AN ABSTRACT OF THE THESIS OF Yuko Eguchi for the degree of Master of Science in
Animal Science presented on September 22. 2000.
Title:
Phospholipase A2 mRNA Expression in Testes from
Roosters (Gallus domesticus) Characterized by High or
Low Sperm Mobility Phenotype.
Approved:
Redacted for privacy
David P. Froman
Previous research has shown that sperm mobility is
a primary determinant of fertility in fowl.
Sperm
mobility denotes the net movement of a sperm population,
and males can be characterized by phenotype.
Sperm
acylcarnitine content differs between low and high sperm
mobility phenotypes.
The release of acyl groups from
phospholipids within sperm depends on the action of the
enzyme phospholipase.
Inhibition of phospholipase A2
(PLA2) activity eliminates sperm motility, thereby
rendering sperm immobile.
This research was performed
to test whether cPLA2 was expressed differentially in
roosters characterized by low or high sperm mobility
phenotype.
cPLA2 expression in the two phenotypes was
compared using reverse transcription - polymerase chain
reactions.
The cDNA amplified was a 352 nucleotide
fragment encoding the Ca 2+ binding domain of cPLA2.
Two
sequential experiments were performed using full- and
half-sib roosters.
In the first experiment (n=3 full­
sibs per phenotype), cPLA2 expression was greatest in
testes from the high phenotype relative to
~-actin
or
18S rRNA (P < 0.05 and P < 0.0057, respectively).
The
average cPLA2 : p-actin ratios for high and low sperm
mobility phenotypes were 0.63 ± 0.260 (mean ± SEM) and
0.32 ± 0.123, respectively.
The cPLA2 : 18S rRNA
average ratios were 0.74 ± 0.158 and 0.38 ± 0.135 for
high and low sperm mobility phenotypes, respectively.
In the second experiment (n=6 half-sibs per phenotype),
the high mobility phenotype also showed greater (P <
0.023) expression of cPLA2 relative to the 18S rRNA
control with averages of 0.74 ± 0.141 and 0.49 ± 0.104
for high and low sperm mobility phenotypes,
respectively.
Moreover, sequence analysis of the
nucleotide fragment showed no difference between
phenotypes. cPLA2 expression clearly differed between
sperm mobility phenotypes.
It was concluded that a
difference in the regulation of cPLA2 mRNA expression
contributes to variation between lines of roosters
generated by selection for sperm mobility.
©Copyright by Yuko Eguchi September 22, 2000 All Rights Reserved Phospholipase A2 mRNA Expression in Testes from Roosters (Gallus domesticus) Characterized by High or Low Sperm Mobility Phenotype. by Yuko Eguchi A THESIS Submitted to Oregon state University in partial fulfillment of
the requirements for the
degree of
Master of Science
Presented September 22, 2000 Commencement June, 2001 Master of Science thesis of Yuko Eguchi presented on
September 22, 2000
Approved:
Redacted for privacy
Major Professor, representing Animal Sciences
Redacted for privacy
He
of Department of Animal Sciences
Redacted for privacy
Dean of
raduate School
I understand that my thesis will become part of the
permanent collection of Oregon State University
libraries. My signature below authorizes release of my
thesis to any reader upon request.
Redacted for privacy
Yuko Eguchi, Author
ACKNOWLEDGEMENTS
I didn't know it but I bit off more than I could
chew when I decided to get a Master's degree in Animal
Sciences.
In hindsight, I can safely say that I could
not have reached this point without the help and support
from so many friends and colleagues.
First, I would
like to thank and acknowledge all of the people who
helped me and are not named here, you know who you are.
I mean no disrespect but over the last two years the
list has become significant in both length and quality
of individual.
I would like to give special thanks to both Dr.
Alfred R. Menino and Dr. David P. Froman for giving me
the opportunity to participate on this project and
donating so much time, effort, and expertise.
which I would not have known where to begin.
without
I
appreciate the mentoring that you have given me, and
feel as though I can never thank either one of you
enough.
I would like to thank all the committee members,
Dr. Dahong Zhang, Dr. Darlene D. Judd, and Dr. Jim R.
Males for taking time out of their busy schedules._ I
consider it an honor to have such a distinguished panel
of people willing to participate in my thesis defense.
without the help from Terry Brandebourg, Viola
Manning, Ying-Yi Xiao, Allen FeItmann , I would never
have gotten the results in the laboratory that I did.
Your technical advice and expertise proved to be
invaluable to me and my research.
Thank you.
I would like to extend my eternal gratitude to my
friends and peers.
While I appreciate the help on my
project, I value my friendship with each of you more
than anything else.
It is you gals that made my job not
seem so much like work but more like fun. Thank you
CoreyAyne Singleton, Katy Paul, Sara Supancic, Lisa
Gemmill, and Jonna Collins.
I would like to also thank
Stephanie Greenway, Allison Walker, and Tobin Knighton
for late night proof readings and everlasting
encouragement.
I only hope I can and will be able to
return the favor to each and everyone who has helped me
get this far.
Thanks again.
TABLE OF CONTENTS Page Introduction. 1
Literature Review • 4
Materials and Methods .18 Results .25 Discussion. .31 References. .36 Appendix. .42 LIST OF FIGURES Figure
1. Testicular ~-actin and cPLA2 expression in
roosters with high or low sperm mobility
phenotypes • • • . •
• • . . • • • • • . • • • 26
2. Testicular cPLA2 and 18S rRNA expression in
roosters with high or low sperm mobility
phenotypes • • • •
• • • . • • • • . . • • 26
3. Testicular ~-actin and 18S rRNA expression in
roosters with high or low sperm mobility
phenotypes .
.
.
.
.
.
.
.
.
.
.
.
.
.
..
. . 29
LIST OF TABLES Table Page
10 categorization of phospholipase A20 0 0 0 0 0 0 0 08
20 PCR primer sequences for cPLA2 and p-actino 0 0 0 22
30 cPLA2 mRNA expression between sets of full-sib
roosters representing two sperm mobility
phenotypes
.
.
.
.
.
.
• .
.
.
.
.
.
.
.
• .
.
. 27
40 cPLA2 mRNA expression between sets of half-sib
roosters representing two sperm mobility
phenotypes 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 30
Phospholipase A2 mRNA Expression in Testes from Roosters
(Gallus Domesticus) Characterized by High or Low Sperm
Mobility Phenotype.
INTRODUCTION
Sperm cells are self-propelled DNA delivery
vehicles.
While this fact may seem trite at face value,
it must be remembered that the concept has been
developed over the course of nearly 300 years.
For
example, in the late 17th century when sperm cells were
first visualized, it was believed that each cell carried
a pre-formed individual.
Thus, it took many years for
scientists to realize that sperm cells carried
chromosomes, that this payload was half the complement
characteristic of the species, and that each of these
chromosomes contained a mixture of paternal and maternal
genes as opposed to a replica of an intact chromosome
from either parent.
Further advances were made after the advent of the
electron microscope; for such instrumentation afforded
the visualization of the axoneme, which is the molecular
motor within the sperm's tail.
Likewise, the discovery
of second messengers, such as Ca 2+ and cAMP advanced the
study of sperm motility.
In review, it would seem that
2
there was little else to be gained from the study of
sperm.
