Developmental Biology 220, 379 –391 (2000)
doi:10.1006/dbio.2000.9634, available online at http://www.idealibrary.com on
Identification of Endogenous Retinoids, Enzymes,
Binding Proteins, and Receptors during Early
Postimplantation Development in Mouse:
Important Role of Retinal Dehydrogenase Type 2
in Synthesis of All-trans-Retinoic Acid
Stine M. Ulven,* ,1 Thomas E. Gundersen,* ,1 Mina S. Weedon,*
Vibeke Ø. Landaas,* Amrit K. Sakhi,* Sigurd H. Fromm,†
Benedicto A. Geronimo,† Jan O. Moskaug,* and Rune Blomhoff* ,2
*Institute for Nutrition Research, University of Oslo, P.O. Box 1046, Blindern, 0316
Oslo, Norway; and †Laboratory for Molecular Embryology, University of Oslo,
P.O. Box 1052, Blindern, 0316 Oslo, Norway
Specific combinations of nuclear retinoid receptors acting as ligand-inducible transcription factors mediate the essential role
of retinoids in embryonic development. Whereas some data exist on the expression of these receptors during early
postimplantation development in mouse, little is known about the enzymes controlling the production of active ligands for
the retinoid receptors. Furthermore, at early stages of mouse development virtually no data are available on the presence of
endogenous retinoids. In the present study we have used a recently developed high-performance liquid chromatographic
(HPLC) technique to identify endogenous retinoids in mouse embryos down to the egg cylinder stage. All-trans-retinoic
acid, a ligand for the retinoic acid receptors, was detected in embryos dissected as early as 7.5 dpc (i.e., a combination of
midstreak until late allantoic bud stage embryos). At these stages, we detected mRNA coding for all the retinoid receptors,
retinoid binding proteins, and two enzymes able to convert retinol to retinal (retinol dehydrogenase 5 (RDH5) and alcohol
dehydrogenase 4 (ADH4)). We also detected retinal dehydrogenase type 2 (RALDH2), an enzyme capable of oxidising the
final step in the all-trans-retinoic acid synthesis. In egg cylinder stage mouse embryos no all-trans-retinoic acid was
detected. However, at this stage its precursor all-trans-retinal was present. In accordance with these HPLC observations,
RDH5 and ADH4 were expressed, but no transcripts coding for enzymes that oxidise retinal to retinoic acid. Therefore, our
results suggest that RALDH2 is a key regulator in initiating retinoic acid synthesis sometime between the mid-primitive
streak stage and the late allantoic bud stage in mouse embryos. © 2000 Academic Press
Key Words: vitamin A; retinoids; retinoic acid; mouse embryos; retinal dehydrogenase type 2.
INTRODUCTION
A large number of knockout studies of retinoid (vitamin
A) receptors and retinoic acid-synthesising enzymes have
demonstrated that retinoids are essential for normal embryonic development (Kastner et al., 1997a,b; Wendling et al.,
1999; Niederreither et al., 1999). However, the exact devel1
These authors contributed equally to this work.
To whom correspondence should be addressed. Fax: ⫹47 22 85
13 96. E-mail: rune.blomhoff@basalmed.uio.no.
2
0012-1606/00 $35.00
Copyright © 2000 by Academic Press
All rights of reproduction in any form reserved.
opmental processes in which retinoids are essential have
not been elucidated in detail. This is particularly true for
the early postimplantation stages, although data suggest
that retinoids may have a function during gastrulation (Ang
et al., 1996).
The different stages of the early postimplantation embryo
are defined by the appearance of various markers. The
pre-primitive streak stage embryo is often called the egg
cylinder stage embryo. This is the predominant embryonic
stage when dissecting mouse embryos at 6.5 dpc. At the
advanced egg cylinder stage the embryo consists of a dis-
379
380
Ulven et al.
tinct embryonic and extraembryonic ectoderm (Fig. 1A).
The primitive streak stages (most prominent at 7.0 –7.75
dpc) include embryos of three stages (Fig. 1B), the early
streak embryo, the midstreak embryo, and the late streak
embryo, mainly defined by the length of the primitive
streak and the spreading of the mesoderm layer. In late
streak embryo, the anterior end of the primitive streak
condenses into the “node.”
The neural plate stages (Fig. 1C) (most prominent at
7.5–7.75 dpc) are divided into the no-allantoic-bud stage,
early allantoic bud stage, and late allantoic bud stage. In the
no-allantoic-bud stage embryo the posterior amniotic fold
has fused with the anterior amniotic fold to make the
amnion and the head process is visible and there is evidence
of neural groove formation. In the late allantoic bud stage
embryo the length of the bud is increased and the embryo is
becoming wider than it is long. The headfold stage (Fig. 1D)
(most prominent at 8.0 dpc) is divided into the early
headfold stage and the late headfold stage, in which the
headfolds are well defined, the neural groove is present in
the anterior midline of the embryo, and the foregut pocket
is forming just below the headfolds.
Retinoid signalling during embryonic development is
dependent on the presence of retinoic acid receptors (RAR)
and retinoid X receptors (RXR) and their endogenous ligands (Chambon, 1994; Mangelsdorf and Evans, 1995; Mangelsdorf et al., 1995). Members of the RAR family are
activated by a number of physiologically occurring retinoids, including all-trans-retinoic acid (at-RA), 9-cis-retinoic
acid (9c-RA), all-trans-4-oxoretinoic acid, all-trans-4oxoretinal,
all-trans-4-oxoretinol,
and
all-trans-3,4didehydroretinoic acid (at-3,4-dd-RA). Members of the RXR
family are efficiently activated by 9c-RA, 9-cis-3,4didehydroretinoic acid, and 9-cis-4-oxoretinoic acid (Chambon, 1994, 1996; Mangelsdorf and Evans, 1995; Mangelsdorf
et al., 1995). The ligands are usually synthesised in vivo by
a complex metabolic system involving numerous enzymes
and binding proteins (Blomhoff, 1994).
The synthesis of at-RA from all-trans-retinol (at-ROH) is
a two-step reaction, involving several enzymes. The ratelimiting step in the synthesis of RA is the oxidation of ROH
to RAL, in which two classes of enzymes are involved. One
class comprises the classical cytosolic medium-chain alcohol dehydrogenases (ADH) (Duester, 1996) and consists of
many members, but only the mouse alcohol dehydrogenase
class I and class IV genes (ADH1 and ADH4) are good
candidates for ROH oxidation. ADH1 and ADH4 are both
efficient in the oxidation of at-ROH to at-RAL (Boleda et al.,
1993; Han et al., 1998), while only ADH4 is efficient in the
oxidation of 9c-ROH (Allali-Hassani et al., 1998). Another
class comprises the microsomal members of the shortchain alcohol dehydrogenase/reductase superfamily (SDR).
Several retinol dehydrogenases of the SDR family are able
to oxidise at-ROH but not 9c-ROH (Chai et al., 1995a,b,
1996), whereas some are specific for 9c-ROH and 11c-ROH
(Simon et al., 1995; Mertz et al., 1997; Romert et al., 1998).
These latter three enzymes are all homologues (Driessen et
al., 1998) called retinol dehydrogenase 5 (RDH5) (Wang et
al., 1999). The relative roles of the different enzymes in
ROH oxidation during embryonic development are still
unknown.
The final step in the enzymatic generation of RA is the
oxidation of RAL to RA. This step can be mediated by two
types of enzymes, aldehyde dehydrogenases and xanthine
oxidases (XOX) (Ang and Duester, 1999; Zhao et al., 1996;
Niederreither et al., 1997; Lee et al., 1991). The main
RA-generating aldehyde dehydrogenases are the retinal dehydrogenase type 2 (RALDH2) and the class 1 aldehyde
dehydrogenase (ALDH1), both of which are members of the
aldehyde dehydrogenase family.
