BMC Research Notes
BioMed Central
Open Access
Short Report
PCR diagnostics of Mycobacterium tuberculosis in historic human
long bone remains from 18th century burials in Kaiserebersdorf,
Austria
Lutz Bachmann1, Barbara Däubl2, Charlotte Lindqvist1,4,
Luise Kruckenhauser2, Maria Teschler-Nicola3 and Elisabeth Haring*2
Address: 1Natural History Museum, Department for Zoology, University of Oslo, PO Box 1172, Blindern, NO-0318, Oslo, Norway, 2Museum of
Natural History Vienna, 1st Zoology. Department, Molecular Systematics, Burgring 7, A-1010, Vienna, Austria, 3Museum of Natural History
Vienna, Department of Anthropology, Burgring 7, A-1010, Vienna, Austria and 4Department of Biological Sciences, The State University of New
York at Buffalo, Buffalo, NY 14260, USA
Email: Lutz Bachmann - bachmann@nhm.uio.no; Barbara Däubl - barbara.daeubl@nhm-wien.ac.at;
Charlotte Lindqvist - charlotte.lindqvist@nhm.uio.no; Luise Kruckenhauser - luise.kruckenhauser@nhm-wien.ac.at; Maria TeschlerNicola - maria.teschler@nhm-wien.ac.at; Elisabeth Haring* - elisabeth.haring@nhm-wien.ac.at
* Corresponding author
Published: 17 September 2008
BMC Research Notes 2008, 1:83
doi:10.1186/1756-0500-1-83
Received: 12 March 2008
Accepted: 17 September 2008
This article is available from: http://www.biomedcentral.com/1756-0500/1/83
© 2008 Haring et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background: In the present pilot study we applied recently published protocols for detecting
Mycobacterium tuberculosis in human remains. We screened long bones from an 18th century
cemetery and skulls from the anatomical "Weisbach collection" (19th century). In addition, besides
the study of abundance of tuberculosis in inmates of the poorhouse itself, we were interested to
test whether in this particular instance tuberculosis can be identified from cortical bones, which
are rarely affected by tuberculosis, but mostly better preserved than the vertebral bodies or
epiphyses.
Method: The DNA extractions from the bone samples were obtained following established
ancient DNA protocols. Subsequently extracts were subjected to a series of PCR amplifications
using primer pairs published previously [1,2]. PCR products of the expected size were subsequently
sequenced.
Results: Only primers targeting the repetitive IS6110 insertion sequence yielded PCR products of
appropriate size. In one sample only (skull sample WB354 of the "Weisbach collection") sequence
analysis revealed an authentic M. tuberculosis sequence that matched to a reference sequence from
GenBank.
Conclusion: With a variety of established PCR approaches we failed to detect M. tuberculosis
DNA in historic human femurs from an 18th century cemetery relating to a poor house in
Kaiserebersdorf, Austria. Our data may indicate that in this particular case, thoracic or lumbar
vertebrae, i.e. bones that are severely affected by the disease, would be more suitable for molecular
diagnostics than long bones. However, the unpredictable state of DNA preservation in bones from
museum collections does not allow any general recommendation of any type of bone.
Page 1 of 6
(page number not for citation purposes)
BMC Research Notes 2008, 1:83
Background
Bone tuberculosis (Spondylitis tuberculosa, "Pott's disease")
and joint tuberculosis are caused by Mycobacterium tuberculosis and appear among others as late manifestations of
a tuberculosis infection. Because of the inflammatory
bony changes, e.g., partial or total destruction of the vertebral bodies or joint elements, manifestations of tuberculosis infections of (pre)historic human skeletal remains
are very often identifiable by means of macroscopic
inspections. Since the spread of M. tuberculosis depends on
population density, its verification is also of high interest
for the reconstruction of population dynamic processes in
archaeology and anthropology [3]. Nevertheless, post
mortem destructions with substantial substance loss or
other pathologies with a similar appearance such as, e.g.,
destruction and remodeling of joint surfaces caused by a
fracture and dislocation of a joint element, or an idiopathic avascular necrosis of the femoral head, may lead
occasionally to erroneous diagnoses, which may miss- or
under-represent the prevalence of tuberculosis in past
human populations. An unambiguous molecular identification of tuberculosis for historic human bone remains
has therefore been highly appreciated by anthropologists
and paleo-epidemiologists.