However, in the late 1990s, a new trait was
discovered by D.P. Froman at Oregon state University:
sperm mobility.
This term denotes the net movement of a
sperm cell population.
One aspect of the discovery was
that normal, fertile males showed extreme variation in
sperm mobility.
In other words, even though two males
might be considered normal as evidenced by variables
such as sperm count, structure, and viability - and even
though these two males might be fertile, i.e. capable of
producing offspring - one of these males might actually
have greater fitness due to the tendency of his sperm to
move en masse under physiological conditions.
This thesis represents the first attempt to
determine the molecular basis for sperm mobility
phenotype.
It is noteworthy that sperm mobility is a
quantitative trait.
Therefore, multiple genes are
important for expression.
However, a series of
experiments had demonstrated that an enzyme known as
phospholipase A2 (PLA2) might play a significant role.
Protein synthesis depends upon the translation of
messenger RNA (mRNA) into a sequence of amino acids.
consequently, the code within the mRNA and the amount of
mRNA in a cell are important considerations for any
given protein.
This research investigated the
3
expression of PLA2 mRNA in roosters manifesting an
extreme difference in sperm mobility phenotype due to
genetic selection.
4
LITERATURE REVIEW
Internal fertilization in the domestic fowl depends
upon the following phenomena: motile sperm ascending the
hen's vagina, sperm storage within the oviduct's sperm
storage tubules (SST), and an acrosome reaction
following sperm egress from the SST.
Allen and Grigg
(1957) were the first to show that aggressive sperm
ascension was dependent upon sperm motility in the
vagina.
The vaginal sphincter, which is located between
the shell gland and vagina, serves as a barrier to the
movement of sperm within the oviduct.
Bakst et al.
(1994) wrote an exhaustive account of movement and
storage of sperm in the oviduct.
Sperm are stored
within specialized tubules located distal to the vaginal
sphincter.
These tubules enable the oviduct to retain a
resident population of viable sperm when the oviduct
contains a nascent egg.
mechanism over many days.
Sperm egress by an unknown
This phenomenon approximates
an exponential decay based upon sperm associated with
the blastodisc in a sequence of eggs following a single
insemination (Pizzari and Froman, unpublished data).
summary, sperm sequestration is critical to internal
fertilization in fowl, and sperm motility is critical
for sperm sequestration.
In
5
Average straight-line velocity (VSL) of fowl sperm
ranges between 30 to 40
2000).
~m/s
(Froman and Feltmann,
However, VSL of individual sperm cells ranges
between 1 and 140
~m/s.
Froman and Feltmann (2000)
demonstrated that roosters in a population can be
characterized by differences in the concentration of
motile sperm within their ejaculates.
These researchers
have correlated phenotypic differences in the
concentration of motile sperm with phenotypic
differences in sperm mobility.
Sperm mobility is
defined as the net movement of a sperm population from
one location to another (Froman and Feltmann, 1998).
Maintenance of the motile state at body temperature is
dependent upon extracellular ca 2+, intracellular
phospholipase A2 (PLA2) activity, long chain fatty acids
complexed with carnitine, and the availability of oxygen
(Froman, unpublished data).
Therefore, spermatozoal
PLA2 activity appears to be critical to the fertility of
roosters, as it generates an endogenous substrate within
sperm cells.
As previously mentioned, sperm mobility denotes
the net movement of a sperm population (Froman and
Feltmann, 1998).
trait.
Sperm mobility is a quantitative
Thus, roosters can be identified within a
population that are characterized by distinct sperm
6
mobility phenotypes.
between phenotypes.
Sperm morphology does not differ
However, sperm from the low
phenotype were characterized by reduced acyl carnitine
content, oxygen consumption, and ATP content (Froman and
Feltmann, 1998; Froman et al., 1999).
Long-chain fatty
acids destined for p-oxidation within the mitochondrial
matrix must first be activated by esterification with
coenzyme A.
Next, the activated acyl group is
conjugated with carnitine on the exterior side of the
inner mitochondrial membrane prior to translocation.
Parenthetically, p-oxidation of fatty acids is an
oxygen-dependent process.
In review, it would appear
that the release of free fatty acids is critical to
expression of sperm mobility phenotype.
This assumption
is supported by the observation that
arachidonyltrifluoromethyl ketone, a specific inhibitor
of cytosolic PLA2, inhibits fowl sperm motility at
micromolar concentrations (Froman, unpublished data).
However, to date, much PLA2 research has been
conducted in light of the discovery that the enzyme
plays a role in signal transduction (Balsinde et al.,
1999).
Intracellular phospholipases (e, 0, Al and A2)
can be activated when cells are stimulated by diverse
agonists.
The enzymes catalyze the cleavage of membrane
phospholipids (Borsch-Haubold, 1998) and produce a
7
variety of lipid mediators, which represent an important
step in signal transduction (Miguel et al., 1999).
PLA2 hydrolyzes the sn-2 fatty acyl bond of
phospholipids to liberate free fatty acids and
lysophospholipids (Miguel et al., 1999).
PLA2 plays a
major role in diverse cellular processes including host
defense, signal transduction, membrane phospholipid
repair in response to oxidative damage, membrane
adaptation to temperature changes, and phospholipid
digestion and metabolism (Dennis, 1994).
PLA2 also
provides precursors for eicosanoid generation, which is
important for homeostasis regulation, e.g. maintenance
of vascular tone, blood pressure, uterine and glandular
function, and the acute inflammation response (Borsch­
Haulbold, 1998).
Mammalian cells contain several structurally
diverse PLA2 enzymes that can occur together in the same
cell (Table 1). In 1997, the classification system of
PLA2 was revised based on DNA sequence (Dennis, 1997).
All Group I, II, and III proteins are extracellular or
secretory enzymes (SPLA2).
They are characterized by 5
to 8 disulfide bonds that impart a rigid tertiary
structure (Balsinde et al., 1999).
The enzyme is also
8
Table 1 categorization of phospholipase A2.
Group
Subgroup
Sources
Type
Size
(kDa)
I
A
Cobra, kraits
Secreted
13-15
B
Porcine/human
Pancreas
Secreted
13-15
A
Rattle snakes,
vipers, human
synovial
fluid/polatelets
Secreted
13-15
B
Gaboon viper
Secreted
13-15
C
Rat/mouse testes
Secreted
15
Bees, lizards
Secreted
16-18
A
Raw 264.7/rat
kidney, human
U937/platelets
Cytosolic
85
B
Human brain
cytosolic
100
C
Human
heart/skeletal
muscle
Cytosolic
65
V
Human/rat/mouse
heart/lung, P388D1
macrophages
Secreted
14
VI
P388D1
macrophages,
chinese hamster
ovary cells
Cytosolic
80-85
A
Human plasma
Secreted
45
B
Bovine brain
Cytosolic
42
IX
Mice, snail
Secreted
14
X
Human leukocytes
Secreted
14
II
III
IV
VII
(Balsinde et al., 1999)
9
characterized by a low molecular weight, no specificity
for a fatty acid at sn-2, and the requirement of a
millimolar ca 2+ concentration for catalysis (Dennis,
1994).
The relatively high number of disulfide bonds
ensures stability against proteolysis and resistance to
denaturation.