In tissues retinoids are most often bound to specific
proteins. Four cytoplasmic binding proteins specific for
retinol and retinoic acid have been identified (Blomhoff et
al., 1990): cellular retinol binding protein (CRBP) types I
and II and cellular retinoic acid binding protein (CRABP)
types I and II (Wolf, 1991). All show a high degree of
homology (Ong, 1984; Giguere et al., 1990; Chytil and Ong,
1984) and belong to a protein family that also includes
protein P2, fatty acid binding protein (Z protein), intestinal
fatty acid binding protein, and mammary-derived growth
inhibitor (Chytil and Ong, 1984).
A large number of studies have tested the effects of
exogenous retinoids on different vertebrate embryos and
suggested possible normal functions of vitamin A (Pijnappel
et al., 1993; Wagner et al., 1990; Thaller and Eichele, 1990;
Durston et al., 1989; Ruiz and Jessell, 1991). The validity of
these suggestions depends, however, upon whether retinoids are endogenously present in the vertebrate embryo. To
confirm the presence of retinoids in embryos, mainly three
different approaches have been utilised.
First, high-performance liquid chromatography (HPLC)
has been used to chemically identify the various retinoids
present. This technique has the potential of unequivocal
identification of various retinoids and their absolute
amounts. One limitation with HPLC is that when analysing embryos during early postimplantation development
the available amount of tissue is often below what is needed
to exceed detection limits. Studies of stages preceding
neurulation have been done with animal models in which
the collection of tissue is not a limiting factor, e.g., zebrafish (Costaridis et al., 1996) and Xenopus (Blumberg et
al., 1996; Azuma et al., 1990). During mouse development
no HPLC data are available prior to 9.0 dpc. Horton and
Maden (1995) analysed endogenous retinoids in mouse
embryos (9 –14 dpc) by HPLC. They detected two retinoids,
at-RA and at-ROH, with at-ROH in 5- to 10-fold excess over
at-RA. They did not detect 9c-RA or any dd-retinoids.
Second, bioassays have been developed that measure the
presence of a substance that is able to enhance expression
from a reporter regulated by a RA-response element in F9
reporter cells (Wagner et al., 1992; Maden et al., 1998). As
F9 cells are capable of converting precursors such as ROH
and RAL to various ligands for the retinoid receptors, such
a bioassay is not designed to identify specific retinoids.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
Retinoid Signaling in Mouse Embryos
381
FIG. 1. Schematic presentation of early postimplantation development. The staging criteria are a modification of Downs and Davies (1993)
and Kaufman (1992). (A) The pre-primitive streak embryo is called the egg cylinder stage. At the advanced egg cylinder stage the embryo
consists of a distinct embryonic and extraembryonic ectoderm, the visceral endoderm, and a proamniotic cavity. (B) In the early streak
embryo the mesoderm starts to form at the posterior end of the embryonic ectoderm. The mesoderm is visible in a dissecting microscope
up to 50% of the length of the posterior side. In midstreak embryos the length of the primitive streak is between 50 and 100% of the length
of the posterior side. The mesoderm layer is also spread laterally to the midline. In late streak embryos, the anterior end of the primitive
streak condenses into the “node.” The posterior amniotic fold is visible. (C) In no-allantoic-bud stage embryos the posterior amniotic fold
has fused with the anterior amniotic fold to make the amnion. Two other cavities are also visible, the exocoelomic cavity and the
ectoplacental cavity. The head process is visible and there is evidence of neural groove formation in the distal half of the embryonic portion
of the egg cylinder. In early allantoic bud embryos, a small allantoic bud is present and the node appears as a “knot” at the distal tip. The
head process is still visible and extended anteriorly. In late allantoic bud stage embryos the length of the bud is increased and projected into
the exocoelomic cavity. The head process is no longer distinct. An obvious neural groove is visible. The embryo is becoming wider than
it is long. (D) In the early headfold stage the allantois is projecting into the exocoelomic cavity. The anterior ectoderm is thickened, and
the neural groove is distinct. Late headfold embryos have well-defined headfolds, the neural groove is present in the anterior midline of the
embryo, and the foregut pocket is forming just below the headfolds. The node is conspicuous distally.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
382
Ulven et al.
Examination of mouse embryos by the bioassay suggests
that retinoid activity is absent in egg cylinder stage embryos but is present in the late primitive streak stages and
onwards (Ang et al., 1996). Hogan et al. used an alternative
“bioassay” (Hogan et al., 1992). They implanted fragments
of mouse embryos into chick wing buds and determined the
digit-inducing capacity of the fragments. Hogan et al. (1992)
observed that fragments from the egg cylinder stage failed
to induce additional digits, while fragments from primitive
streak stage embryos and neural plate stage embryos exhibited digit-inducing capacity.
A third strategy that has been used to study retinoid
signalling during embryonic development is transgenic
mice models containing reporters controlled by retinoidresponsive promoters. Since a more complex promoter,
such as the complete RAR␤2 promoter (Mendelsohn et al.,
1991; Shen et al., 1992), might be regulated by a complex
combination of transcription factors, the use of a minimal
retinoic acid-responsive promoter (Balkan et al., 1992; Rossant et al., 1991) is probably better for studying a retinoid
signal. By using such a promoter, Rossant et al. (1991)
detected a retinoid signal that appeared in the early headfold stage embryo. In addition, a strong signal was observed
in the posterior half of the late headfold stage embryo.
In this study we have used a very sensitive HPLC method
to determine retinoids in early mouse postimplantation
embryos. Furthermore, by using RT-PCR we have examined the mRNA expression of a number of retinoidmetabolising enzymes, binding proteins, and nuclear receptors in order to detect the factors controlling retinoid
signalling in early postimplantation mouse embryos. Our
study shows that at-RAL is present in egg cylinder stage
mouse embryos. We could not detect any RA in these
embryos. Transcripts for two enzymes able to convert ROH
to RAL are expressed at this stage, whereas no transcripts
coding for enzymes that oxidise RAL to RA were detected.
When analysing 7.5-dpc embryos (a combination of embryos from mid-primitive streak (Fig. 1B) until late allantoic
bud stage (Fig. 1C)), we detected RALDH2 transcripts as
well as endogenous at-RA. These data suggest that
RALDH2 is a key regulator in initiating a retinoid signal in
early postimplantation mouse embryos.
MATERIALS AND METHODS
Chemicals
All-trans-retinoic acid, 9-cis-retinoic acid, 13-cis-retinoic acid,
all-trans-retinol, 13-cis-retinol, all-trans-retinal, 13-cis-retinal, and
9-cis-retinal were obtained from Sigma Aldrich. The retinoids
11,13-di-cis-retinol, 9-cis-retinol, all-trans-3,4-didehydroretinal,
9-cis-3,4-didehydroretinal, 9-cis-3,4-didehydroretinoic acid, 9-cis3,4-didehydroretinol, and all-trans-3,4-didehydro-retinol were gifts
from F. Hoffmann La Roche (Basel, Switzerland). All-trans-3,4didehydroretinoic acid was a generous gift from A. Vahlquist.
Dissection
The study protocol was in accordance with the official governmental guidelines on the care and use of laboratory animals.
Female F1 hybrids (C57BL/6J ⫻ CBA/J) were superovulated according to Hogan et al. (1994) and the morning of vaginal plug was
considered 0.5 dpc. Further staging of mouse embryos was according to Kaufman (1992) and Downs and Davies (1993) (see Fig. 1).
Pregnant mice were sacrificed by cervical dislocation. Whole
embryos were dissected from the decidua, Reichert’s membrane,
and the ectoplacental cone.