In recent years, tuberculosis has been diagnosed from a
variety of historic human bone remains using ancient
DNA methodology. Spigelman and Lemma [4] were the
first to detect authentic DNA of M. tuberculosis in pre-European-contact human remains from Borneo by means of
PCR amplification. This study has been criticized to some
extent for technical issues, but the results were confirmed
some ten years later [5]. Other examples of detecting M.
tuberculosis in historic samples include ancient Egyptian
mummies [6] and twelve approximately 140 – 1,200 years
old mummies excavated from the Andes Mountain region
of South America [1]. In seven samples Mycobacterium
DNA could be detected out of which two proved positive
for M. tuberculosis. In another study several loci of the M.
tuberculosis genome were targeted in DNA extracted from
naturally mummified remains from three 18th century
individuals from Hungary by means of PCR and spoligotyping [7], and M. tuberculosis rather than Mycobacterium
bovis was identified as the cause of the disease. Taylor et al.
[2] were able to confirm the morphology based diagnosis
of tuberculosis for approximately 2,200 years old human
remains excavated from Tarrant Hinton, Dorset, United
Kingdom, using a series of sensitive PCR amplifications.
In addition, they identified a member of the "modern"
type of M. tuberculosis and excluded other strains such as
M. bovis as the source of infection of this particular individual. More recently, M. tuberculosis DNA could also be
genotyped from five Iron Age individuals from Aymyrlyg,
South Siberia [8]. So far, the most comprehensive studies
have been conducted by Zink et al. [9,10]. Remains of 41
http://www.biomedcentral.com/1756-0500/1/83
individuals from the ancient Egyptian population (3,000500 BC) have been screened for M. tuberculosis, among
them 21 samples without morphological osseous
changes. M. tuberculosis was detected in 9 samples including 2 cases without pathological bone changes [9]. In
2005, Zink et al. [10] screened numerous samples of different age and origin, and determined high frequencies of
tuberculosis infections in historic populations.
Most studies mentioned above used either dried skin [1]
or thoracic and lumbar vertebrae as well as ribs [2,8], i.e.
those parts of the skeleton that are affected most by Pott's
disease, as sources for DNA extractions. Nevertheless, to
some extent long bones have been shown suitable for
detection of M. tuberculosis, e.g., Fusegawa et al. [11],
although vertebrae, spines, and ribs remain the preferred
samples. Zink et al. [10] also screened 51 long bones for
the presence of M. tuberculosis, and showed that such samples may also be suitable for investigating osseous tuberculosis, although with probably lower success rate.
In the present pilot study, we screened 10 long bones from
the 18th century burials of the Kaiserebersdorf castle, Austria, for M. tuberculosis DNA. In addition to study the
abundance of tuberculosis in inmates of the poorhouse
itself, we were interested to test whether in this particular
instance tuberculosis can be identified from cortical bones
(here we used the most robust element, the femur). Such
bones are rarely affected by tuberculosis but are frequently
much better preserved than the vertebral bodies or epiphyses, and preservation of authentic ancient DNA in the
bones' middle regions has been shown likely [12].
According to historical sources, the cemetery was localized
close to a chapel and a poor house, which was established
by the Habsburg empress Maria Theresia. The skeletal
remains of 34 individuals were systematically investigated, and 24 individuals were identified as elder females.
Nearly all individuals exhibited severe skeletal changes or
pathological alterations. Among them not only progressive degenerative joint lesions indicating long-lasting hard
labor, but also features such as cribra orbitalia (anemia),
chronic Vitamin C deficiency (newly build bone structures and porosities) and Vitamin D deficiency (rachitic,
osteomalacia, osteoporosis) as well as severe inflammations (meningitis and sinusitis) and symptoms of infectious diseases such as syphilis and tuberculosis were
observed [13].
Methods
Samples
All samples were taken from the collections housed at the
Department of Anthropology, Natural History Museum
Vienna, Austria. Ten samples were taken from the midshaft femur of ten different individuals recovered from the
burial site at the castle of Kaiserebersdorf, south-east of
Page 2 of 6
(page number not for citation purposes)
BMC Research Notes 2008, 1:83
http://www.biomedcentral.com/1756-0500/1/83
Vienna: KE1, KE8, KE18, KE20, KE22b, KE26b, KE22,
KE23, KE26c, KE29. [5]. Tuberculosis was clearly identified in one individual (KE20), a well preserved skeleton of
an end-mature female, which shows characteristic osteolytic changes among two vertebral bodies and the adjacent
portion of the os sacrum. Individual KE23, a mature
female, very likely represents a case of beginning joint
tuberculosis. The proximal metaphysis of the left ulna
shows an active osteolytic process in form of a cavity.