Thus sPLA2 remains active in
extracellular fluid (Balsinde et al., 1999).
In
addition to its primary role in the digestion of dietary
lipid (Miguel et al., 1999), the Group IB pancreatic
sPLA2 also appear to play a role in inflammation (Vadas
et al., 1993).
In the last few years, additional forms
of the enzyme have been discovered (Dennis, 1994).
Group V sPLA2 is found primarily in cardiac tissue (Chen
et al., 1994) and is involved in arachidonic acid
release (Balboa et al., 1996).
The Group X sPLA2 has
been found in immune tissues where its function remains
unclear (Cupillard et al., 1997).
When PLA2 is
classified according to its biological properties, there
are three main types: sPLA2, the Group IV cytosolic PLA2
(CPLA2), and intracellular ca 2+-independent PLA2 (iPLA2i
Balsinde et al., 1999).
There are several distinct cPLA2 enzymes that share
no homology to the sPLA2 enzymes.
An 85-kDa iPLA2 is
the most recently identified and is ubiquitously
expressed (Ackerman and Dennis, 1995).
characteristics with sPLA2 and cPLA2.
It shares some
The iPLA2
10
exhibits no substrate specificity for fatty acids at sn­
2 of phospholipids, and similar to sPLA2, post­
translational modifications have not been discovered.
Both cPLA2 and iPLA2 have identical molecular weights
(Kda) , are found at similar intracellular sites, and may
have a common catalytic mechanism (Balsinde and Dennis,
1997).
All iPLA2 enzymes contain eight ankyrin unique
repeats and exist as a multimeric complex, which allows
them to be Ca 2+ independent (Tang et al., 1997). It has
been suggested that iPLA2 functions in the steady-state
remodeling of phospholipid fatty acyl groups (Balsinde
et al., 1995).
A distinct 85-kDa cPLA2 (Group IV) has been
extensively studied due to its importance in agonist­
induced arachidonic acid release (Clark et al., 1995;
Leslie,1997). This ca 2+-dependent PLA2 is present in
the cytosol of a variety of cells including human
neutrophils (Syrbu, 1999), human monoblasts U937 (Kramer
et al., 1991), and macrophages.
This cPLA2 is the only
PLA2 identified that has specificity for sn-2
arachidonic acid (Balsinde et al., 1999).
Even though
cPLA2 possesses PLA1' lysophospholipase and transacylase
activities, the enzyme was designated as a phospholipase
(Group IV; Dennis, 1997).
cPLA2 has a calcium-dependent
lipid-binding domain (C2) at its N-terminus and a
catalytic unit which forms an unique shape.
Active site
11
residues include Arg-200, Ser-228, and Asp-549.
These
three amino acids are necessary for multiple catalytic
activities (Pickard et al., 1996).
The C2 domain has been found in signal-transduction
and vesicle-fusion proteins, including protein kinase C,
GTPase-activating protein, synaptotagmin and
phospholipase COl (Dessen, 2000).
consists of eight antiparallel
~
The C2 domain
strands interconnected
by six loops that fold to form a sandwich.
This~­
sandwich coordinates between one to three Ca 2+ atoms
with a group of acidic residues on three ca 2+ binding
loops (Dessen et al., 1999).
Amino acids located at or
around the peak of three Ca 2+ binding loops are
responsible for membrane binding of cPLA2 by serving as
interface recognition (Dessen, 2000).
The catalytic mechanism of cPLA2 starts with a
serine-acyl intermediate, using Ser-228 as the
nucleophilic residue, followed by catalysis with Arg-200
and Asp-549.
Ser-228 and Asp-549 are located at the
bottom of a deep and narrow cleft, which is at the
center of a hydrophobic funnel.
This funnel allows
cPLA2 to selectively cleave arachidonyl phospholipids
(Dessen et al., 1999).
Dessen et al (1999) also
revealed that there is a flexible lid that is capable of
moving to yield substrate access to the active site.
12
Ubiquitously expressed cPLA2 is regulated at the
transcriptional level to ensure that the cellular
concentration of free arachidonic acid is controlled, as
cPLA2 plays an essential role in arachidonic acid
release and inflammation (Leslie, 1997; Miguel et al.,
1999).
For example, cytokines and growth factors, such
as interleukin (IL)-l, tumor necrosis factor (TNF), stem
cell factor (SCF), and IL-3 increase cPLA2 messenger RNA
and protein in a variety of cell types.
The increased
expression correlates with enhanced prostaglandin
production (Lin et al. 1992).
The gene for cPLA2
contains certain characteristics of a housekeeping
promoter in which there is no TATA box.
there is no GC-rich region or SP1 sites.
In addition,
In the
promoter region of the gene, there is a multiple
pyrimidine sequence that controls basal expression
(Leslie, 1997).
sites for transcription factor binding
domains that have been identified by DNA sequence
analysis include three AP-1, two PEA-3, one Nf-kappaB
motifs, and a glucocorticoid response element (Leslie,
1997; Bingham and Austen, 1999).
The presence of a
glucocorticoid response element suggests that steroids
possibly suppress the synthesis of cPLA2 (Leslie, 1997).
There are also ATTTA motifs at the 3' untranslated
region that may be another regulation site through
stabilizing transcription (Bingham and Austen, 1999).
13
CPLA2 is also regulated post-translationally by
Ca 2+ and phosphorylation status (Qiu et al., 1998).
As
previously mentioned, the N-terminus of cPLA2 contains a
C2 domain, which is important for ca 2+-dependent binding
of cPLA2 to membrane and phospholipid vesicles (Nalefski
et al., 1994).
cPLA2 trans locates from the cytosol to
the nuclear envelope, endoplasmic reticulum membrane,
and plasma membrane to induce arachidonic acid release
in a ca 2+-dependent fashion (Schievella et al.,1995;
Leslie, 1997).
Reynolds et al. (1993) demonstrated that
the following metal ions can replace Ca 2+ to exert
similar effects: Ba 2+, Mn2+, sr 2+, and Mg2+.
High
concentrations of NaCl and Na2S04 can also replace Ca 2+.
These data suggest that Ca 2+ may promote membrane
association rather than catalysis (Dennis, 1994).
Therefore, a micromolar increase in intracellular Ca 2+
concentration induces an allosteric change in the C2
domain that helps place the catalytic domain relative to
its substrate (Dessen, 2000).
Mitogen-activated protein kinase (MAPK) is also
important for cPLA2 activation.
potential phosphorylation sites.
There are multiple
However Borsch-Haubold
(1998) stated that Ser-505 and Ser-727 are critical.
Ser-505 and Ser-727 are conserved in cPLA2 from diverse
species, such as humans, mice, chickens, and zebrafish
(Leslie, 1997).
The kinase that is responsible for
14
phosphorylation of Ser 727 has not yet been identified,
but it is not MAPK (Leslie, 1997). Dessen et al. (1999)
stated that Ser 505 phosphorylation is required for
optimal orientation between the C2 and catalytic
domains, because Ser-505 is located close to the linker
region of the C2 and catalytic domains.
According to
Kramer et al. (1996), chinese hamster ovary cells
require phosphorylation of Ser-505.
However, in human
platelets, phosphorylation of Ser-505 is not required
for arachidonic acid release.
