RNA interference: new tool, ancient immune system Bergen lecture – April 21st 2005 Torgeir Holen, CMBN 1 29/05/2016 Aims of this talk Part I: To give a short introduction to the newly discovered immune system RNA interference (RNAi) in various species Part II: To look at some practical limitations to knocking down mRNA gene expression by RNAi & siRNA, and some recent solutions... Part III: siRNA is already old hat – what’s going on now...? short RNA : DNA/chromatin interactions... 2 29/05/2016 Part I: Gene silencing exist in many multicellular organisms roundworm Petunias Transgenic Petunias C. elegans Transgenic potatoes resist virus infection fungus Neurospora 3 fruitfly Drosophila 29/05/2016 Gene silencing go back to the earliest epochs of life on Earth This ancient immune system seems conserved over 1.5 billion years ...thus we can learn about different aspects of gene and RNA silencing wherever it is easiest... plants... roundworms... flies... human cell lines... Wang, Kumar & Hedges, 1999 4 29/05/2016 A brief history of RNA silencing 1998: Andrew Fire and colleagues show that double-stranded RNA induce gene silencing in C. elegans • 1999: Hamilton & Baulcombe find small RNA where genes are silenced in plants • 2000: Greg Hannon and colleagues isolate Dicer, the siRNA producing RNase-III enzyme in Drosophila • 2001: Thomas Tuschl and colleagues show that synthetic small RNA introduced into human cells can silence human genes 5 29/05/2016 6 29/05/2016 Plasmid produced siRNA •Brummelkamp, 2002; Paddision, 2002; Miyahishi, 2002; Paul, 2002; Sui, 2002; Lee, 2002; Jacque, 2002; Yu, 2002; Yang, 2002 7 29/05/2016 The PRK/interferon response immune-system virus-response system in mammalian cells activated by long dsRNA mechanism: shuts down all translation by by phosphorylating eIF2-alpha (see Williams, Oncogene, 1999) the siRNA break-through of Thomas Tuschl consisted of the PKR/interferon response not being activated (Elbashir et al, Nature, 2001; also shown by Natasha Caplen, PNAS, 2001) 8 29/05/2016 Part II: Limits to siRNA activity - some other limitations to these great, but very new, tools 1. siRNA exhibit position effects – some target positions superior to others 2. siRNA activity fades out – in our case 3-4 days after transfection 3. siRNA activity can be blocked by competition with less active siRNA 4. Some siRNA have great tolerance for chemical modifications 5. Some siRNA tolerate mutations 6. Main problem of RNAi-field today: delivery, in vitro & in vivo 9 29/05/2016 Finding good target positions: TF-luciferase-reporter assay - Holen et al (Nucleic Acids Research, 2002). - Tissue Factor (TF), is the principal coagulation trigger and has been implicated in cardiac diseases. TF is also involved in angiogenesis and metastasis of cancer. Fusion Reporter Construct ... TF (47-951) LUC (37-2255) pTRE ... pTRE Fen1, Aqp4 and GlnS Constructs pTRE Fen1/Aqp4/GS LUC (37-2255) pTRE ... ... 10 29/05/2016 Why the position effects? hTF562i hTF478i hTF372i hTF167i PSK314i HeLa mRNA AGGUGGCCGGCGCUUCAGGCACUACAAAUACUGUGGC hTF158i AGGUGGCCGGCGCUUCAGGTT hTF161i UGGCCGGCGCUUCAGGCACTT hTF164i CCGGCGCUUCAGGCACUACTT hTF167i hTF562i hTF478i hTF372i hTF167i PSK314i 293 GCGCUUCAGGCACUACAAATT hTF170i CUUCAGGCACUACAAAUACTT hTF173i CAGGCACUACAAAUACUGUTT hTF176i hTF562i hTF478i hTF372i hTF167i PSK314i GCACUACAAAUACUGUGGCTT Cos-1 Cotransfections with siRNAs targeting sites around hTF167 hTF929i hTF562i hTF478i hTF459i hTF372i hTF256i hTF167i hTF77i PSK739i PSK566i PSK546i PSK314i HaCaT TF-LUC/RLUC Normalised Re lativ e hTF-Fluc/Rluc 120 100 80 60 40 20 0 PSK314i 20 40 60 80 hTF158i hTF161i hTF164i hTF167i hTF170i