From an anthropological point of view, the inmates of the
poor house in Kaiserebersdorf represent a group of hard
working, extremely insufficiently nourished people. It is
considered likely that infectious diseases such as tuberculosis have spread within this community.
As positive controls, three bone samples (core samples
obtained from skull vaults) from the anatomical
"Weisbach collection", dated to the end of the 19th century were used. Individual data such as sex, age-of-death,
and cause-of-death were recorded in handwritten protocols [14]: WB 565, a 22 year old male, died from meningitis tuberculosa. The internal layer exhibits no signs of
inflammation, but many small (1–2 mm in diameter),
often confluent depressions, which have been interpreted
as features of tubercles. WB 354, a 24 year old male, died
from tuberculosis of the peritoneum. The internal layer
shows few very tiny new bone formations within the sagittal sinus and small depressions by tubercles in the middle and occipital cranial base. The sample has been taken
from a pathomorphologically completely inconspicuous
region of the skull. WB 594, a 22 year old male, died from
tuberculosis of the peritoneum and meningitis. The internal lamina shows slight newly build bone structures
within the sinus and imprints of tubercles exclusively at
the posterior cranial base. These skull remains are macroscopically well preserved because they have never been
exposed to soil.
Finally, two bone samples (also from the midshaft femur)
were taken from the site Hainburg (Lower Austria) that
dates back to the early Bronze Age (ca. 2,000-1,500 BC):
HB284 (a female, age-of-death 21–24), and HB310 (a
female, age-of-death 30–35). From this epoch, bones with
morphological alterations due to tuberculosis have never
been reported from Austrian localities (Ninvestigated =
2000). Therefore, we considered them as negative controls.
DNA extraction, PCR, and DNA sequencing
Small samples were chopped off the bones and ground
into a fine powder using a mortar under liquid nitrogen.
Approximately 0.1–0.3 gram of bone powder was subsequently transfered into a 2.0 ml screw-capped centrifuge
tube and DNA was extracted according to the silica based
protocol with modifications [15,16].
The DNA extracts were subjected to a series of PCR amplifications using primer pairs (table 1) previously described
[1,2]. The primer pairs proposed by [1] target the insertion
sequence IS6110. This insertion was shown to be specific
Table 1: Primers used for amplifying M. tuberculosis target DNA
Primer
Length of product
Sequence 5' – 3'
Reference
IS1081_F2
IS1081_R2
IS1081_R3
OxyR_F3
OxyR _R1
OxyR _F4
pncA_F2
pncA _R2
pncA _R3
D1flanking_F
D1flanking _R2
D1flanking _R3
D1internal _F3
D1internal _R3
D1internal _R4
TbA
TbB
TbC
TbD
135 bp
CTGCTCTCGACGTTCATCGCCG
GGCACGGGTGTCGAAATCACG
TGGCGGTAGCCGTTGCGC
CACTGCCTACGCGACCAGACG
TCTGCGGAATCAGTGTCACC
AGACGCTCGATGCTGCCCAA
GGCGGACTACCATCACGTCG
GGAGTACCGCTGACGCAATGCGGT
GGCCACGACGAGGAATAGTC
ATCGAAAGGCTAACGGGTGC
CTGCTCGCCGAGTTGGTCGATA
TCGATACCGTCGATCGTGTCAAAG
CGAGCTACGACGCTCGCTATTA
GCATATCGTGATCCGTCTCGAT
CTCGATCATCAGTAGTTCGGGATTC
CTCGTCCAGCGCCGCTTCGG
CCTGCGAGCGTAGGCGTCGG
GCTTCGGACCACCAGCACCT
GCGTCGGTGACAAAGGCCAC
Insertion sequence IS1081
[2]
113 bp
110 bp
94 bp
117 bp
96 bp
112 bp
96 bp
115 bp
105 bp
TbA/TbB:
120 bp
TbC/TbD:
95 bp
oxidative stress regulator OxyR pseudogene
[2]
Pyrazinamidase gene
[2]
flanking sections of TbD1 region
[2]
TbD1 region
[2]
insertion sequence IS6110
[1]
For the primers of [2], F (forward) and R (reverse) denote orientation of the primer and for each gene amplification was performed with the first
two primers followed by reamplification with the third primer in combination with one of the original primers.