Solid-Phase Extraction—HPLC
Electrochemical detection (ECD). Mouse embryos were analysed for retinoids (Table 1) according to a recently published
method (Sakhi et al., 1998). Briefly, embryos were carefully dissected under red light (Kodak filter No. 25) in cold 0.9% NaCl and
immediately frozen in liquid nitrogen and stored at ⫺70°C until
analysis. They were thawed and homogenised with a motorised
pellet grinder in a clear Eppendorf tube. Ten microlitres of internal
standard were added to 320 ␮l of the homogenate and the volume
was adjusted to 340 ␮l with buffer. Then, 510 ␮l of cold acetonitrile
was added. After thorough mixing and centrifugation at 5300g for
10 min (5°C), 750 ␮l of the clear supernatant was transferred to an
amber glass vial. An aliquot of 250 ␮l of water was added with
subsequent mixing, resulting in a final acetonitrile concentration
of 45%. The entire procedure was performed under red light and the
samples were kept on ice under argon atmosphere whenever
possible. An aliquot of 1000 ␮l was then injected onto the HPLC
system. The samples were submitted to online solid-phase extraction followed by automated transfer of the extract to the analytical
column by column switching. The coulometric electrochemical
detection system (ESA, Inc.) consisted of three cells. The guard cell
was set to ⫹750 mV and was used to oxidise any trace organic
compounds in the separating mobile phase, ensuring a very low
background. The screening cell lowered the amount of oxidisable
components in the injected sample and was set to ⫹450 mV. The
analytical cell was set to ⫹750 mV relative to the palladium
reference electrode and provided the signal by oxidising the double
bonds in the polyene chain of the retinoid.
Diode array detector (DAD). Mouse embryos (9.5 dpc) were
homogenised and 500 ␮l of acetonitrile was added, before mixing
and centrifugation. The supernatant was then concentrated and
cleaned up on a solid-phase extraction column located in the
sample loop. Retinoids retained on the solid-phase extraction
column were eluted to analytical column by turning of the valve.
After injection of the samples, UV spectra were recorded online
with a Shimadzu SPD-M10A diode array detector. The chromatographic conditions were as described by Sakhi et al. (1998), apart
from the flow being 0.5 ml/min, and the analytical column had a
2.1-mm i.d.
Atmospheric pressure electrospray ionization-mass spectrometry (AP-ESI-MS). Mouse embryos (9.5 dpc) were homogenised
and 300 ␮l of acetonitrile was added before mixing and centrifugation. An aliquot of 100 ␮l was injected on a 2.1 ⫻ 250-mm suplex
pKb-100 column. On-column focusing was performed by conditioning the column with 90% A (acetonitrile:water:acetic acid,
49.5:50:0.5, v/v) and 10% B (acetonitrile:2-propanol:acetic acid,
49.5:50:0.5, v/v) for 1 min and then changing to 20% A and 80% B
for the remainder. The flow was 0.350 ml/min. The liquid chromatograph was interfaced with the mass spectrometer by AP-ESI
(Hewlett–Packard). The [M⫹1] ⫹ ion of protonated at-RAL was
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
383
Retinoid Signaling in Mouse Embryos
detected in single-ion monitoring mode. The mass-to-charge ratio
(m/z) of this ion was 285.4. Tuned to give maximum sensitivity for
this fragment, the settings of the mass spectrometer were as
follows: fragmentor 50 V, nebuliser pressure 40 psi, drying gas flow
12 L/min, drying gas temperature 300°C, capillary voltage 5000 V,
gain 5.
RT-PCR
Mouse embryos were carefully dissected in ice-cold PBS and
washed several times in PBS to avoid contamination with maternal
tissue. Tissue was frozen in liquid nitrogen and kept at ⫺70°C until
analysis. mRNA was isolated from a pool of embryos using a
MicroFast mRNA isolation kit (Invitrogen). cDNA synthesis and
PCR amplifications (40 cycles) were performed as described (Ulven
et al., 1998). The specific oligonucleotides are shown in Table 2.
Each RT-PCR analysis was carried out using a negative control,
either without reverse transcriptase or by replacing the mRNA
template with water when PCR products spanned an intron. Each
positive result was repeated at least two times (and each negative
result was repeated five times). The identity of all PCR products
was confirmed by sequencing (MediGenomix). ␤-Actin was used in
all experiments as a positive control to ensure the quality of
mRNA.
RESULTS AND DISCUSSION
Endogenous Retinoids in 6.5- to 9.5-dpc Mouse
Embryos
No data exist on endogenous retinoids in mouse embryos
at stages earlier than 9.0 dpc (Horton and Maden, 1995). In
order to measure retinoids during early postimplantation
stages in mouse embryos, we used a highly sensitive HPLC
method. To preserve the configuration of the extremely
labile retinoids, online solid-phase extraction, microcolumns, and column switching and DAD, coulometric ECD,
or mass spectrometry were employed. The method applied
in this study has been fully validated and shows excellent
precision and reproducibility (Sakhi et al., 1998). The limit
of detection is 27 fmol for at-RA, 70 fmol for at-ROH, and
165 fmol for at-RAL compared to about 30 pmol for the
method used previously for mouse embryo analyses (Horton and Maden, 1995). This method was used to screen
mouse embryos at different stages of development (6.5–9.5
dpc) for 16 different retinoids (Table 1, Fig. 2A).
In initial experiments, 9.5-dpc embryos were collected
and prepared for analysis and a volume equivalent to 1.6
embryos was injected into the HPLC system equipped with
the coulometric EC detector. The amounts of at-ROH and
at-RA were 970 and 250 fmol per embryo, respectively (Fig.
2B). The other retinoids were either absent or below the
detection limit. When analysing 8.5-dpc mouse embryos
(i.e., 8 –12 somites) a homogenate equivalent to 9 embryos
was used (Fig. 3). In such embryos, we detected 87 and 13
fmol at-ROH and at-RA, respectively, per embryo. We then
analysed embryos collected at 7.5 dpc (i.e., a combination of
embryos from mid-primitive streak until late allantoic bud
stage). In such embryos we detected 32, 28, and 2.0 fmol
TABLE 1
List of Retinoids
Retinoid isomer
Abbreviation
All-trans-retinol
13-cis-retinol
11,13-di-cis-retinol
9-cis-retinol
All-trans-3,4-didehydroretinol
9-cis-3,4-didehydroretinol
All-trans-retinal
13-cis-retinal
9-cis-retinal
All-trans-3,4-didehydroretinal
9-cis-3,4-didehydroretinal
All-trans-retinoic acid
13-cis-retinoic acid
9-cis-retinoic acid
All-trans-3,4-didehydroretinoic acid
9-cis-3,4-didehydroretinoic acid
at-ROH
13c-ROH
11c, 13c-ROH
9c-ROH
at-dd-ROH
9c-dd-ROH
at-RAL
13c-RAL
9c-RAL
at-dd-RAL
9c-dd-RAL
at-RA
13c-RA
9c-RA
at-dd-RA
9c-dd-RA
at-ROH, at-RAL, and at-RA, respectively, per embryo (Fig.
3). When analysing embryos dissected at 6.5 dpc (i.e., egg
cylinder stage embryos) we were not able to detected either
at-ROH or at-RA, only at-RAL (20 fmol per embryo) (Fig. 3).
When using HPLC systems with coulometric EC detectors (as above) or single-wavelength UV detectors, identity
of any compound is based on coelution with authentic
standards. We therefore confirmed the identity of at-ROH
and at-RA by online recording of UV spectra of the endogenous compounds from 20 9.5-dpc embryos (Fig. 2C). In this
experiment, a peak coeluting with at-RAL was also seen,
but the mass of this substance was insufficient to provide
an adequate UV spectrum. However, by using LC-MS we
demonstrated that the identity of the peak was at-RAL (Fig.
4). The amount of at-RAL detected by the MS detector was
109 fmol/embryo.
Thus, these data demonstrate surprisingly that at-RAL is
the predominant retinoid in egg cylinder stage embryos and
that a detectable level of at-RA first appears sometime
between the mid-primitive streak stage and the late allantoic bud stage. We were not able to detect any other known
ligands for the RAR and RXR subtypes at these stages,
including 9c-RA (Fig. 3). The absence of endogenous 9c-RA
in the embryo in the present study in which we have used
ultrasensitive HPLC analysis is noteworthy and adds to
previous attempts to identify 9c-RA in mouse embryos
(Horton and Maden, 1995).
Our results are in agreement with the bioassay data
reported by Hogan et al. (1992) and Ang et al. (1996). In
reporter mice, retinoid signalling is first detected in early
headfold stage embryos (Rossant et al., 1991; Balkan et al.,
1992). Thus, these studies collectively suggest that at-RA
first accumulates at detectable levels during the primitive
streak stages.
It has been suggested that the metabolism and activation
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
384
Ulven et al.