hTF173i 100 120 140 Normalised TF-LUC/RLUC 11 29/05/2016 hTF176i Knock-downs must be verified... PSK739i PSK566i PSK546i PSK314i hTF562i hTF478i hTF372i hTF167i mock - position effect consistent also in Northern assays, protein assays and coagulation assays… Inhibition of TF mRNA, procoagulant activity Protein &andCoagulation antigen by siRNA TF GAPDH TF hTF176i hTF173i hTF170i hTF167i hTF164i hTF161i hTF158i mock Northerns Normalised TF expression 120 100 80 mRNA procoag antigen 60 40 20 0 mock hTF167i hTF372i PSK314i Legend: mRNA (filled bars), procoagulant activity (dotted bars) and TF protein (hatched bars) GAPDH 12 29/05/2016 Some recent computational solutions to position effects: Khvorova, Cell, 2003: 5’end of active antisense unstable... Ui-Tei et al, Nucleic Acids Research, 2004: (i) A/U at the 5' end of the antisense strand (ii) G/C at the 5' end of the sense strand (iii) at least five A/U residues in the 5' terminal one-third of the antisense strand (iv) the absence of any GC stretch of more than 9 nt in length. siRNAs opposite in features with respect to the first three conditions give rise to little or no gene silencing in mammalian cells 13 29/05/2016 RNAi silencing sets in slowly… …why? Normalised TF expression Normalised TF/GAPDH mRNA Time-dependence of hTF167i effect 100 procoag 80 mRNA 60 LUC 40 20 0 48 h 72 h 96 h 120 h Measurements at 4 h, 8 h, 24 h, 48 h …and fades out even more slowly, but steadily… 14 29/05/2016 Tolerance for chemical modifications P1+1 5’-g*c-gcuucaggcacuaca-a-a-u*a-3’ 3’-g*c-c-g-cgaaguccgugaugu-u*u-5’ P0+2 5’-g-c-gcuucaggcacuaca-a-a*u*a-3’ 3’-g*c*c-g-cgaaguccgugaugu-u-u-5’ P2+2 5’-g*c*gcuucaggcacuaca-a-a*u*a-3’ 3’-g*c*c-g-cgaaguccgugaugu*u*u-5’ P2+4 5’-g*c*gcuucaggcacuaca*a*a*u*a-3’ 3’-g*c*c*g*cgaaguccgugaugu*u*u-5’ M1+1 5’-GcgcuucaggcacuacaaauA-3’ 3’-GccgcgaaguccgugauguuU-5’ M0+2 5’-gcgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguuu-5’ M2+2 5’-GCgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguUU-5’ M2+4 5’-GCgcuucaggcacuacaAAUA-3’ 3’-GCCGcgaaguccgugauguUU-5’ Normalized TF/GAPDH mRNA Normalised TF/GAPDH mRNA 120 100 80 60 40 20 0 mock wt A1+1 5’-GcgcuucaggcacuacaaauA-3’ 3’-GccgcgaaguccgugauguuU-5’ A0+2 5’-gcgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguuu-5’ P1+1 P0+2 M1+1 M0+2 A1+1 A0+2 P2+2 P2+4 M2+2 M2+4 15 29/05/2016 Inhibition of cholesterol synthesis by siRNA: A recent study by Alnylam Inc "...Administration of chemically modified siRNAs resulted in silencing of the apoB messenger RNA in liver and jejunum, decreased plasma levels of apoB protein, and reduced total cholesterol. " Soutschek et al, Nature, 2004 16 29/05/2016 An siRNA mutation study **** * ** * * 5'-GCGCUUCAGGCACUACAAAUA GCCGCGAAGUCCGUGAUGUUU-5' Normalized TF/GAPDH mRNA mRNA TF/GAPDH Normalised 120 100 80 60 40 20 s1 6 s1 3 s1 1 s1 0 s7 s4 s3 s2 s1 t w ds 7/ 1 ds 0 10 /1 ds 1 10 /1 ds 3 10 /1 6 m oc k 0 Amarzguioui M, Holen T, Babaie E, Prydz H. Tolerance for mutations and chemical modifications in a siRNA. Nucleic Acids Res. 2003 Jan 15;31(2):589-95. 17 29/05/2016 Other genes possibly targeted by laminB2 CLSTN2 5'-AAGAGGAGGAAGAAGCCGAGG-3' |||||||||| ||||||||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' HS6ST3 5'-AAGAGGAGGAGGAAGACGAGC-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' NM_015897 5'-AAGAGGAGGAGGAAGACGAGG-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' The dangers of siRNA in functional genomics: “…the two other lamins, B1 and B2, are now identified as essential proteins” (Harborth et al, JCS, 2001) NM_015355 5'-ACUCGGCCUCCUCCUCCUCCU-3' ||||||| ||||||||||| | 3'-UGAGCCGAAGGAGGAGGAGAA-5' ATBF1 