Target Sequences: IS108 = Insertion sequence IS1081; OxyR = oxidative stress regulator OxyR pseudogene; pncA = Pyrazinamidase gene; D1 =
TbD1 region described in [25] that is deleted in modern strains of M. tuberculosis; TbA-TbD: insertion sequence IS6110.
Page 3 of 6
(page number not for citation purposes)
BMC Research Notes 2008, 1:83
for the M. tuberculosis complex [17], and is present in high
copy number in most M. tuberculosis strains [18]. Targeting the IS6110 insertion sequences in the M. tuberculosis
genome is considered the most sensitive approach [19],
and, therefore, most frequently applied. The primer pairs
taken from [2] target five different regions of the M. tuberculosis genome, including the repetitive IS1081 insertion
sequences.
PCR amplifications were performed using the PfuTurbo
DNA polymerase (Stratagene, La Jolla, CA, USA) or the
DyNAzyme (Finnzymes, Espoo, Finland) DNA polymerase in 1× Reaction Buffer, 0.2 mmol/L of each dNTP,
0.04% bovine serum albumin (BSA), 1 μmol/L of each
primer, and 2 μL of DNA extract (DNA concentration not
quantified). Thermal cycling conditions were: 94°C for 2
min; 32 cycles of 94°C for 50 sec, 48° – 60°C for 50 sec,
and 72°C for 1 min; and a final extension at 72°C for 10
min. PCR products were purified for direct sequencing
using 8 μL 10× diluted exoSAP-IT solution (USB Corporation, Cleveland, OH, USA) per reaction. Cycle sequencing, using the same primers as in the PCR reaction, was
performed in 10 μL reactions using 2 μL BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), 2 μL 5× Sequencing Buffer, 10
pmol primer, and 3 μL purified PCR product. Sequencing
products were purified with ethanol precipitation and
analyzed using an ABI 3100 Genetic Analyzer (Applied
Biosystems, Foster City, CA, USA).
PCR products that could not be sequenced directly were
cloned in the pCR4Blunt-TOPO plasmid vector by means
of the TOPO TA Cloning Kit (Invitrogen) and individual
clones were subsequently sequenced.
Inhibitory effect of DNA extracts
Ancient DNA extracts may contain PCR inhibiting components that can cause misleading results. In such instances
failure to obtain PCR products cannot be assigned to the
absence of the target DNA but simply to inhibition of the
reaction. In order to test for co-extracted PCR inhibitors in
the samples used in the current study, established test
PCRs targeting a ~1000 bp and a ~300 bp fragment of the
mitochondrial genome of microtine rodents were spiked
with ancient DNA extracts. Spiking PCR amplifications
[20] were performed in a final volume of 25 μL using the
Taq DNA polymerase (Roche) in 1× Reaction Buffer, 0.2
mmol/L of each dNTP, 1 μmol/L of each primer, 50 ng
genomic DNA of Microtus maximowiczii and 2 μL of DNA
extract (DNA concentration not quantified). Thermal
cycling conditions were: 94°C for 2 min; 35 cycles of
94°C for 20 sec, 56°/57°C for 30 sec, and 72°C for 60/40
sec; and a final extension at 72°C for 7 min. The primers
were Pro+ (5'-ACC ATC AGC ACC CAA AGC TG-3') and
Phe- (5'-AAG CAT TTT CAG TGC TTT GCT T-3') for the
http://www.biomedcentral.com/1756-0500/1/83
~1000 bp fragment, and Pro+ and mico3- (5'-GTA AAA
GAA GCA TTA ATT AAA-3') for the ~300 bp fragment [21].
None of the ancient DNA extracts inhibited amplification
of the test PCRs, as assessed by three replicates. PCR inhibition through ancient DNA extracts was therefore not
considered a significant problem for the selected samples.