TABLE 2
Oligonucleotides Used for RT-PCR Analyses
Gene
Abbreviation
Retinoic acid receptor ␣ (X56565, X06538)
RAR␣
Retinoic acid receptor ␤ (S56660)
RAR␤
Retinoic acid receptor ␥ (M24857)
RAR␥
Retinoid X receptor ␣ (M84817)
RXR␣
Retinoid X receptor ␤ (M84818)
RXR␤
Retinoid X receptor ␥ (M84819)
RXR␥
Retinoic acid receptor ␣2 (X56565)
RAR␣2
Retinoic acid receptor ␤2 (S56660)
RAR␤2
Retinoic acid receptor ␥2 (M32069,
M24857)
Chicken ovalbumin upstream promotertranscription factor I (U07625)
Chicken ovalbumin upstream promotertranscription factor II (U07635)
Nuclear-corepressor (U35312)
RAR␥2
Retinol dehydrogenase 1/3 (AI115847)/
(AA260409)
Retinol dehydrogenase 5 (AF013288)
RoDH1/3
cis-Retinol/3␣-hydroxysterol short-chain
dehydrogenase (AF030513)
cis-Retinol/3␣-hydroxysterol short-chain
dehydrogenase isozyme (AF056194)
Alcohol dehydrogenase 1 (M22671-79)
CRAD1
Alcohol dehydrogenase 4 (U20257)
ADH4
Aldehyde dehydrogenase 1 (M74570)
ALDH1
Retinal dehydrogenase type 2 (X99273)
RALDH2
Xanthine dehydrogenase (X62932)
XOX
Cellular retinoic acid binding protein I
(X15481)
Cellular retinoic acid binding protein II
(M35523)
Cellular retinol binding protein I (X60367)
CRABPI
Cellular retinol binding protein II
(M16400-2)
CRBPII
COUP-TFI
COUP-TFII
N-CoR
RDH5
CRAD2
ADH1
CRAB II
CRBPI
of retinoids during early embryonic development are fundamentally different in embryos of lower vertebrates such
as Xenopus and zebrafish compared to higher vertebrates
such as mouse and human. Lower vertebrates store large
Primer sequence
Sense: 5⬘ CAGTTCCGAAGAGATAGTACC 3⬘
Antisense: 5⬘ TACACCATGTTCTTCTGGATGC 3⬘
Sense: 5⬘ TCGAGACACAGAGTACCAGC 3⬘
Antisense: 5⬘ GAAAAAGCCCTTGCACCCCT 3⬘
Sense: 5⬘ GCCTCCTCGGGTCTACAAG 3⬘
Antisense: 5⬘ ATGATACAGTTTTTGTCGCGG 3⬘
Sense: 5⬘ ATGAAGCGGGAAGCTGTG 3⬘
Antisense: 5⬘ CATGTTTGCCTCCACGTATG 3⬘
Sense: 5⬘ TCAACTCCACAGTGTCGCTC 3⬘
Antisense: 5⬘ TAAACCCCATAGTGCTTGCC 3⬘
Sense: 5⬘ TTCTTCAAAAGGACCATCAGG 3⬘
Antisense: 5⬘ CGTTCATGTCACCGTAGGATTCT 3⬘
Sense: 5⬘ TAACCCCTTCCTAGTGGTGGAC 3⬘
Antisense: 5⬘ TACACCATGTTCTTCTGGATGC 3⬘
Sense: 5⬘ CTCTCAAAGCCTGCCTCAGT 3⬘
Antisense: 5⬘ GTGGTAGCCCGATGACTTGT 3⬘
Sense: 5⬘ CTTACTACGCAGAGCCACT 3⬘
Antisense: 5⬘ ATGATACAGTTTTTGTCGCGG 3⬘
Sense: 5⬘ TGGAGAAGCTCAAGGCGCTG 3⬘
Antisense: 5⬘ CTGTGCGAAGAGAGGGCAATC 3⬘
Sense: 5⬘ GTGGAGAAGCTCAAGGCACTG 3⬘
Antisense: 5⬘ CGTGCGGAGGGAAGGGAGA 3⬘
Sense: 5⬘ GAAGCCACAGCAGAAGAACC 3⬘
Antisense: 5⬘ ACGACCATGTTCTACCAGGC 3⬘
Sense: 5⬘ TCAGAAAGGCTGGAGACAGT 3⬘
Antisense: 5⬘ AAAGTGACACTCTGCCCAAGA 3⬘
Sense: 5⬘ AACCTGGAGAGTCTGGAGA 3⬘
Antisense: 5⬘ TTCATGATGCGGCGCTGTAC 3⬘
Sense: 5⬘ GTAGTGCCAGATTATGCTC 3⬘
Antisense: 5⬘ AGTCACCCCAGACAGGTCCTT 3⬘
Sense: 5⬘ CTAATGTCTCCAACTACGAG 3⬘
Antisense: 5⬘ TCATCTGAGCATGTGTCTGT 3⬘
Sense: 5⬘ CGATCACGTGGTTAGTGGAA 3⬘
Antisense: 5⬘ GATCGCTTCGGCTACAAAAG 3⬘
Sense: 5⬘ GGCTGATGGCACTACCAGAT 3⬘
Antisense: 5⬘ GGGTGACCTTGGCAGTTTTA 3⬘
Sense: 5⬘ GGGCTGACAAGATTCATGGT 3⬘
Antisense: 5⬘ TGAAGAGCCGTGAGAGGAGT 3⬘
Sense: 5⬘ TTGCAGATGCTGACTTGGAC 3⬘
Antisense: 5⬘ TCTGAGGACCCTGCTCAGTT 3⬘
Sense: 5⬘ GTTCCCAGTGTGGGTTCTGT 3⬘
Antisense: 5⬘ GGTTGTTTCCACTTCCTCCA 3⬘
Sense: 5⬘ CAACTTCAAGGTCGGAGAGG 3⬘
Antisense: 5⬘ CAGCTCTCGGGTCCAGTAAG 3⬘
Sense: 5⬘ TGATGAGGAAGATCGCTGTG 3⬘
Antisense: 5⬘ TTCCACTCTCCCATTTCACC 3⬘
Sense: 5⬘ GCTGAGCACTTTTCGGAACT 3⬘
Antisense: 5⬘ CCCTCAGCTCTCATTTCCAG 3⬘
Sense: 5⬘ GACGAAGGACCAGAATGGAA 3⬘
Antisense: 5⬘ TCACCGTCTTGAACGATGAT 3⬘
amounts of RAL, while indirect evidence has pointed towards ROH as the storage form in higher vertebrates
(Costaridis et al., 1996; Horton and Maden, 1995). Our data
demonstrate, however, that RAL is the predominant retin-
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
385
Retinoid Signaling in Mouse Embryos
FIG. 3. HPLC analysis of retinoids in 6.5-, 7.5-, and 8.5-dpc mouse
embryos. The dotted squares indicate the retention windows of
at-RAL, at-ROH, and at-RA. The arrows indicate the presence of an
endogenous retinoid. The thick lines represent the elution profile
obtained with the electrochemical detector after injection of embryo homogenates. The thin line represents the control sample.
oid in egg cylinder stage mouse embryos. This RAL might
be a result of embryonic uptake of retinoids from the
mother, e.g., as maternal retinol-RBP (Båvik et al., 1996).
Alternatively, at-RAL is derived from retinoids or carotenoids stored in the preimplanted embryo. The observations
that egg cylinder stage embryos contain at-RAL and express
the enzyme ADH4 (see below) may seem to favour the
former mechanism. If so, the embryo may first take up
at-ROH followed by a subsequent expression of ADH4,
which then converts at-ROH into at-RAL that accumulates
in egg cylinder stage embryos.