This suggests that there
are other mechanisms for activation.
In addition to calcium and phosphorylation
regulating CPLA2 activity, alternative mechanisms exist.
Mosior et al. (1998) demonstrated that
CPLA2 is
activated by and has a high affinity for phosphatidylinositol 4,5 bisphosphate (PIP2) in a 1:1 stoichiometry
in lipid vesicles.
This membrane affinity is
accompanied by an increase in cPLA2 activity.
Interestingly, PIP2 can decrease the Ca 2+ requirement
for CPLA2, so that under certain conditions, CPLA2 can
work independently from ca 2+ (Mosior et al., 1998).
cPLA2 may contain pleckstrin homology domains (PH) where
proteins localize on membranes by binding
polyphosphoinositides.
Mosior et al. (1998) has not
shown conclusive homology to any PH domain sequence in
cPLA2.
However, cPLA2 has a small region of basic
15
residues that is similar to phospholipase COl which
binds PIP2.
The relationship of the PH domain and
polyphosphoinositides with cPLA2 needs further study.
Recently, concerted cellular regulation by cPLA2
and sPLA2 has been discovered in arachidonic acid
generating cells.
The activation of cPLA2 is mediated
by several signals such as phosphorylation cascades,
increased intracellular Ca 2+ and binding to PIP2
(Balsinde et al., 1999).
In cells that do not express
sPLA2, cPLA2 accounts for the majority of arachidonic
acid released.
In platelets, the role of sPLA2 in
arachidonic acid release cannot be demonstrated,
suggesting cPLA2 is the only effector in this cell
system (Bartoli et al., 1994).
On the other hand, for
cells with sPLA2, the majority of arachidonic acid
release is shown to be mediated by activation of sPLA2.
Once this enzyme is secreted, it associates with the
outer surface of cells but nonetheless releases
arachidonic acid internally, which leads to eicosanoid
production. More importantly, researchers have
demonstrated that sPLA2 has a dependency on cPLA2
activation, i.e. cPLA2 is required for sPLA2 to function
correctly, but not vice versa (Balsinde et al., 1999).
Balsinde and Dennis (1996) proposed that cPLA2
rearranges the membrane and allows sPLA2 to amplify the
primary response initiated by cPLA2. Murakami et al.
16
(1998) stated that this bidirectional interaction
between cPLA2 and sPLA2 may represent a general action
leading to maximum arachidonic acid release.
Therefore,
cPLA2 also plays a key role as an arachidonic acid
release signal, followed by sPLA2 activation as an
effector (Balsinde et al., 1999).
It is evident that
cPLA2 plays dual roles; participating in a process to
activate sPLA2 and in release of arachidonic acid
(Balsinde et al., 1998).
In summary, much is known about PLA2 in signal
transduction.
However, relatively little is known about
the role of PLA2 in energy production, and ATP synthesis
is critical for expression of sperm mobility phenotype.
Based on a series of experiments (Froman and Feltmann,
1998; Froman et al., 1999; Froman and Feltmann, 2000;
Froman, unpublished data), PLA2 appeared to be critical
to the maintenance of fowl sperm motility at body
temperature over a time course of minutes to hours.
Consequently, the release of an endogenous substrate
within fowl sperm may enable them to ascend the hen's
vagina and enter the sperm storage tubules.
In view of
the value of genetic models in biological research, the
overall objective of this thesis was to evaluate cPLA2
expression in two family groups of full- and half-sib
roosters that differed in sperm mobility phenotype.
Specifically, expression levels were compared by reverse
17
transcription -polymerase chain reaction (RT-PCR).
Second, the DNA sequences of the calcium binding domains
(C2) were compared.
18
MATERIALS AND METHODS
A total of 18 sexually mature New Hampshire
roosters were used for this project.
Roosters differed
(P < 0.001) in sperm mobility phenotype as measured by
Froman and Feltmann (1998).
In the first experiment, 3
full-sib roosters were used per phenotype.
In the
second experiment, 6 half-sib roosters were used per
phenotype.
All animals were housed in cages and had
free access to food and water.
Roosters were euthanized
by cervical dislocation and immobilized by electrical
shock.
The right testis was exposed.
A 1.6 cm3 section
was aseptically placed in a microcentrifuge tube and
snap frozen in an ethanol/dry ice bath.
stored at -80°C prior to RNA extraction.
Samples were
Total RNA was
isolated from approximately 5 mm3 of testis tissue using
acid guanidinium thiocyanate / phenol/chloroform
extraction as described by Chomczynski and Sacchi
(1987).
RNA was re-solubilized in autoclaved distilled
water and stored at -80°C.
RNA was quantified and
assessed for purity by UV-spectrophotometry.
Reverse transcriptase-polymerase chain reactions
(RT-PCR) were conducted using procedures described by
Arcellano-Panlilio and Schultz (1993) with
modifications.
In the first experiment, cPLA2
expression was compared to
~-actin
and 18S rRNA
19
expression using relative quantitative RT-PCR.
~-actin
compare cPLA2 to
RNA (5
~g
0.5
~g)
To
expression, equivalent total
from each tissue sample was incubated with
oligo (dT)12-18 primers (Gibco BRL, Grand Island,
NY) for 10 min at 70°C in a total volume of 12
the mixture was chilled to 4°C.
~l
and
Four microliters of 5x
first-strand buffer (250 mM Tris-HCL, pH 8.3, 375 mM
KCl, and 15 mM Mg C12), 2
1
~l
~l
0.1 M dithiothreitol (OTT),
10 mM dNTP mix (10 roM for dATP, dGTP, dTTP, and
dCTP), and 1
~l
(200 U) superscript II reverse
transcriptase (Gibco BRL) were added to each tube.
Tubes were incubated at 42°C for 120 min and then
incubated at 95°C for 10 min to inactivate the reverse
transcriptase.
30
~l.
~l
The RT reaction mixture was diluted with
of sterile distilled water to a total volume of 50
To compare cPLA2 expression relative to 18S rRNA,
RT was conducted with 2
(50~i
~l
of random decamer primers
Ambion, Austin, TX) instead of oligo (dT) 12-18
primers.
Incubation temperatures were the same as for
oligo dT priming.
For comparison of cPLA2 to
was conducted using 10
~l
~-actin
expression, PCR
of RT product. The PCR
20
reaction mixture contained 4 U Taq DNA Polymerase
(Promega, Madison, WI) in a total volume of 50
~l
consisting of 2.0
roM
Tris-HCl (pH 8.0), 10.0 roM KCl,
0.01
roM
OTT, 5% (v/v) glycerol, 0.05% (v/v)
roM
EDTA, 0.1
Tween@20, 0.05% (v/v) Nonidet@-40, 2.5 roM MgC12, 0.2
dNTP mix, sterile distilled water, and 2.0
roM
~
oligonucleotide primers specific for cPLA2 or p-actin.
Mineral oil was used to cover each reaction mixture.
For comparing cPLA2 expression relative to 18S rRNA
in the first and second experiment, relative
quantitative PCR was conducted using the QuantumRNAm
18S Internal Standards Kits (Ambion) as per the
manufacturer's instructions.