Precautions against contamination
The bone samples were processed independently in the
DNA labs of the Natural History Museum Vienna and the
Natural History Museum Oslo following standards to
avoid contamination of samples: These include in particular, usage of DNA, DNAse, and RNAse-free consumables
and reagents, as well as pipette tips with aerosol protection filters, and UV-treatment of tubes prior to extraction
and PCR amplifications. Negative controls for extractions
(without any sample) as well as PCR reactions (without
any DNA) were included in the experimental setup. The
samples from Hainburg (Lower Austria, Bronze Age) were
considered as additional negative controls. Samples from
presumably TB-containing cases were never processed
before the experiments on the negative controls and samples of unknown infection status had been finished. In
both labs no studies of modern mycobacterial or human
DNA had been performed before, and especially no modern mycobacterial DNA was used as positive PCR controls.
Results
When subjecting the long bone samples from Kaiserebersdorf, Austria, as well as the positive and negative controls
to PCR amplification targeting various regions in the
genome of Mycobacterium tuberculosis, several PCR products were obtained. OxyR amplified for the skull WB594
using the primer pair R1/F4. The PCR targeting the IS6110
insertion sequences yielded PCR products of appropriate
size for the skulls WB354, WB565, and WB594 using
primer pair TbA/TbB, and for the long bones KE23 and
HB284, and the skulls WB354 and WB594 using primer
pair TbC/TbD.
When sequencing the obtained PCR products only
WB354 amplified with the primer pair TbC/TbD yielded a
sequence identical with the targeted IS6110 insertion
sequences of M. tuberculosis (reference sequence: AF
181860), and was therefore considered positive. The
sequence has been deposited in GenBank under the accession number FJ177511. None of the other cloned PCR
products yielded sequences with similarity to M. tuberculosis but proved unspecific PCR amplification (sequence
similarity to, e.g., sequences from Pseudomonas or various
fungi).
With the exception of the unspecific amplification of nontarget DNA of samples KE23 and HB284 when using the
TbC/TbD primer pair, DNA extracts from long bones
Page 4 of 6
(page number not for citation purposes)
BMC Research Notes 2008, 1:83
never yielded PCR products that were visible as distinct
band of appropriate size on ethidium-bromide stained
agarose gels. Even reamplification attempts were negative
for the various primer pairs.
Discussion
In the present study we aimed at diagnosing tuberculosis
in historic human long bones from 18th century burials in
Kaiserebersdorf, Austria. A positive result, i.e., PCR amplification of a DNA fragment with a nucleotide sequence
matching the IS6110 insertion sequences of M. tuberculosis
deposited in GenBank, was only obtained for the skull
WB354. This was not unexpected since this sample served
as positive control and tuberculosis had been diagnosed
earlier in this individual by means of the spoligotyping
approach [14]. The amplification of the IS6110 insertion
sequence proofs the suitability of the applied PCR
approach. However, also for this sample positive PCR
amplification was only obtained with the primer pair
TbC/TbD that targets the repetitive insertion sequences
IS6110, but not for any of the other molecular markers
tested. This may indicate that only very limited amount of
template DNA could be extracted from this particular
sample. The failure to amplify any tuberculosis specific
target DNA from the other positive skull samples may further support this interpretation. It should be considered
that a M. tuberculosis strain which did not contain IS6110
has been reported earlier [22]. Thus, the use of IS6110 as
a single marker for PCR-facilitated detection M. tuberculosis might be insufficient. Nevertheless, the IS6110 insertion sequence is very likely the most sensitive marker [19]
in the M. tuberculosis genome and yielded positive results
while other markers such as, e.g., oxyR failed [23].
However, even the IS6110 insertion sequence could not
de determined in the long bones of the samples KE20 and
KE23 from the poor house in Kaiserebersdorf, Austria.
Given the difficulties in amplifying target DNA of M.
tuberculosis in the positive skull samples, it may not be surprising that none of the test bones from the burials in Kaiserebersdorf yielded any specific PCR product, although it
seems likely from other anthropological evidence that at
least samples KE20 and KE23 relate to individuals that
suffered from tuberculosis.
Several reasons can account for the negative results on the
long bone samples from Kaiserebersdorf: First, some individuals may not have suffered from tuberculosis. This can
almost certainly be excluded for samples KE20 and KE23.