Expression of Retinoid Metabolising Enzymes in
6.5- to 9.5-dpc Mouse Embryos
FIG. 2. HPLC analyses of retinoid standards and 9.5-dpc mouse
embryos performed on the online solid-phase extraction ECD or
DAD system. (A) Elution profile showing separation and ECD at
⫹750 mV of retinoids and internal standard (i.s). (1) at-3,4-dd-RAL,
(2) at-3,4-dd-ROH, (3) 13c-RAL, (4) at-RAL, (5) at-ROH, (6) at-3,4dd-RA, (7) 9c-RA, (8) at-RA. The background has been digitally
subtracted. (B) The thick line represents the elution profile showing
substances oxidisable at ⫹750 mV versus the palladium reference
electrode in 9.5-dpc mouse embryos. The internal standard 13-cisacitretin is labelled i.s. The peak labelled 1 coeluted with at-ROH,
indicated with white arrow. The peak labelled 2 coeluted with
at-RA, indicated with black arrow. The thin line represents the
control sample that followed the real sample from collection to
analysis. (C) Analysis of the same sample as in B using a DAD. Full
spectral data were recorded online in the range 250 – 450 nm. The
recorded spectrum of peak 1 is shown in the inset superimposed on
the spectrum from pure authentic at-ROH standard. In a similar
By using a sensitive RT-PCR technique we screened the
embryos (6.5–9.5 dpc) for transcripts coding for a number of
enzymes, binding proteins, nuclear receptors, and repressors known to be involved in retinoid signalling. We were
first interested in the expression pattern of the different
transcripts involved in the metabolism and function of
vitamin A in whole embryos at early stages, for which little
or no information is available. Embryos were analysed for
transcripts coding for enzymes able to oxidise retinol to
manner the spectrum of peak 2 is shown. The minor peak eluting
in front of peak 1 has the same retention time as at-RAL, but the
absorption of this peak was not sufficient for adequate UV spectrum to be recorded. Peaks were also confirmed by spiking of the
samples with retinoid standards.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
386
Ulven et al.
FIG. 4. HPLC-MS analysis of 9.5-dpc mouse embryos. The thick
line represents the profile obtained from single-ion monitoring of
m/z ⫽ 285.4 when analysing 9.5-dpc embryos (10 embryos). The
thin line represents pure authentic at-RAL standard analysed under
identical conditions. The dotted line represents the control sample
that followed the real sample from collection to analysis. The
arrow indicates the retention time of at-RAL.
retinal (ADH1, ADH4, RoDH1, RoDH3, RDH5, CRAD1,
and CRAD2) and further to retinoic acid (ALDH1,
RALDH2, and XOX) (Figs. 5A and 5B). In egg cylinder stage
embryos (6.5 dpc), we detected ADH4 and RDH5 mRNA,
two enzymes catalysing oxidation of ROH to RAL. These
enzymes were also expressed at all later stages studied. Of
the other enzymes catalysing oxidation of ROH to RAL,
CRAD1 and ADH1 were first expressed in 9.5-dpc embryos,
while RoDH1, RoDH3, and CRAD2 mRNAs were not
expressed in any of the stages tested (Fig. 5A). Expression of
ADH1 in 9.5-dpc embryos is in agreement with the in situ
hybridisation data from Ang et al. (1996). They observed
that ADH1 expression at this stage was limited to the
mesonephros, a structure that gives rise to portions of the
genitourinary system. This indicates that the main RALsynthesising enzymes during early postimplantation embryos are ADH4 and RDH5, while ADH1 and CRAD1 may
contribute to RAL synthesis in 9.5-dpc embryos.
We detected no transcripts coding for enzymes oxidising
RAL to retinoic acid in egg cylinder stage embryos (6.5 dpc)
(Fig. 5B). These data are in accordance with our HPLC
analysis in which we identified at-RAL but not at-RA in
such embryos. In 7.5-dpc embryos (mainly mid-primitive
streak stage until no-allantoic-bud stage embryos), however, we detected RALDH2 mRNA, an enzyme capable of
oxidising the at-RAL into the active ligand at-RA. Thus,
these results suggest that RALDH2 is a key enzyme involved in initiating RA synthesis in early postimplantation
mouse embryos. Our results also suggest that several alternative pathways exist for at-RA production during later
stages of development as ALDH1 mRNA appeared in 8.5dpc mouse embryos and XOX mRNA in 9.5-dpc embryos
(Fig. 5B).
These data greatly extend our knowledge of the expression of enzymes involved in RA synthesis during early
postimplantation development. By using in situ hybridisation, Ang et al. (1996) previously detected ADH4 mRNA in
7.0- to 7.5-dpc mouse embryos in the posterior region of the
embryo along the primitive streak. We used the more
sensitive RT-PCR technique and demonstrated that ADH4
is expressed also at the egg cylinder stage. The other
enzyme that we observed in egg cylinder stage embryos was
RDH5. The expression of this enzyme has not been studied
in 6.5- and 7.5-dpc embryos before, but was detected in
neuroepithelium in 8.5-dpc embryos (Romert et al., 1998).
Since we now demonstrate that ADH4 as well as RDH5 is
expressed in egg cylinder stage embryos, two alternative
pathways may exist for retinal synthesis at this stage. This
FIG. 5. RT-PCR analysis of enzymes, binding proteins, receptors,
and repressors involved in the retinoid metabolism in 6.5- to
9.5-dpc mouse embryos. (A) The expression patterns of enzymes
converting ROH to RAL: RoDH1/3, CRAD2, CRAD1, ADH1,
RDH5, and ADH4. (B) The expression patterns of enzymes converting RAL to RA: XOX, ALDH1, and RALDH2. (C) The expression
patterns of intracellular retinoid binding proteins: CRABPI,
CRABPII, CRBPI, and CRBPII. (D) The expression patterns of
retinoic acid receptors (RARs), retinoid X receptors (RXRs), and
RAR␣2, RAR␤2, and RAR␥2 isoforms. (E) The expression patterns
of repressors COUP-TF I, COUP-TF II, and N-CoR.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
387
Retinoid Signaling in Mouse Embryos
is in accordance with the observation that ADH4 ⫺/⫺ mutant
mice, who most likely have a normal expression of RDH5,
have normal survival rates compared to wild-type except
when challenged by vitamin A deficiency (Deltour et al.,
1999). CRAD1 (Chai et al., 1997) and CRAD2 (Su et al.,
1998) mRNAs have not been studied previously in embryonic tissues. Since CRAD2 mRNA was not detected and
CRAD1 mRNA is detected only in 9.5-dpc embryos, these
enzymes, which are most effective with cis isomers of
ROH, do not seem to have any function in RA synthesis
during early postimplantation stages in mice. The same is
true for RoDH1 and RoDH3, whose transcripts were not
detected at any of the stages analysed. Previously, these two
enzymes have been detected only in liver (Chai et al.,
1995b, 1996), an organ not completely developed in 9.5-dpc
embryos.
We detected RALDH2 mRNA in 7.5-dpc but not in
6.5-dpc embryos. Lack of RALDH2 expression in 6.5-dpc
embryos is in accordance with an in situ hybridisation
study by Niederreither et al. (1997). They detected
RALDH2 expressed in the posterior half of the early allantoic and late allantoic bud stage embryo, in mesoderm
adjacent to the node and on each side of the primitive streak
and in individual cells in the primitive streak. By using in
situ hybridisation Ang et al. (1996) observed that ALDH1
was expressed in the posterior half of the embryo in 7.5-dpc
embryos, but not in 6.5-dpc embryos. We could not detect
any ALDH1 expression in either 6.5- or 7.5-dpc embryos. As
XOX (dehydrogenase form), which has been suggested to be
an alternative retinal dehydrogenase (Lee et al., 1991), is
expressed in 9.5-dpc embryos but not in 6.5- to 8.5-dpc
embryos, this enzyme also seems not to have a role in
retinoid metabolism during early postimplantation stages
of development.