The 18S rRNA primer:
competimer ratio was 2:8 and 3:7 for quantifying cPLA2
and p-actin expression, respectively.
competimer
technology allows modulation of the efficiency of 18S
rRNA amplification without affecting amplification of
the target gene in multiplex PCR.
The 18S rRNA
competimer primers have modified 3' ends that block
extension by DNA polymerase enabling relative
amplification efficiency of 18S rRNA cDNA to be reduced
without primers being the limiting factor and loss of
relative quantitation.
After 18S rRNA primers and
competimers were added, procedures were the same as for
- - - - - - -
21
the initial part of the first experiment. In the case of
~-actin
expression relative to 18S rRNA in the second
experiment, PCR reactions had to be carried out in
different tubes as single primer reactions instead of
multiplex primer reactions, due to unpredicted
interactions between
~-actin
and 18S rRNA primers
producing unexpected bands.
Target cDNAs were amplified by PCR using the
following conditions: (1) an initial 4-min incubation at
94°C, (2) 35 cycles of denaturation (1 min at 94°C),
annealing (2 min at 57°C) and extension (2 min at 72°C)
and (3) incubation at 72°C for 7 min. Thirty-five cycles
were determined experimentally as optimal for both cPLA2
and
~-actin
conditions.
The negative control contained
water in place of RT product.
Primers used in
amplification were designed from published chicken cPLA2
and mouse p-actin sequences (Table 2).
Primer pairs
were synthesized by the Oregon state University Center
for Gene Research and Biotechnology Central services
Laboratory.
PCR products were resolved on 2% (w/v) and
3% (w/v) agarose gels containing 0.5
~g/ml
ethidium
bromide for cPLA2 and actin and for cPLA2 and 18S rRNA,
respectively.
Table 2
Primer
name
PCR primer sequences for cPLA2 and p-actin.
Primer sequence
PCR
fragment
size (bp)
PCR fragment
position
5' primer=
352
175-526 of
chicken cDNA
Reference l
Nalefske et
al.
(1994)
CCTTATCAACACATTGTGGTGG (22 nt)
3' primer=
TTAACTGGACCTCCTTCTTCTCTC (24 nt)
~-actin
243
5' primer=
CGTGGGCCCTAGGCACCA
(18nt)
3' primer=
TTGGCCTTAGGGTTCAGGGGGG
1
(22nt)
See Reference section for full citation
181-424 of
mouse cDNA
Tokunaga et
al.
(1986)
23
Gels were photographed with a MP-40 Polaroid Land
camera and positive/negative film (Polaroid 665).
was exposed under UV light for 90 s.
Film
Negatives were
processed according to the product insert.
The negative
was soaked for 30 to 60 s in a sodium sulfite clearing
solution followed by a wash under cold running water for
5 min.
The negative was then dipped in 2% (v/v)
PhotoFlo and air dried. The intensity and area of each
amplified signal or band on the photographic negative
was computed by scanning and computing densitometry
(Hoefer GS-300 Scanning Densitometer and GS-350h Data
System). cPLA2 amounts were expressed relative to
actin or 18S rRNA, and
~-actin
~-
amounts were expressed
relative to 18S rRNA.
Linearity of the relationship between densitometric
area and ng of DNA was validated using correlation
regression analysis.
Densitometric areas were plotted
against four concentrations of DNA for DNA sizes of 100,
200, 500, 700, and 1,000 base pairs (bp) (Mass Ruler,
Bio-Rad Laboratories, Hercules, CAl.
Correlation
coefficients for densitometric area by DNA bp size and
densitometric area by concentration of DNA were greater
than r
= 0.94 for areas ranging from 400-6800 relative
densitometric units.
24
PCR products of cPLA2 and
~-actin
were extracted
using the QIA quick1M PCR Purification Kit (Quiagen,
Valencia, CA) as per the manufacturer's instructions.
Extracted PCR products were analyzed for purity and
concentration by UV-spectrophotometry, and sequenced at
the Oregon state University center for Gene Research and
Biotechnology Central Services Laboratory.
cPLA2 and
actin expression in testes was evaluated by one-way
ANOVA where phenotype was the major effect.
All
analyses were performed using the NCSS statistical
software program (Number Cruncher, Version 2000).
~­
25
RESULTS
RT-PCR amplified a 352 bp nucleotide fragment for
cPLA2.
Comparison of the chicken cPLA2 fragment to
published sequences showed sequence similarity of 100%,
77.3% and 76.9% for chicken, human and mouse cDNA,
respectively (FASTA search; Pearson and Lipman, 1988).
Testicular cPLA2 mRNA expression was compared against
~­
actin expression between high and low sperm mobility
phenotypes using full-sib roosters (n=3 roosters per
phenotype) in a preliminary experiment.
Four different
RT-PCR were performed to analyze expression levels
(Figure 1).
The average cPLA2 :
~-actin
ratio in the
high sperm mobility phenotype was 0.63 ± 0.260 (mean ±
SEM; Table 3).
This value was approximately twofold
greater than the average cPLA2 :
~-actin
ratio from the
low sperm mobility phenotype, which was 0.32 ± 0.123 (P
< 0.05).
The same six males were used to compare the cPLA2
expression relative to 18S rRNA (Ambion, Austin, TX)
levels in four replicate multiplex RT-PCR experiments
(Figure 2).
The average cPLA2 : 18S ratio for high
sperm mobility was 0.74 ± 0.158, and the average for low
sperm mobility was 0.38 ± 0.135 (Table 3).
Once again
the average cPLA2 expression within testes of high sperm
26
Figure 1 Testicular ~-actin and cPLA 2 expression in
roosters with high or low sperm mobility phenotypes .
Lanes 1 - 7 are ~-actin, and lanes 9- 15 are cPLA 2 • Lanes
1 and 9 are the negative controls. Lane 8 is the DNA
ladder.
Lanes 2,4,5,10,12, and 13 represent low sperm
mobility phenotypes, and lanes 3, 6, 7, 11 , 14, and 15
represent high sperm mobility phenotypes.
234
5
6
7
8
9
10
11
12
13
14
15
__ 352 bp
-243 bp
Figure 2 Testicular cPLA2 and 18S rRNA expression in
roosters with high or low sperm mobility phenotypes.
The top bands are cPLA 2 and the bottom bands are 18S
rRNA.
Lane 1 is the DNA ladder. Lane 2 is the negative
control.
Lanes 4 , 7, and 8 represent low sperm mobility
phenotypes, and lanes 3, 5 and 6 represent high sperm
mobility phenotypes .
2
4
5
6
7
8
/352 bp
-324 bp
Table 3 cPLA2 mRNA expression between sets of full-sib roosters representing two
sperm mobility phenotypes.
Sperm mobility
phenotypes
Roosters per
phenotype (n)
Low
3
0.32 ± 0.123 A
0.38 ± 0.135 C
0.56 ± 0.151
High
3
0.63 ± 0.260 B
0.74 ± 0.158 0
0.59 ± 0.0949
p-actin
AB means within a column differ (P < 0.05).
co means within a column differ (P < 0.0057).
18S
p-actin
18S
28
mobility roosters was approximately twofold greater
compared to that observed with the low sperm mobility
phenotype (P < 0.0057).