Second, no DNA was preserved in the samples from Kaiserebersdorf. With the data at hand, we can currently not
reject such interpretation. We refrained from amplifying
other human target DNA in order to test for the presence
of amplifiable DNA. The human actin gene has been suggested for this purpose [24]. However, the samples from
http://www.biomedcentral.com/1756-0500/1/83
Kaiserebersdorf have been handled extensively by
humans, and proof of authenticity of any human target
DNA would have been close to impossible. Third, the
presence of PCR inhibitors in the DNA extracts may have
prevented successful amplifications. According to the
results of our spiking experiments, this option can be
excluded. No sample from Kaiserebersdorf, Austria, prevented successful amplification of high quality test DNA.
A further reason for the failure of amplifying M. tuberculosis DNA from the samples from Kaiserebersdorf may relate
to the bone samples themselves. Long bones such as, e.g.,
the femurs that are rarely affected by tuberculosis may represent material that is hardly suitable for the molecular
detection of M. tuberculosis. This interpretation may hold
for the particular samples under study, but it has been
shown earlier that M. tuberculosis can be detected in historic femur samples [10] although with probably lower
success rate.
Conclusion
In the current study, we failed to positively diagnose
tuberculosis in DNA extracts from historic human long
bones from inmates of a poor house in Kaiserebersdorf,
Austria. Using thoracic or lumbar vertebrae for diagnosing
tuberculosis, i.e., bones that are severely affected by the
disease might have been more successful than long bones.
This issue will be further explored in a future study. We
conclude that the unpredictable state of DNA preservation
in bones from museum collections does not allow any
general recommendation of any type of bone.
Authors' contributions
LB planned the project, conducted the labwork at the
NHM, Vienna, and participated in writing and editing the
manuscript. BD and LK conducted the labwork at the
NHM, Vienna. CL conducted the labwork at the NHM,
Oslo. MTN planned the project, contributed the samples,
and edited the manuscript. EH planned the project and
participated in writing and editing the manuscript. All
authors approved the final version of the manuscript.
Acknowledgements
We gratefully acknowledge the funding by the SYNTHESYS (Synthesis of
Systematic Resources) program to LB in 2006 (AT-TAF-2968) for working
at the Natural History Museum, Vienna, Austria.
References
1.
2.
3.
4.
Konomi N, Lebwohl E, Mowbray K, Tattersall I, Zhang D: Detection
of Mycobacterial DNA in Andean Mummies. Journal of Clinical
Microbiology 2002, 40:4738-4740.
Taylor GM, Young DB, Mays SA: Genotypic analysis of the earliest known prehistoric case of tuberculosis in Britain. Journal
of Clinical Microbiology 2005, 43:2236-2240.
Roberts CA, Buikstra JE: The Bioarchaeology of Tuberculosis, A
Global View on a Reemerging Disease. University Press of Florida; 2003.
Spigelman M, Lemma E: The use of the polymerase chain reaction to detect Mycobacterium tuberculosis in ancient skeletons. International Journal of Osteoarchaeology 1993, 3:137-143.
Page 5 of 6
(page number not for citation purposes)
BMC Research Notes 2008, 1:83
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Spigelman M, Matheson C, Lev G, Greenblatt C, Donoghue HD:
Confirmation of the presence of Mycobacterium tuberculosis
complex-specific DNA in three archaeological specimens.
International Journal of Osteoarchaeology 2002, 12:393-401.
Nerlich AG, Haas CJ, Zink A, Szeimies U, Hagedorn HG: Molecular
evidence for tuberculosis in an ancient Egyptian mummy.
The Lancet 1997, 350:1404.
Fletcher HA, Donoghue HD, Taylor GM, Zanden AGM van der, Spigelman M: Molecular analysis of Mycobacterium tuberculosis
DNA from a family of 18th century Hungarians. Microbiology
2003, 149:143-151.
Taylor GM, Murphy E, Hopkins R, Rutland P, Christov Y: First
report of Mycobacterium bovis DNA in human remains from
the Iron Age. Microbiology 2007, 153:1243-1249.
Zink AR, Haas CJ, Reischl U, Szeimies U, Nerlich AG: Molecular
analysis of skeletal tuberculosis in an ancient Egyptian population. J Med Microbiol 2001, 50(4):355-366.
Zink AR, Grabner W, Nerlich AG: Molecular identification of
human tuberculosis in recent and historic bone tissue samples: the role of molecular techniques for the study of historic tuberculosis. American Journal of Physical Anthropology 2005,
126:32-47.