All the Cellular Retinoid Binding Proteins Are
Expressed in 6.5- to 9.5-dpc Mouse Embryos
Studies on the distribution of the various types of CRBPs
and CRABPs have established that CRBPI and CRABPI are
the predominant intracellular retinoid binding proteins in
most tissues. Several lines of evidence indicate that the
intracellular binding proteins protect their ligands from
nonspecific reactions with several enzymes, but permit
metabolism with other more specific enzymes. For example, it has been hypothesised that activation of ROH to
RA is controlled, in part, by the relative amounts of
apoCRBPI and holoCRBPI (Napoli, 1996). Although the
cellular retinoid binding proteins are not known as essential for retinoid function, they have been shown to modulate the metabolism of retinoids. For example, by inactivation of the CRBPI gene in mice, it was recently
demonstrated (Ghyselinck et al., 1999) that its absence
results in a waste of ROH that is asymptomatic in vitamin
A-sufficient animals, but leads to a severe syndrome of
vitamin A deficiency in animals fed a diet containing low
amounts of vitamin A. We observed expression of tran-
scripts for the cellular binding proteins CRBPI, CRBPII,
CRABPI, and CRABPII at all stages analysed, including the
egg cylinder stage (Fig. 5C).
In previous reports in which the expression patterns of
cellular retinoid binding proteins were studied from 7.5 dpc
by in situ hybridisation (Ruberte et al., 1991, 1992),
CRABPI and CRBPI expression was detected in 7.5-dpc
embryos. CRBPI expression was highest in both epiblast
and primary mesenchyme of the primitive streak. CRABPI
expression was observed in the primary mesenchyme, including the allantois, overlapping with CRBPI expression
just lateral to the primitive streak, but not in the streak
itself. CRABPI and II also seem to have individual functions
during early embryonic development since they are localised in different parts of the 8.0-dpc embryo (Ruberte et
al., 1992).
Since CRBPII is almost exclusively expressed in the small
intestine in adults, the protein is often regarded as a specific
binding protein, which functions only in intestinal absorption of retinol. Previous studies have, however, demonstrated high expression of CRBPII in some other tissues,
including the liver, during late embryonic stages (Levin et
al., 1987). Our present demonstration of an expression of
CRBPII from the egg cylinder stage and onwards suggests
that CRBPII also is involved in retinoid metabolism in
some very early stages of development.
Expression of Nuclear Receptors and Corepressors
When we analysed for transcripts coding for the nuclear
retinoid receptors we observed that all the RARs (RAR␣, ␤,
␥) and all the RXRs (RXR␣, ␤, ␥) were expressed in 6.5-, 7.5-,
and 8.5- as well as 9.5-dpc embryos (Fig. 5D). The expression of RXR subtypes before 8.5 dpc has not been studied
previously (Dolle et al., 1994). Since we observe RXR
expression in both 6.5- and 7.5-dpc embryos, our results
suggest that RXR can function as either a homodimer or a
heterodimer partner for RAR or other members of the
superfamily of ligand-inducible transcription factors at
least down to the egg cylinder stage. Our results confirm
the previous observations (Ruberte et al., 1990, 1991; Dolle
et al., 1994; Ang and Duester, 1997) that RAR␣ and RAR␥
are expressed as early as 6.5 dpc. However, our results
extend previous knowledge as we also demonstrate that
RAR␤ is expressed in the egg cylinder stage embryo and
that the RAR␣2, RAR␤2, and RAR␥2 isoforms are expressed
in such embryos. Interestingly, all these three isoforms
have a retinoic acid-response element in their promotor
(Mangelsdorf et al., 1995). Thus, our data, which are in
agreement with previous suggestions (Ang and Duester,
1997), demonstrate that induction of the expression of these
receptors does not seem to control the initiation of retinoid
signalling during primitive streak formation, since all the
retinoid receptors are expressed at the egg cylinder stage
and onwards.
Chicken ovalbumin upstream promoter transcription factor (COUP-TF) types I and II belong to the superfamily of
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
388
Ulven et al.
FIG. 6. Schematic summary of the results from mRNA analyses and the amount of endogenous retinoids in 6.5- to 9.5-dpc embryos
presented in Figs. 2–5. The amount of retinoids is presented on a logarithmic scale. The embryonic stages analysed are illustrated on the
top. The grey area indicates the time at which retinoic acid is first detected (midstreak stage until the late allantoic bud stage), suggesting
the importance of RALDH2 at this stage.
ligand-inducible transcription factors and are known to
efficiently repress transcription driven by RAR–RXR heterodimers (Chambon, 1996; Mangelsdorf et al., 1995). Further, we demonstrate that the COUP-TF I and II are
expressed at all stages from 6.5 to 9.5 dpc in mouse embryos
(Fig. 5E). These receptors have previously been studied by
Qiu and co-workers (Qiu et al., 1994) from 7.5 dpc using in
situ hybridisation, but they could not observe any staining
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
389
Retinoid Signaling in Mouse Embryos
before 8.5 dpc. Although further experiments are needed to
investigate whether COUP-TF I and II are present in the
same cells as the retinoid receptors, these orphan receptors
are potential modulators of retinoid signalling in early
stages of development.
The mechanism of action of retinoids in gene expression
has been shown to involve a balance between coactivators
with histone acetylase activity and corepressors with histone deacetylase activity. The expression of the most
prominent coactivator, CBP/p300, has previously been
demonstrated at 7.5 dpc of mouse development (Yao et al.,
1998). Here, we demonstrate that the most prominent
nuclear corepressor, N-CoR, is expressed in 7.5-dpc embryos and later stages but not in 6.5-dpc embryos (Fig. 5E).
Together, these data suggest that a functional corepressor/
coactivator mechanism is present in 7.5-dpc embryos when
retinoid signalling first seems to appear.
In summary, the present study shows that mRNA transcripts for all the RAR and RXR subtypes, two ROH
oxidising enzymes, and all the binding proteins are expressed in egg cylinder stage embryos, with the important
exception of enzymes able to convert RAL to RA (Fig. 6).
Expression of RALDH2 mRNA in 7.5-dpc embryos suggests
that these embryos, sometime between the mid-primitive
streak stage and the late allantoic bud stage (Fig. 1), are able
to perform the last step in RA synthesis. Recently, Niederreither and co-workers (1999) generated a targeted disruption of the mouse RALDH2 gene and found that
RALDH2 ⫺/⫺ embryos, which die at midgestation without
undergoing axial rotation, exhibit shortening along the
anterioposterior axis, heart, and frontonasal malformation
and do not form limb buds. Furthermore, these defects
result from a block in embryonic retinoic acid synthesis, as
shown by the lack of activity of RA-responsive transgenes,
the altered expression of an RA-target homeobox gene, and
the near full rescue of the mutant phenotype by maternal
RA administration. These results are fully in accordance
with our results and interpretations, i.e., an essential role of
RALDH2 in the regulation of RA synthesis during early
postimplantation stages. We have also used sensitive HPLC
techniques to identify the precursor, at-RAL, in egg cylinder
stage mouse embryos, and the active ligand, at-RA, in
7.5-dpc mouse embryos. These embryos represent a combination of embryos from mid-primitive streak until late
allantoic bud stage. No other retinoid ligands, including
9c-RA, were detected in preneurulation stage mouse embryos, suggesting that retinoid signalling in early embryos
does not require anything other than at-RA. Expression of
two alternative enzymes (ADH4 and RDH5) capable of
synthesising RAL is detected in egg cylinder stage embryos.
Since RDH5 is most active in the conversion of c-ROHs,
while ADH4 efficiently converts at-ROH into at-RAL, the
data suggest that ADH4 is crucial for retinoid signalling in
egg cylinder stage embryos. Additionally we detected
mRNA coding for an enzyme capable of oxidising the final
step in the at-RA synthesis (i.e., RALDH2) in mouse embryos dissected at 7.5 dpc (Fig. 6). Therefore, our results
suggest that RALDH2 is the key regulator in retinoid
signalling in early postimplantation mouse embryos.
ACKNOWLEDGMENTS
We thank A. Vahlquist and F. Hoffmann La Roche for generous
donation of retinoid standards, K. Holte for excellent technical
assistance, and S. Kjølsrud for help in preparing the manuscript.
This work was supported by grants from the Norwegian Cancer
Society, the Norwegian Research Council, The Novo Nordisk
Foundation, and the Throne Holst Foundation.
REFERENCES
Allali-Hassani, A., Peralba, J. M., Martras, S., Farres, J., and Pares,
X. (1998). Retinoids, omega-hydroxy fatty acids and cytotoxic
aldehydes as physiological substrates, and H2-receptor antagonists as pharmacological inhibitors, of human class IV alcohol
dehydrogenase. FEBS Lett. 426, 362–366.