~-actin
expression relative to 18S rRNA was
evaluated between high and low sperm mobility phenotypes
(n=3 full-sibs per phenotype) in four replicate single
primer RT-PCR experiments (Figure 3).
significant difference in
~-actin
There was no
expression between
high and low phenotypes (P > 0.63; Table 3).
In a subsequent experiment, 12 additional males
(half-sib roosters; n=6 per phenotype) were used to
further compare CPLA2 expression in high and low sperm
mobility phenotypes relative to 18S rRNA in three
replicate multiplex RT-PCR experiments. Ratios were 0.74
± 0.141 and 0.49 ± 0.104 for the high and low
phenotypes, respectively.
comparable to the previous
experiment, there was a significant difference in cPLA2
expression between high and low sperm mobility
phenotypes (P < 0.023).
Based upon pooled data, i.e. 9
males per phenotype, cPLA2 was expressed to a greater
extent within testes of roosters from the high sperm
mobility phenotype (P < 0.00022).
sequence analysis
failed to detect any differences in the cPLA2 nucleotide
sequence (nt 175-526) between high and low sperm
mobility phenotypes.
29
Figure 3 Testicular p-actin and 18S rRNA expression in
roosters with high or low sperm mobility phenotypes .
Lanes 1-7 are p-actin, and lanes 9-15 are 18S rRNA .
Lanes 1 and 9 are the negative controls. Lane 8 is the
DNA ladder. Lanes 2, 4, 5 , 10, 12 and 13 represent low
sperm mobility phenotypes, and lanes 3, 6, 7, 11, 14, 15
represent high sperm mobility phenotypes.
2
3
4
5
6
7
8
9
10
11
12
13
14
15
324 bp
243 bp
30
Table 4 cPLA2 mRNA expression between sets of half-sib
roosters representing two sperm mobility phenotypes.
Sperm mobility
phenotypes
Roosters per
phenotype (n)
cPLA2 : 18S
Low
6
0.49 ± 0.104 A
High
6
0.74
AB
± 0.141 B
means within a column differed (P < 0.00022).
31
DISCUSSION
The primary objective of this research was to
compare the levels of cPLA2 mRNA between high and low
sperm mobility phenotypes.
The secondary objective was
to compare nucleotide sequences from a region containing
the calcium binding domain.
Previous experiments had
shown that extracellular ca 2+ was essential for
maintenance of fowl sperm motility at body temperature
(Froman, unpublished data).
Likewise, sperm from high
sperm mobility males exhibited higher ATP content and
oxygen consumption compared to sperm from average sperm
mobility males (Froman and Feltmann, 1998; Froman et
al., 1999).
In this regard, it was noteworthy that
sperm were found to contain long-chain acyl carnitine
(Froman et al., 1999), and arachidonyltrifluoromethyl
ketone (a PLA2 inhibitor) arrested motility within
minutes (Froman, unpublished data). Moreover, ca 2+ is
known to modulate PLA2 activity.
Thus, PLA2 activity
seemed to be critical for the maintenance of motility at
body temperature.
Roosters differ in the extent to
which their sperm are motile, and as a consequence,
roosters differ with respect to sperm mobility, i.e. the
extent to which a population of sperm move.
cPLA2 is
the one type of PLA2 known to be transcriptionally
regulated (Miguel et al., 1999). Therefore, the
32
following argument was made: if a difference in cPLA2
expression could be observed between sperm mobility
phenotypes, then the gene encoding cPLA2 may influence
the expression of sperm mobility phenotype.
The hypothesis was tested using RT-PCR.
Expression
of p-actin and 18S rRNA were used as internal standards.
RT-PCR is considered to be a sensitive and powerful tool
for analyzing gene expression (Freeman et al., 1999).
p-actin was one of the first RNAs to be used as an
internal control because it is considered to reflect the
expression of a house-keeping gene.
Typically, p-actin
mRNA is expressed at moderately abundant levels.
However, the use of p-actin mRNA as an internal control
has been questioned recently because expression levels
have been shown to vary in some tissues (Ambion
technical bulletin 151).
In order to eliminate the possibility of anomalous
p-actin expression and to test whether p-actin
expression was comparable between high and low sperm
mobility phenotypes, an 18S rRNA internal standard was
used.
rRNAs are continually expressed at constant rates
even under conditions where mRNA transcription is
altered because rRNAs are transcribed by a distinct
polymerase (Ambion technical bulletin 151).
Ambion's
Competimer technology attenuates 18S rRNA amplification
33
at different levels depending on the expression level of
the researcher's gene of interest.
This attenuation
allows the accumulation and detection of both 18S rRNA
and target mRNA at the same time.
The QuantumRNA™ 18S
Internal Standards Kit provides an effective method to
perform relative quantitative RT-PCR. This method still
does not eliminate the possibilities of tube-to-tube
variations in RT-PCR efficiencies, thus it cannot be
used as an absolute quantitative RT-PCR (Death et al.,
1999).
For the absolute quantitative RT-PCR, homologous
synthetic external RNA standards are used to eliminate
the possibility of tube-to-tube variations in RT-PCR
reactions by allowing primers and enzymes to compete
(Death et al., 1999).
Yanagisawa (1967) associated sperm motility with
intracellular ATP and creatine phosphate in sea urchin
sperm.
Subsequently, Mohri (1976) suggested that there
was an ATP transporting system using creatine phosphate
for the dynein ATPase, which is involved in the
flagellar movement of the sperm axoneme.
Mita and Ueta
(1988) showed decreased phosphatidylcholine (PC) content
after sea urchin sperm were activated by dilution with
sea water, leading to the conclusion that PC was an
endogenous sUbstrate.
Later, Mita and Ueta (1990)
attributed PC hydrolysis to PLA2.
Thus, PLA2 was
proposed to be a key enzyme involved with energy
production in sea urchin sperm.
Based upon the role of
PLA2 in sea urchin sperm and the effect of a specific
PLA2 inhibitor on fowl sperm motility, it seemed
plausible that PLA2 was critical to energy production in
fowl sperm.
Therefore, it was postulated that a higher
expression level of cPLA2 mRNA might account for
phenotypic differences in sperm mobility.
The high sperm mobility phenotype showed greater
expression of cPLA2 mRNA relative to both
~-actin
mRNA
and 18S rRNA internal standards than the low mobility
phenotype.
Moreover,
~-actin
was shown to be expressed
at comparable levels between high and low sperm mobility
phenotypes.
Furthermore, there were no differences in
the nucleotide sequences that span the calcium binding
domain between high and low sperm mobility phenotypes.
Therefore, these experiments demonstrated that testes of
high sperm mobility males expressed more cPLA2 than did
their low mobility counterparts.
While the basis for
this difference is unknown, it would help explain
phenotypic differences if varying amounts of PLA2 were
found in sperm from different males in a population.
Whether or not high sperm mobility phenotypes have
higher cPLA2 activity needs to be examined.
-
Likewise,
there may be some transcription factors that are
responsible for transcribing message at different rates.
35
Ets-2 is responsible for up-regulation of the PLA2
activating protein (PLAA) gene in mice and humans
(Beatty et al., 1999).
PLAA activates sPLA2 activity.
There may be a similar pathway for cPLA2.