Fusegawa H, Wang BH, Sakurai K, Nagasawa K, Okauchi M, Nagakura
K: Outbreak of tuberculosis in a 2000-year-old Chinese population. Kansenshogaku Zasshi 2003, 77:146-149.
Kaiser C, Bachmeier B, Conrad C, Nerlich A, Bratzke H, Eisenmenger
W, Peschel O: Molecular study of time dependent changes in
DNA stability in soil buried skeletal residues. Forensic Science
International 2008, 177:32-36.
Teschler-Nicola M, Schamall D, Müller M: Pathological finds in a
poor house cemetery of the 18th Century (Wien-Kaiserebersdorf) – preliminary results. Paleopathology Association, 34th
Annual Meeting 2007:31. Abstractvolume
Prodinger W, Gerold F, Parson W, Teschler-Nicola M: Möglichkeiten einer Subtypisierung von Mycobacterium tuberculosis bei tuberkulösen Läsionen in anthropologischem
Material: explorartive Studie an Calvarien der anthropologischen Sammlung Weisbach (19. JH AD). In Proceedings 3.
Kongress der Gesellschaft für Anthropologie (GfA), Göttingen Edited by:
Schultz M, Christiansen K, Greil H, Henke W, Kemkes-Grottenthaler
A, Niemitz C, Rothe H, Schiefenhövel W, Schmidt HD, Schröder I,
Schutkowski H, Teschler-Nicola M, Wittwer-Backofen U. Schnittstelle Mensch – Umwelt in Vergangenheit, Gegenwart und Zukunft;
2000:354-356.
Höss M, Pääbo S: DNA extraction from Pleistocene bones by a
silica-based purification method. Nucleic Acids Research 1993,
21:3913-3914.
Borge T, Bachmann L, Bjørnstad G, Wiig Ø: Genetic variation in
Holocene bowhead whales from Svalbard. Molecular Ecology
2007, 16:2223-2235.
Eisenach KD, Cave MD, Bates JH, Crawford JT: Polymerase chain
reaction amplification of a repetitive DNA sequence specific
for Mycobacterium tuberculosis. Journal of Infectious Diseases 1990,
161:977-981.
Cave MD, Eisenach KD, McDermott PF, Bates JH, Crawford JT:
IS6110: conservation of sequence in the Mycobacterium
tuberculosis complex and its utilization in DNA fingerprinting. Molecular Cell Probes 1991, 5:73-80.
Donoghue HD, Spigelman M, Greenblatt CL, Lev-Maor G, Kahila BarGal G, Matheson C, Vernon K, Nerlich AG, Zink AR: Tuberculosis:
from prehistory to Robert Koch, as revealed by ancient
DNA. The Lancet Infectious Diseases 2004, 4:584-592.
Pusch CM, Bachmann L: Spiking of contemporary human template DNA with ancient DNA extracts induces mutations
under PCR and generates non-authentic mitochondrial
sequences. Molecular Biology and Evolution 2004, 21:957-964.
Haring E, Herzig-Straschil B, Spitzenberger F: Phylogenetic analysis
of Alpine voles of the Microtus multiplex complex using the
mitochondrial control region. Journal of Zoological Systematics and
Evolutionary Research 2000, 38:231-238.
van Soolingen D, de Haas PE, Hermans PW, Groenen PM, van
Embden JD: Comparison of various repetitive DNA elements
as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis. Journal of Clinical Microbiology
1993, 31:1987-1995.
http://www.biomedcentral.com/1756-0500/1/83
23.
24.
25.
Mays S, Fysh E, Taylor GM: Investigation of the link between visceral surface rib lesions and tuberculosis in a medieval skeletal series from England using ancient DNA. American Journal
of Physical Anthropology 2002, 119:27-36.
Ghossein RA, Ross DG, Salomon RN, Rabson AR: A search for
mycobacterial DNA in sarcoidosis using the polymerase
chain reaction.
American Journal of Clinical Pathology 1994,
101:733-737.
Brosch R, Gordon V, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier
K, Garnier T, Gutierrez C, Hewinson G, Kremer K, Parsons LM, Pym
AS, Samper S, van Soolingen D, Cole ST: A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proceedings
of the National Academy of Sciences USA 2002, 99:3684-3689.
Publish with Bio Med Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical researc h in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
BioMedcentral
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
Page 6 of 6
(page number not for citation purposes)