Ang, H. L., Deltour, L., Hayamizu, T. F., Zgombic-Knight, M., and
Duester, G. (1996). Retinoic acid synthesis in mouse embryos
during gastrulation and craniofacial development linked to class
IV alcohol dehydrogenase gene expression. J. Biol. Chem. 271,
9526 –9534.
Ang, H. L., and Duester, G. (1997). Initiation of retinoid signaling in
primitive streak mouse embryos: Spatiotemporal expression patterns of receptors and metabolic enzymes for ligand synthesis.
Dev. Dyn. 208, 536 –543.
Ang, H. L., and Duester, G. (1999). Stimulation of premature
retinoic acid synthesis in Xenopus embryos following premature
expression of aldehyde dehydrogenase ALDH1. Eur. J. Biochem.
260, 227–234.
Azuma, M., Seki, T., and Fujishita, S. (1990). Changes of egg
retinoids during the development of Xenopus laevis. Vision Res.
30, 1395–1400.
Balkan, W., Colbert, M., Bock, C., and Linney, E. (1992). Transgenic
indicator mice for studying activated retinoic acid receptors
during development. Proc. Natl. Acad. Sci. USA 89, 3347–3351.
Blomhoff, R. (1994). “Vitamin A in Health and Disease.” Dekker,
New York.
Blomhoff, R., Green, M. H., Berg, T., and Norum, K. R. (1990).
Transport and storage of vitamin A. Science 250, 399 – 404.
Blumberg, B., Bolado, J., Derguini, F., Craig, A. G., Moreno, T. A.,
Chakravarti, D., Heyman, R. A., Buck, J., and Evans, R. M. (1996).
Novel retinoic acid receptor ligands in Xenopus embryos. Proc.
Natl. Acad. Sci. USA 93, 4873– 4878.
Boleda, M. D., Saubi, N., Farres, J., and Pares, X. (1993). Physiological substrates for rat alcohol dehydrogenase classes: Aldehydes
of lipid peroxidation, omega-hydroxy fatty acids, and retinoids.
Arch. Biochem. Biophys. 307, 85–90.
Båvik, C., Ward, S. J., and Chambon, P. (1996). Developmental
abnormalities in cultured mouse embryos deprived of retinoic by
inhibition of yolk-sac retinol binding protein synthesis. Proc.
Natl. Acad. Sci. USA 93, 3110 –3114.
Chai, X., Zhai, Y., Popescu, G., and Napoli, J. L. (1995a). Cloning of
a cDNA for a second retinol dehydrogenase type II. Expression of
its mRNA relative to type I. J. Biol. Chem. 270, 28408 –28412.
Chai, X., Boerman, M. H., Zhai, Y., and Napoli, J. L. (1995b).
Cloning of a cDNA for liver microsomal retinol dehydrogenase.
A tissue-specific, short-chain alcohol dehydrogenase. J. Biol.
Chem. 270, 3900 –3904.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
390
Ulven et al.
Chai, X., Zhai, Y., and Napoli, J. L. (1996). Cloning of a rat cDNA
encoding retinol dehydrogenase isozyme type III. Gene 169,
219 –222.
Chai, X., Zhai, Y., and Napoli, J. L. (1997). cDNA cloning and
characterization of a cis-retinol/3alpha-hydroxysterol shortchain dehydrogenase. J. Biol. Chem. 272, 33125–33131.
Chambon, P. (1994). The retinoid signaling pathway: Molecular
and genetic analyses. Semin. Cell Biol. 5, 115–125.
Chambon, P. (1996). A decade of molecular biology of retinoic acid
receptors. FASEB J. 10, 940 –954.
Chytil, F., and Ong, D. E. (1984). Cellular retinoid-binding proteins.
In “The Retinoids” (M. B. Sporn, A. B. Roberts, and D. S.
Goodman, Eds.), pp. 90 –123. Academic Press, Orlando.
Costaridis, P., Horton, C., Zeitlinger, J., Holder, N., and Maden, M.
(1996). Endogenous retinoids in the zebrafish embryo and adult.
Dev. Dyn. 205, 41–51.
Deltour, L., Foglio, M. H., and Duester, G. (1999). Impaired retinol
utilization in Adh4 alcohol dehydrogenase mutant mice. Dev.
Genet. 25, 1–10.
Dolle, P., Fraulob, V., Kastner, P., and Chambon, P. (1994). Developmental expression of murine retinoid X receptor (RXR) genes.
Mech. Dev. 45, 91–104.
Downs, K. M., and Davies, T. (1993). Staging of gastrulating mouse
embryos by morphological landmarks in the dissecting microscope. Development 118, 1255–1266.
Driessen, C. A., Winkens, H. J., Kuhlmann, E. D., Janssen, A. P.,
van Vugt, A. H., Deutman, A. F., and Janssen, J. J. (1998). The
visual cycle retinol dehydrogenase: Possible involvement in the
9-cis retinoic acid biosynthetic pathway. FEBS Lett. 428, 135–
140.
Duester, G. (1996). Involvement of alcohol dehydrogenase, shortchain dehydrogenase/reductase, aldehyde dehydrogenase, and
cytochrome P450 in the control of retinoid signaling by activation of retinoic acid synthesis. Biochemistry 35, 12221–12227.
Durston, A. J., Timmermans, J. P., Hage, W. J., Hendriks, H. F., de
Vries, N. J., Heideveld, M., and Nieuwkoop, P. D. (1989). Retinoic acid causes an anteroposterior transformation in the developing central nervous system. Nature 340, 140 –144.
Ghyselinck, N. B., Bavik, C., Sapin, V., Mark, M., Bonnier, D.,
Hindelang, C., Dierich, A., Nilsson, C. B., Hakansson, H., Sauvant, P., Azais-Braesco, V., Frasson, M., Picaud, S., and Chambon, P. (1999). Cellular retinol-binding protein I is essential for
vitamin A homeostasis. EMBO J. 18, 4903– 4914.
Giguere, V., Lyn, S., Yip, P., Siu, C. H., and Amin, S. (1990).
Molecular cloning of cDNA encoding a second cellular retinoic
acid-binding protein. Proc. Natl. Acad. Sci. USA 87, 6233– 6237.
Han, C. L., Liao, C. S., Wu, C. W., Hwong, C. L., Lee, A. R., and Yin,
S. J. (1998). Contribution to first-pass metabolism of ethanol and
inhibition by ethanol for retinol oxidation in human alcohol
dehydrogenase family—Implications for etiology of fetal alcohol
syndrome and alcohol-related diseases. Eur. J. Biochem. 254,
25–31.
Hogan, B., Beddington, R., Constantini, F., and Lazy, E. (1994).
Recovery, culture and transfer of embryos. In “Manipulating the
Mouse Embryo: A Laboratory Manual,” pp. 129 –188. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
Hogan, B. L., Thaller, C., and Eichele, G. (1992). Evidence that
Hensen’s node is a site of retinoic acid synthesis. Nature 359,
237–241.
Horton, C., and Maden, M. (1995). Endogenous distribution of
retinoids during normal development and teratogenesis in the
mouse embryo. Dev. Dyn. 202, 312–323.
Kastner, P., Mark, M., Ghyselinck, N., Krezel, W., Dupe, V.,
Grondona, J. M., and Chambon, P. (1997a). Genetic evidence that
the retinoid signal is transduced by heterodimeric RXR/RAR
functional units during mouse development. Development 124,
313–326.
Kastner, P., Messaddeq, N., Mark, M., Wendling, O., Grondona,
J. M., Ward, S., Ghyselinck, N., and Chambon, P. (1997b).
Vitamin A deficiency and mutations of RXRalpha, RXRbeta and
RARalpha lead to early differentiation of embryonic ventricular
cardiomyocytes. Development 124, 4749 – 4758.
Kaufman, M. H. (1992). Assessment of developmental stage of preand postimplantation mouse embryos based on the staging
system of Theiler (postimplantation period). In “The Atlas of
Mouse Development,” pp. 17–337. Academic Press, San Diego.