Therefore,
discovering the transcriptional control responsible for
up-regulating cPLA2 mRNA may be critical to further
understand the genetic difference between these
phenotypes.
36
REFERENCES Ackerman EA, and Dennis EA. Mammalian calcium­
independent phospholipase A2. Biochem Biophys Acta.
1995; 1259:125-136.
Allen TE, and Grigg GW.
Australian J Agric Res.
Sperm transport in the fowl.
1957; 8:788-799.
Ambion Technical Bulletin 151. Use of internal and
external standards or reference RNAs for accurate
quantitation of RNA levels. Ambion TechNotes
Newsletter. 2000; 6(5):13.
Arenas MI, Bethencourt FR, De Miguel MP, Fraile B, Romo
E, and Paniagua R. Immunocytochemical and quantitative
study of actin, desmin and vimentin in the peritubular
cells of the testes from elderly men. J Reprod Fertil.
1997; 110:183-193.
Arcellana-Panlilio MY, and Schultz GA. Analysis of
messenger RNA. In: Guide to Techniques in Mouse
Development. Methods of Enzymology (Eds. Wassarman PM,
Depamphilis ML), New York: Academic Press. 1993;
225:303-328.
Ashizawa K, and Sano R. Effects of temperature on the
immobilization and the initiation of motility of
spermatozoa in the male reproductive tract of the
domestic fowl, Gallus domesticus. Comp Biochem Physiol.
1990; 96A:297-301.
Bakst MR, Wishart G, and Brillard J-P. Oviducal sperm
selection, transport, and storage in poultry. poultry
Sci Rev. 1994; 5:117-143.
Balboa MA, Balsinde J, Winstead MV, Tischfield JA, and
Dennis EA. Novel group V phospholipase A2. J BioI
Chem. 1996; 271:32381-32384.
Balsinde J, Balboa MA, and Dennis EA. Functional
coupling between secretory phospholipase A2 and
cyclooxygenase-2 and its regulation by cytosolic group
IV phospholipase A2. Proc Natl Acad Sci USA.
1998;
95:7951-7956.
Balsinde J, and Dennis EA. Distinct roles in signal
transduction for each of the phospholipase A2 enzymes
present in P388D macrophages. J BioI Chem. 1996;
271:6758-6765.
37
Balsinde J, and Dennis EA. Function and inhibition of
intracellular calcium-independent phospholipase A2. J
BioI chem. 1997; 272:16069-16072.
Balsinde J, Bianco ID, Ackermann EJ, Conde-Frieboes K,
and Dennis EA. Inhibition of calcium-independent
phospholipase A2 prevents arachidonic acid incorporation
and phospholipid remodeling in P388D1 macrophages. Proc
Natl Acad Sci USA. 1995; 92:8527-8531.
Balsinde J, Maria A, Balboa PA, Dennis I, and Dennis EA.
Regulation and Inhibition of phospholipase A2. Annu Rev
Pharmacol Toxicol. 1999; 39:175-189.
Bartoli F, Lin HI, Ghomashchi F, Gelb MH, Jain MK, and
Apitz-Castro R. Tight binding inhibitors of 85-kDa
phospholipase A2, but not 14-kDa phospholipase A2
inhibit release of free arachidonate in thrombin
stimulated human platelets. J BioI Chem. 1994;
269:15625-15630.
Beatty BG, Qi S, Pienkowska M, Herbrick J, Scheidl T,
Zhang ZM, Kola I, Scherer SW, and Seth A. Chromosomal
localization of phospholipase A2 activating protein, an
Ets2 target gene, to 9p21. Gen. 1999; 62:529-532.
Birkhead TR, Martinez JG, Burke T and Froman OP. Sperm
mobility determines the outcome of sperm competition in
the domestic fowl. Proc R Soc Lond B. 1999; 266:1759­
1764.
Borsch-Haubold AG. Regulation of cytosolic PLA2 by
phosphorylation. Biochem Soc Trans. 1998; 26:350-354.
Chen J, Engle SJ, Seilhamer JJ, and Tischfield JA.
Cloning and recombinant expression of a novel human low
molecular weight Ca+ dependent phospholipase A2. J BioI
Chem. 1994; 269:2365-2368.
chomczynski P, and Sacchi N. single step method of RNA
isolation by guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem. 1987; 162:156-159.
Clark JO, Schievella AR, Nalefski EA, and Lin LL.
Cytosolic phospholipase A2. J Lipid Mediat. Cell
signal. 1995; 12:83-117.
Cupillard L, Koumanov K, Mattei MG, Lazdunski M, and
Lambeau G. Cloning, chromosomal mapping, and expression
of a novel human secretory phospholipase A2' J BioI
Chem. 1997; 272:15745-15752.
38
Death AK, Yue DK, and Turtle JR. Competitive RT-PCR for
measuring metalloproteinase gene expression in human
mesangial cells exposed to a hyperglycemic environment.
BioTechniques. 1999; 27:512-520.
Dennis EA. Diversity of group types, regulation, and
function of phospholipase A2. J BioI Chem. 1994;
269:13057-13060.
Dennis EA. The growing phospholipase A2 superfamily of
signal transduction enzymes. Trends Biochem Sci. 1997;
22:1-2.
Dessen A. Phospholipase A2 enzymes: structural
diversity in lipid messenger metabolism. Structure.
2000; 8:R15-22.
Dessen A, Tang J, Schmidt JTH, Stahl M, Clark JD, Seehra
J, and Somers WS. Cell. 1999; 97:439-360.
Freeman WM, Walker SJ, and Vrana KE. Quantitative RT­
PCR: pitfalls and potential. BioTechniques. 1999;
26:112-125.
Froman DP., personal communication, July 21, 2000.
Froman DP, and Feltmann AJ. Sperm mobility: a
quantitative trait of the domestic fowl (Gallus
domesticus). BioI Reprod. 1998; 58:379-384.
Froman DP, and Feltmann AJ. Sperm mobility: phenotype
in roosters (Gallus domesticus) determined by
concentration of motile sperm and straight line
velocity. BioI Reprod. 2000; 62:303-309.
Froman DP, Feltmann AJ, Rhoads ML, and Kirby JD. Sperm
mobility: a primary determinant of fertility in the
domestic fowl (Gallus domesticus). BioI Reprod. 1999;
61:400-405.
Kramer RM, Robers EF, Um SL, Borsch-Haubold AG, Watson
SP, Fisher MJ, and Jakubowski JA. P38 mitogen-activated
protein kinase phosphorylates cytosolic phospholipase A2
(CPLA2) I thrombin-stimulated platelets. J BioI Chem.
1996; 271:27723-27729.
Kramer RM, Roberts EF, Manetta J, and Putnam JE. The
Ca 2+-sensitive cytosolic phospholipase A2 is a 100-kDa
protein in human monoblast U937cells. J BioI Chem.
1991; 266:5268-5272.
39
Leslie CC. Properties and regulation of cytosolic
phospholipase A2. J BioI Chem. 1997; 272:16709-16712.
Lin LL, Lin AY, and DeWitt DL. Interleukin-1a induces
the accumulation of cytosolic phospholipase A2 and the
release of prostaglandin E2 in human fibroblasts. J
Biol Chem. 1992; 267:23451-23454.
