 3G2, Novus), EpCAM (clone B29.1, Abcam), and Tbx3 (rabbit, Aviva). For Western blotting, 25 μg protein extract per sample denatured with heat and reducing agents, separated on a 4–12% acrylamide gel, and transferred to nitrocellulose. Antibodies used for Western blotting were Tbx3 (mouse, Abcam), FGFR3 (rabbit, Sigma), and β-actin (clone mAbcam 8226, Abcam). Isolation of RNA and Quantitative RT-PCR. Cells were harvested by trypsinization, pelleted by centrifugation, and RNA isolation was performed using the RNAeasy kit (Qiagen) in accordance with the manufacturer’s protocol. The RNA samples were then reverse transcribed using the iScript cDNA kit (Bio-Rad), and quantitative PCR was performed with Sybr green (Bio-Rad) on a Bio-Rad iCycler. Primers used are: GAPDH F-GAGTCAAC1 of 8 isolated by miniprep (Qiagen). Lentiviral expression construct for Tbx3 gene transduction was created using standard Gateway cloning techniques into the self-inactivating pLenti6.2/V5DEST Gateway vector (Invitrogen). A WT human Tbx3 cDNA clone (NM_016569.2–443) was generously provided by Josh LaBaer (Harvard Institute of Proteomics, Harvard Medical School. Boston, MA). The VSV-G-pseudotyped lentiviral vectors were generated by transient cotransfection of the above vectors with the VSV-G-expressing construct pCMV-VSV-G and the packaging construct pCMV DR8.2Dvpr (3), both generously provided by Inder Verma (Salk Institute), into 293T cells with the FuGENE 6 transfection reagent (Roche). Viral supernatant was collected and introduced to subconfluent SUM149, SUM159, MCF7, and HMEC cultures, or to patient-derived breast cancer cells. Lentiviral integration was selected with 1 μg/ mL puromycin (for shRNAs), or with 10 μg/mL blasticidin (Tbx3) for 7 d. GGATTTGGTCGT R-GACAAGCTTCCCGTTCTCAG, Tbx3 F-TGGGGACCTCTGATGAGTCCT R-CCATGCTCCTCTTTGCTCTC, DUSP6 F-GCTATACGAGTCGTCGCACA RCGTCCTTGAGCTTCTTGAGC, Wnt5a F-GGGAGGTTGGCTTGAACATA R-GAATGGCACGCAATTACCTT, ERα FATTTGAAGTGGGCAGAGAACAT R-CAATACCAACATCAGCCAGAAA, FGFR3 F-ACTGGGGAACAGTGGATGTC R-GGATGCCTGCATACACACTG, FGF9 F-TTTCTGGTGCCGTTTAGTCC R-GACTACCTGCTGGGCATCAA, Vimentin F-AGATGGCCCTTGACATTGAG R-GGTCATCGTGATGCTGAGAA, N-Cadherin F-ACAGTGGCCACCTACAAAGG RCCGAGATGGGGTTGATAATG, E-Cadherin F-TGCCCAGAAAATGAAAAAGG R-GGATGACACAGCGTGAGAGA, Zeb-1 F-GATCAACCACCAATGGTTCC R-TTGCGCAAGACAAGTTCAAG. Lentiviral Constructs and Infection. Bacterial glycerol stocks of MISSION shRNA were obtained (Sigma), and plasmid DNA was 1. Proia DA, Kuperwasser C (2006) Reconstruction of human mammary tissues in a mouse model. Nat Protoc 1:206–214. 2. Wu M, et al. (2009b) Dissecting genetic requirements of human breast tumorigenesis in a tissue transgenic model of human breast cancer in mice. Proc Natl Acad Sci USA 106: 7022–7027. 900 800 700 600 500 400 300 200 100 0 B 4 EtOH % CD44+/CD24-/ESA+ Thousands of Cells A 3. Miyoshi H, Blömer U, Takahashi M, Gage FH, Verma IM (1998) Development of a selfinactivating lentivirus vector. J Virol 72:8150–8157. E2 1 2 3 4 5 6 EtOH 3.5 E2 3 2.5 2 1.5 1 0.5 0 1 Days in Culture – Phenol Red Free DMEM + 10% Charcoal stripped FBS 2 3 4 5 6 Days in Culture – Phenol Red Free DMEM + 10% Charcoal stripped FBS T47D % CD44+/CD24-/ESA+ 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 HCC1428 % CD44+/CD24-/ESA+ untreated 1nM E2 EtOH * 20 18 16 14 12 10 8 6 4 2 0 1nM E2 +100nM 4OHT % CD44+/CD24-/ESA+ * C p>0.5 2.5 2 p>0.5 1.5 1 0.5 0 EtOH untreated EtOH 1nM E2 SUM1315 SUM159 1nM E2 1nM E2 +10 nM 4OHT Fig. S1. (A) MCF7 cells were seeded in six-well plates at 100,000 cells per well. The next day, the cultures were switched to phenol-red–free DMEM with 10% charcoal-dextran FBS and either 1 nM estrogen or vehicle (EtOH). Each day, two wells per condition were trypsinized and counted. Average cell number per well per day is shown. (B) Cells described in A were assayed daily for percentage of CD44+/CD24−/ESA+ cells by flow cytometry. (C) Average percentage of CD44+/CD24−/ESA+ cells as measured by flow cytometry in the ERα+ cell lines T47D (*P < 0.01) and HCC1428 (*P < 0.0001), or in the ERα− cell lines SUM159 and SUM1315, following 6-d treatment with either 1 nM 17-β-estradiol (E2) or vehicle (EtOH). Data are mean ± SEM; n = 5 biological replicates. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 2 of 8 E 4 3.5 3 2.5 2 1.5 1 0.5 0 * EtOH 1nM E2 ** IGF-I IGF-II IGFBP-6 IGFBP-2 conditioned conditioned medium medium boiled EGF F IGFBP-4 fresh medium boiled FGF-9 fresh medium FGF-7 bFGF bNGF PBMP-7 PBMP-6 PBMP-5 PBMP-4 2 TGFb2 40 30 20 10 0 Fb TGFb3 16 14 12 10 8 6 4 2 0 -2 -4 -6 -8 -10 p<0.0001 TGFa % ER + cells D % CD44+/CD24-/ESA+ n relative r e tto EtOH Fold Secretion C 70 60 50 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0 FGF-6 B Bulk % CD44+/CD24-/ESA+ Stem 90 80 FGF-4 A * ** EtOH E2 FGF9 E2+FGF9 E2+PD 3.00 EtOH E2 2.00 1.50 1.00 0.50 0.00 not assayed not assayed % CD44+/CD24-/ESA+ 2.50 no growth 100ng/mL 100ng/mL 100ng/mL 100ng/mL 100ng/mL 100ng/mL 100ng/mL factor FGF2 FGF10 EGF Heregulin IGFII BMP6 SDF1b Fig. S2. (A) Quantification of ERα immunofluorescence staining on sorted and cytospun MCF7 cells. Graph represents percentage of ERα+ cells for from seven fields per sort with an average of 56 nuclei per field ± SEM. (B) Average percentage of CD44+/CD24−/ESA+ cells as assayed by flow cytometry in MCF7 cultures following 6-d treatment with fresh estrogen, vehicle (EtOH), or conditioned media from EtOH- or E2-pretreated MCF7 cells. *P < 0.001 E2 CM vs. EtOH CM. Where indicated, unconditioned or conditioned media was boiled before feeding the cells. For unconditioned media containing fresh 1 nM 17-β-estradiol, the estrogen was added before boiling to show its relative heat stability. *P < 0.04 E2 CM vs. E2 CM boiled. Data are mean ± SEM; n = 4 biological replicates. (C) Cytokine array quantification of proteins secreted by MCF7 cells in response to estrogen (E2). All data are normalized to the respective IgG controls, and the fold increase in secretion is shown as the E2 pixel value divided by the EtOH pixel value for matched exposure lengths. (D) Average percentage of CD44+/CD24−/ ESA+ cells in MCF7 cultures treated with 1 nM 17-β-estradiol (E2), recombinant human FGF9 (100 ng/mL), or FGF9 and E2 in the absence of serum. *P < 0.05 E2+FGF9 vs. E2; **P < 0.001 E2 vs. E2+PD. Data are mean ± SEM; n = 6 biological replicates. (E) Average percentage of CD44+/CD24−/ESA+ cells in MCF7 cultures following 6-d treatment with EtOH vehicle, 1 nM 17-β-estradiol (E2), fibroblast growth factor 2 (FGF2), fibroblast growth factor 10 (FGF10), human epidermal growth factor (EGF), recombinant human heregulin (HRG), insulin-like growth factor 2 (IGFII), bone morphogenic protein 6 (BMP6), or stromal-derived factor 1β (SDF1β). Data are mean ± SEM. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 3 of 8 A E Sphere formation FGFR3 DAPI 10µm B SUM159 SUM149 300 * * 250 200 150 100 50 0 untreated FGF9 pre-treat FGF9 PD173074 pre-treat PD173074 FGFR3 -Actin F DMSO PD173074 FGF9 * 160 140 sphere formation EtOH E2 2.5 2 1.5 1 * 120 100 40 Tumor 2 Tumor 3 sh G FP sh FG FR 3 nt C sh ce pt y du Tumor 1 em ns rl 0 ve ct or 20 tra * 60 0 un * 80 0.5 d %CD44+/CD24-/ESA+ C D Relative cell n umber R E2/EtOH cultures 3 2.5 2 1.5 1 0.5 un tra ns em duc ed pt y ve c s h to r C nt rl sh G F sh P FG FR 3 0 MCF7 Fig. S3. (A) Immunofluorescence of FGFR3 (red) and DAPI (blue) of untreated MCF7 cultures. (B) Western blot of FGFR3 expression in MCF7 cells transduced lentivirus containing a small-hairpin directed to FGFR3. (C) Average percentage of CD44+/CD24−/ESA+ cells in MCF7 cultures treated for 6 d with 1 nM 17β-estradiol (E2) in cultures transduced with indicated small hairpins. *P = 0.001 shFGFR3+E2 vs. shCntrl+E2. (D) Proliferation rates of FGFR3 knockdown MCF7 cell lines in response to 1 nM 17-β-estradiol (E2). Data are shown as total cell number in E2-treated cultures normalized to cell number in matched EtOH-treated cultures; n = 4. (E) Tumorsphere formation of SUM159 or SUM149 cells pretreated with recombinant human FGF9 or FGFR inhibitor PD173074, or treated while making spheres with FGF9 or PD173074. Data collected at 6 d after seeding, *P < 0.002 FGF9 vs. vehicle. (F) Three different tumors derived from primary mammary epithelial cells transformed with MyrP110α, kRasG12V, p53R175H, and CCND1 and implanted into humanized mouse mammary glands were dissociated into single cells and plated at low dilution on super–low-attachment plates in filtered MEGM ± DMSO, 100 ng/mL FGF9, or 10 μM PD173074. Spheres were quantified on a Becton Dickonson Multisizer 8 d after seeding, and sphere formation was normalized to the DMSO condition; n = 12. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 4 of 8 mRNA level (log2) A MCF7 mRNA level (log2) mRNA level (log2) MCF7 -1 EV -2 sh sh GF P Tb x3 Tbx3 -3 Actin n -4 SUM159 0 SUM159 -0.2 -0.4 sh -0.6 -0.8 -1 Cn trl sh GF sh P Tb x3 Tbx3 -1.2 TBX3 DUSP6 -1.4 -1.6 Actin SUM149 SUM149 0 sh -0.2 -0.4 -0.6 Tbx3 -0.8 -1 Actin Cn trl sh GF sh P Tb x3 3 Relative el cell number C B 0 2.5 2 EtOH E 1.5 0.14% 1 1nM E2 2.06% 0.5 un tra ns em duc ed pt y ve ct sh or C nt rl sh G FP sh Tb x3 0 MCF7 EV TBX3 4.5 D 0.17% 4 2.59% 3 CD44 Mean OD600 3.5 2.5 2 1.5 CD24 1 0.5 SUM159 trl sh Tb x3 sh Cn sh Cn trl sh Tb x3 0 SUM149 Fig. S4. RNAi-mediated knock down of Tbx3. (A) RT-PCR of Tbx3 and DUSP6 expression (relative to shCntrl). (B) Western blot of Tbx3 expression in MCF7, SUM159, and SUM149 cultures transduced with lentivirus containing short hairpins targeting a scrambled sequence (Cntrl), GFP, or Tbx3. (C) Proliferation rates of Tbx3 knockdown MCF7 cell lines in response to 1 nM 17-β-estradiol (E2). Data are shown as total cell number in E2-treated cultures normalized to the cell number in matched EtOH-treated cultures; n = 4. (D) Proliferation rates of SUM149 and SUM159 Tbx3 knockdown cultures as measured by Crystal Violet staining. Cells were stained 6 d after being equally plated, and OD595 was measured on a spectrophotometer. Data are mean ± SEM. (E) Representative flow cytometric dot plots of CD44 and CD24 expression in MCF7 cultures over-\expressing Tbx3. Empty vector control-transduced cultures are shown for comparison. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 5 of 8 A Radvanyi et al, 2005 (NV, N=9) (NB, N=7) (DCIS, N=7) Minn et al, 2005 (IDBC, N=7) (ILBC, N=7) (IMBC, N=3) (ER-, N=42) (ER+,N=57) Chin et al.,2006 (ER-, N=43) (ER+,N=75) Lu et al.,2008 (ER-, N=50) (ER+,N=45) B Fig. S5. TBX3 expression in human breast cancers. (A) Oncomine (Compendia Bioscience) was used for analysis and visualization of TBX3 expression in published microarray data sets. TBX3 overexpression was observed in many invasive breast cancer subtypes when compared with normal breast tissue, and correlates very highly with ER expression. DCIS, ductal breast carcinoma in situ; IDBC, invasive ductal breast carcinoma; ILBC, invasive lobular breast carcinoma; IMBC, invasive mixed breast carcinoma; NB, normal breast; NV, no value. (B) Gene expression correlation analysis in a data set shows that a large group of primary breast tumors coexpress high levels of ERα and FGFR3. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 6 of 8 A Loi et al Loi et al P-value: 4.20E-4 1. No Metastatic Recurrence at 3 Years (78) 2. Metastatic Recurrence at 3 Years (8) P-value: 0.002 1. No Metastatic Recurrence at 5 Years (78) 2. Metastatic Recurrence at 5 Years (8) J Clin Oncol 2007/04/02 J Clin Oncol 2007/04/02 B P value: 0.022 Chin et al. P-value: 1. Stage I (119) 2. Stage II (34) 3. Stage III (16) Genome Biol 2007/10/07 D Gyorffy et al. P-value: 0.019 C Hess et al. P-value: 4.20E 1. P/FAC Non-responder (90) 2. P/FAC Responder (32) J Clin Oncol 2006/09/10 Wooster et al. P-value: 0.023 -5 Hoeflich et al. P-value: 1.37E-5 1. Doxorubicin Resistant (6) 1. Paclitaxel Resistant (7) 1. Erlotinib Resistant (18) 2. Doxorubicin Sensitive (20) 2. Paclitaxel Sensitive (153) 2. Erlotinib Sensitive (3) Int J Cancer 2006/04/01 Not Published 2008/05/09 Clin Cancer Res 2009/07/15 Fig. S6. TBX3 expression in tumors following response to therapy. Oncomine (Compendia Bioscience) was used for analysis and visualization of TBX3 expression in published microarray data sets grouped as follows: (A) metastasic recurrence at 3 and 5 y; (B) genomic amplification of Tbx3 locus and tumor stage; (C) pathological complete response to therapy; and (D) sensitivity of breast cancer cells to common breast cancer therapeutics in vitro. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 7 of 8 E2 E2 ERα FGF/FGFR TBX3 TBX3 FGF wnt Luminal/ERα + Cells FGF9 FGFR3 FGF9 FGFR3 E2 ERα ERα E2 ERα ERα FGF Wnt TBX3 ERα TBX3 Basal/EMT Cells Cells Basal/EMT FGF FGF Wnt TBX3 TCF4 Wnt Wnt TBX3 TCF4 DUSP6 DUSP6 TBX3 Fig. S7. Proposed model of paracrine signaling within breast cancer cell lines. In ERα+ tumors, estrogen (E2) binds to the estrogen receptor in the non-CSC compartment to induce paracrine FGF9 secretion. FGF9 then binds to FGFR3 and induces Tbx3 expression. Expression of Tbx3 leads to further expression of Wnts and FGF/FGF signaling which promote CSC phenotypes. In ERα− tumors, it appears that FGFR/Tbx3 is active in the EMT-like cells, leading to stabilized paracrine signaling that regulates cancer stem cell (CSC) subpopulations. Fillmore et al. www.pnas.org/cgi/content/short/1007863107 8 of 8