Lee, M. O., Manthey, C. L., and Sladek, N. E. (1991). Identification
of mouse liver aldehyde dehydrogenases that catalyze the oxidation of retinaldehyde to retinoic acid. Biochem. Pharmacol. 42,
1279 –1285.
Levin, M. S., Li, E., Ong, D. E., and Gordon, J. I. (1987). Comparison
of the tissue-specific expression and developmental regulation of
two closely linked rodent genes encoding cytosolic retinolbinding proteins. J. Biol. Chem. 262, 7118 –7124.
Maden, M., Sonneveld, E., van der Saag, P. T., and Gale, E. (1998).
The distribution of endogenous retinoic acid in the chick embryo: Implications for developmental mechanisms. Development 125, 4133– 4144.
Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR heterodimers
and orphan receptors. Cell 83, 841– 850.
Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz,
G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., and
Chambon, P. (1995). The nuclear receptor superfamily: The
second decade. Cell 83, 835– 839.
Mendelsohn, C., Ruberte, E., LeMeur, M., Morriss-Kay, G., and
Chambon, P. (1991). Developmental analysis of the retinoic
acid-inducible RAR-beta 2 promoter in transgenic animals. Development 113, 723–734.
Mertz, J. R., Shang, E., Piantedosi, R., Wei, S., Wolgemuth, D. J.,
and Blaner, W. S. (1997). Identification and characterization of a
stereospecific human enzyme that catalyzes 9-cis-retinol oxidation. A possible role in 9-cis-retinoic acid formation. J. Biol.
Chem. 272, 11744 –11749.
Napoli, J. L. (1996). Biochemical pathways of retinoid transport,
metabolism, and signal transduction. Clin. Immunol. Immunopathol. 80, S52–S62.
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P., and
Dolle, P. (1997). Restricted expression and retinoic acid-induced
downregulation of the retinaldehyde dehydrogenase type 2
(RALDH-2) gene during mouse development. Mech. Dev. 62,
67–78.
Niederreither, K., Subbarayan, V., Dolle, P., and Chambon, P.
(1999). Embryonic retinoic acid synthesis is essential for early
mouse post-implantation development. Nat. Genet. 21, 444 –
448.
Ong, D. E. (1984). A novel retinol-binding protein from rat. Purification and partial characterization. J. Biol. Chem. 259, 1476 –
1482.
Pijnappel, W. W., Hendriks, H. F., Folkers, G. E., van den Brink,
C. E., Dekker, E. J., Edelenbosch, C., van der Saag, P. T., and
Durston, A. J. (1993). The retinoid ligand 4-oxo-retinoic acid is a
highly active modulator of positional specification. Nature 366,
340 –344.
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.
391
Retinoid Signaling in Mouse Embryos
Qiu, Y., Cooney, A. J., Kuratani, S., DeMayo, F. J., Tsai, S. Y., and
Tsai, M. J. (1994). Spatiotemporal expression patterns of chicken
ovalbumin upstream promoter-transcription factors in the developing mouse central nervous system: Evidence for a role in
segmental patterning of the diencephalon. Proc. Natl. Acad. Sci.
USA 91, 4451– 4455.
Romert, A., Tuvendal, P., Simon, A., Dencker, L., and Eriksson, U.
(1998). The identification of a 9-cis retinol dehydrogenase in the
mouse embryo reveals a pathway for synthesis of 9-cis retinoic
acid. Proc. Natl. Acad. Sci. USA 95, 4404 – 4409.
Rossant, J., Zirngibl, R., Cado, D., Shago, M., and Giguere, V.
(1991). Expression of a retinoic acid response element-hsplacZ
transgene defines specific domains of transcriptional activity
during mouse embryogenesis. Genes Dev. 5, 1333–1344.
Ruberte, E., Dolle, P., Chambon, P., and Morriss-Kay, G. (1991).
Retinoic acid receptors and cellular retinoid binding proteins. II.
Their differential pattern of transcription during early morphogenesis in mouse embryos. Development 111, 45– 60.
Ruberte, E., Dolle, P., Krust, A., Zelent, A., Morriss-Kay, G., and
Chambon, P. (1990). Specific spatial and temporal distribution of
retinoic acid receptor gamma transcripts during mouse embryogenesis. Development 108, 213–222.
Ruberte, E., Friederich, V., Morriss-Kay, G., and Chambon, P.
(1992). Differential distribution patterns of CRABP I and CRABP
II transcripts during mouse embryogenesis. Development 115,
973–987.
Ruiz and Jessell, T. M. (1991). Retinoic acid modifies the pattern of
cell differentiation in the central nervous system of neurula stage
Xenopus embryos. Development 112, 945–958.
Sakhi, A. K., Gundersen, T. E., Ulven, S. M., Blomhoff, R., and
Lundanes, E. (1998). Quantitative determination of endogenous
retinoids in mouse embryos by high-performance liquid chromatography with on-line solid-phase extraction, column switching
and electrochemical detection. J. Chromatogr. A 828, 451– 460.
Shen, S., van den Brink, C. E., Kruijer, W., and van der Saag, P. T.
(1992). Embryonic stem cells stably transfected with mRAR beta
2-lacZ exhibit specific expression in chimeric embryos. Int. J.
Dev. Biol. 36, 465– 476.
Simon, A., Hellman, U., Wernstedt, C., and Eriksson, U. (1995).
The retinal pigment epithelial-specific 11-cis retinol dehydrogenase belongs to the family of short chain alcohol dehydrogenases.
J. Biol. Chem. 270, 1107–1112.
Su, J., Chai, X., Kahn, B., and Napoli, J. L. (1998). cDNA cloning,
tissue distribution, and substrate characteristics of a cis-retinol/
3alpha-hydroxysterol short-chain dehydrogenase isozyme.
J. Biol. Chem. 273, 17910 –17916.
Thaller, C., and Eichele, G. (1990). Isolation of 3,4didehydroretinoic acid, a novel morphogenetic signal in the
chick wing bud. Nature 345, 815– 819.
Ulven, S. M., Natarajan, V., Holven, K. B., Lovdal, T., Berg, T., and
Blomhoff, R. (1998). Expression of retinoic acid receptor and
retinoid X receptor subtypes in rat liver cells: Implications for
retinoid signalling in parenchymal, endothelial, Kupffer and
stellate cells. Eur. J. Cell Biol. 77, 111–116.
Wagner, M., Han, B., and Jessell, T. M. (1992). Regional differences
in retinoid release from embryonic neural tissue detected by an
in vitro reporter assay. Development 116, 55– 66.
Wagner, M., Thaller, C., Jessell, T., and Eichele, G. (1990). Polarizing activity and retinoid synthesis in the floor plate of the neural
tube. Nature 345, 819 – 822.
Wang, J., Chai, X., Eriksson, U., and Napoli, J. L. (1999). Activity of
human 11-cis-retinol dehydrogenase (Rdh5) with steroids and
retinoids and expression of its mRNA in extra-ocular human
tissue. Biochem. J. 338, 23–27.
Wendling, O., Chambon, P., and Mark, M. (1999). Retinoid X
receptors are essential for early mouse development and placentogenesis. Proc. Natl. Acad. Sci. USA 96, 547–551.
Wolf, G. (1991). The intracellular vitamin A-binding proteins: An
overview of their functions. Nutr. Rev. 49, 1–12.
Yao, T. P., Oh, S. P., Fuchs, M., Zhou, N. D., Ch’ng, L. E.,
Newsome, D., Bronson, R. T., Li, E., Livingston, D. M., and
Eckner, R. (1998). Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300. Cell 93, 361–372.
Zhao, D., McCaffery, P., Ivins, K. J., Neve, R. L., Hogan, P., Chin,
W. W., and Drager, U. C. (1996). Molecular identification of a
major retinoic-acid-synthesizing enzyme, a retinaldehydespecific dehydrogenase. Eur. J. Biochem. 240, 15–22.
Received for publication November 4, 1999
Revised January 20, 2000
Accepted January 20, 2000
Copyright © 2000 by Academic Press. All rights of reproduction in any form reserved.