5'-AAGAGGAGGAGGAAGACGAGG-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' SPTB 5'-AAGAGGAGGAGGAAACAGAGU-3' |||||||||||||| | |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' 18 29/05/2016 The delivery problem - comparing different transfection agents Lipofectamine2000, Lipofectamine, Oligofectamine and RNAifect… 140 120 100 80 60 40 20 as -1 6 hT 7 F1 67 as -P i SK 41 1 as -1 6 hT 7 F1 67 as -P i SK 41 1 as -1 6 hT 7 F1 67 as -P i SK 41 1 as -1 6 hT 7 F1 67 as -P i SK 41 1 0 19 29/05/2016 Indirect delivery in vivo - Tissue Factor in cancer metastasis Day 10 Day 15 set-up: metastatic B16 cells transfected with siRNA against TF, then injected into tail-vein of mice tumors will then colonize lungs of mouse mTF223i D mTF223i hTF167i mock hTF167i mTF GAP Day 20 mTF321i mTF223i hTF167i 20 Mohammed Amarzguioui, Qian Peng, Torgeir Holen, Vlada Vasovic, Eshrat Babaie, Jahn 29/05/2016 M. Nesland & Hans Prydz RNAi delivery by virus Lentiviruses delivery especially interesting for delivery to neuronal cells. An et al, Human Gene Theraphy, 2003 Stewart et al, RNA, 2003 Paddison PJ, Silva JM, Conklin DS, Schlabach M, Li M, Aruleba S, Balija V, O'Shaughnessy A, Gnoj L, Scobie K, Chang K, Westbrook T, Cleary M, Sachidanandam R, McCombie WR, Elledge SJ, Hannon GJ. A resource for large-scale RNAinterference-based screens in mammals. Nature. 2004 Mar 25;428(6981):427-31. 21 29/05/2016 Transgenic RNAi: mice expressing siRNA Carmell, Rosenquist et al, Nature Structural & Molecular Biology, 2003 22 29/05/2016 Regulatable knock-downs What of it? Can’t the Cre/LoxP system or other conditional knock-outs do the same? From Matsukura et al (Nucleic Acids Research, 2003) 23 29/05/2016 Part III: The possible link between RNA and DNA silencing in higher organisms 1) 2) 3) RNA silencing, more than siRNA DNA & chromatin regulation: still unsolved... Three cases of RNA-DNA silencing link a) b) c) d) e) dsRNA-induced DNA methylation in plants transgene DNA silencing in Drosophila centromere silencing in budding yeast (S. pombe) X-chromatin silencing in humans... recently: chromatin silencing induced by short RNA in human cells 24 29/05/2016 More small RNA exist • stRNA (short temporal RNA, also called micro-RNA, miRNA) inhibit mRNA translation (Lee & Ambros, 1993; Reinhart, 2000; Lee, 2001; Lau, 2001; LagosQuintana, 2001; Llave, 2002; Lim, 2003) • microRNA comes from microGenes, transcripted as ~70 nt hairpins, and processed (as is shRNA) to short ~21-mer RNAs... • latest research hotspot: heterochromatic siRNA might affect centromeres in budding yeast (S.pombe) (Reinhart, 2002; Volpe, 2002) 25 29/05/2016 Double-stranded RNA cause silencing in plants PTSVd viroids (Wassenegger, Cell, 1994) • PTSVd can lead to methylation of a target down to 30 bp of DNA (Pelissier & Wassenegger, RNA, 2000) HOW??? 26 29/05/2016 Lehninger, 1993 X-chromosome inactivation centre (Xic) Xic (450 kb region) can be transferred to chromosome 12, resulting in gene silencing, hypoacetylation, histone methylation (His3mLys9), delayed DNA replacation and RNA coating... (Lee & Jaenisch, Nature, 1997) Lee, Cell, 2000 27Lewin, 200029/05/2016 Summary: What is the mechanism? Is the proposed mechanism right? ...and does it exist in higher organisms? Allshire, Science, 2002 Nobody knows... yet 28 29/05/2016 Two recent papers find chromatin modifications in mammalian cells Morris KV, Chan SW, Jacobsen SE, Looney DJ. Small interfering RNA-induced transcriptional gene silencing in human cells. Science. 2004 Aug 27;305(5688):1289-92. Epub 2004 Aug 05. Kawasaki & Taira. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature. 2004 Sep 9;431(7005):211-7. Epub 2004 Aug 15. 29 29/05/2016