Miguel A, Leslie G, and Leslie CC. Regulation of
arachidonic acid release and cytosolic phospholipase A2
activation. J Leukoc BioI. 1999; 65:330-336.
Mita M, and Ueta N. Energy metabolism of sea urchin
spermatozoa, with phosphatidylcholine as the preferred
substrate. Biochem Biophys Acta. 1988; 959:361-369.
Mita M, and Ueta N. Phosphatidylcholine metabolism for
energy production in sea urchin spermatozoa. Biochem
Biophys Acta. 1990; 1047:175-179.
Mohri H. Tubulin-dynein system in cell motility I.
Zool Mag. 1976; 85:1-16.
Mosior M, six DA, and Dennis EA. Group IV cytosolic
phospholipase A2 binds with high affinity and
specificity to phosphatidylinositol 4,5 bisphosphase
resulting in dramatic increases in activity. J BioI
Chem. 1998; 273:2184-2191.
Murakami M, Shimbara S, Kambe T, Kuwata H, Winstead MV,
Tischfield JA, and Kudo I. The function of five
distinct mammalian phospholipases A2 in regulating
arachidonic acid release. J BioI Chem. 1998;
273:14411-14423.
Nalefski EA, Sultzman LA, Martin DM, Kriz RW, Towler PS,
Knopf JL, and Clark JD. Delineation of two functionally
distinct domains of cytosolic phospholipase A2, a
re~ulatory ca2+-dependent lipid-binding domain and a
Ca +-independent catalytic domain. J BioI Chem. 1994;
269:18239-18249.
Okamura F, and Nishiyama H. The passage of spermatozoa
through the vitelline membrane in the domestic fowl,
Gallus gallus. Cell Tiss Res. 1978; 188:497-508.
Pickard RT, Chiou XG, Strifler BA, DeFelippis MR, Hyslop
PA, Tebbe AL, Yee YK, Reynolds LJ, Dennis EA, Kramer RM,
and Sharp JD. Identification of essential residues for
the catalytic function of 85-kDa cytosolic phospholipase
A2. J BioI Chem. 1996; 271:19225-19231.
40
Pizzari and Froman DP., personal communication, February
21, 2000.
Qui ZH, Gijon MA, de Carvalho MS, Spencer OM, and Leslie
CC. The role of calcium and phosphorylation of
cytosolic phospholipase A2 in regulating arachidonic
acid release in macrophages. J BioI Chem. 1998;
273:8203-8211.
Reynolds LJ, Hughes LL, Louis AI, Kramer RM, and Dennis
EA. Metal ion and salt effects on the phospholipase A2,
lysophospholipase and transacylase activities of human
cytosolic PLA2' Biochim Biophys Acta.
1993; 1167:272­
280
Schievella AR, Regier MK, smith WL, and Lin LL.
Calcium-mediated translocation of cytosolic
phospholipase A2 to the nuclear envelope and endoplasmic
reticulum. J BioI Chem. 1995; 270:30749-30754.
Syrbu SI, Waterman WH, Molski TFP, Nagarkatti 0, Hajjar
JJ, and Sha'afi, RI. Phosphorylation of cytosolic
phospholipase A2 and the release of arachidonic acid in
human neutrophils. J Immunol. 1999; 162:2334-2340.
Tang J, Kriz RW, Wolfman N, Shaffer M, Seehra J, and
Jones SSe A novel cytosolic calcium-independent
phospholipase A2 contains eight ankyrin motifs. J BioI
Chem. 1997; 272:8567-8575.
Tokunaga K, Taniguchi H, Yoda K, Shimizu M, and Sakiyama
S. Nucleotide sequence of a full-length cDNA for mouse
cytoskeletal p-actin mRNA. Nucl Acids Res. 1986;
14:2829.
Vadas P, Browining J, Edelson J, and Pruzanski W.
Extracellular phospholipase A2 expression and
inflammation: the relationship with associated disease
states. J Lipid Mediators. 1993; 8:1-30.
41
APPENDIX 42
APPENDIX
The acid guanidinium - phenol - choloroform method
(Chomczynski and Sacchi, 1987), was used to extract RNA
from chicken testis and liver with a slight
modification.
Once excised, tissue samples were placed
within 1.6 ml microcentrifuge tubes and immediately
frozen in a dry ice / ethanol bath.
After partial
thawing, each tissue was cut into pieces approximately
5mm3 in size, and these smaller pieces were placed into
a sterile tube (12 x 75 mm) containing 1 ml of the
denaturing solution (Solution D) containing
250 g
guanidinium thiocyanate (Ambion, Austin, TX), 293 ml
distilled water (dH20), 1.76 ml of 0.75 N sodium
citrate, 26.4 ml 10% N-lauryl sarcosine (Sigma, st.
Louis, MO) and 0.36 ml p-mercaptoethanol (Sigma).
Tissues were homogenized with a hand-held homogenizer
(TissueoTearor™ Model 985-370; Biospec Products,
Bartlesville, OK).
The homogenizer was rinsed
thoroughly after each homogenation.
Each homogenate was
transferred to a 17 x 100 mm sterile polypropylene tube.
RNA extraction was carried out by sequentially adding
100
~l
2 M sodium acetate (pH 4), 1 ml water-saturated
phenol (pH 4.5; Ambion), and 200
alcohol mixture (49:1).
~l
chloroform: isoamyl
The homogenate was vortexed,
43
and then placed on ice for 15 minutes.
The chilled
mixture was centrifuged at 10,000 x g for 20 min at room
temperature to generate 3 layers.
The aqueous
supernatant contained RNA, whereas the middle and bottom
layers contained protein and DNA, respectively.
The
aqueous phase was removed, placed in a 1.6 ml sterile
microcentrifuge tube, and followed by another
centrifugation at 14,000 x g for 5 min to sediment
residual protein and DNA.
RNA precipitation from
testicular tissue was carried out by adding 1 ml
isopropanol to the second aqueous layer from each
microcentrifuge tube.
Precipitation of RNA from liver,
because of the high glycogen content, was performed by
adding 3 ml of 4M sodium acetate (pH 7).
Tubes were
stored overnight at -20°C and centrifuged at 14,000 x g
for 20 min at room temperature.
resuspended in 300
with 300
~l
~l
Each RNA pellet was
Solution D and re-precipitated
isopropanol.
Re-precipitated RNA was stored
at -20°C for 2 - 3 h and centrifuged at 14,000 x g for
10 min at room temperature.
Each supernatant was
carefully aspirated with filtered tips (USA Scientific,
Ocala, FL) attached to a P-200 Pipetman (Rainin,
Emeryville, CAl.
Each pellet was washed with 500
ice-cold ethanol and centrifuged for 2 min.
~l
75%
The wash
with ice-cold ethanol was repeated, and the precipitate
44
was dried for 2 h at room temperature.
Each RNA pellet
was analyzed for moisture content with a microscope (20
x).
Each pellet was then solubilized in 50
~l
of
autoclaved distilled water by heating for 10 min at
65°C.
RNA was quantified and evaluated for purity using
UV-spectrophotometry.
The ratio of two wavelengths 260
nm (RNA) and 280 nm (protein), was used for estimating
purity and absorbance at 260 nm was used to determine
RNA concentration.