The Role of the Retinoblastoma Protein in
Mitochondrial Apoptosis
by
(MASSACHUET
INSTIT1TE
Keren Ita Hilgendorf
B.S. Biology,
University of Texas at Austin, 2007
LiBRA RIES
Submitted to the Department of Biology
In Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
at the
Massachusetts Institute of Technology
September 2013
©2013 Massachusetts Institute of Technology. All Rights Reserved
Signature of Author ...........................................
Department of Biology
June 20, 2013
C ertified by ...........................................
......................................
Jacqueline A. Lees
Professor of Biology
Thesis Supervisor
Accepted by .....................
........................
Stephen P. Bell
Professor of Biology
Chairman, Graduate Committee
The Role of the Retinoblastoma Protein in Mitochondrial Apoptosis
By
Keren Ita Hilgendorf
Submitted to the Department of Biology
On June 20th, 2013 in Partial Fulfillment of the
Requirements for the Degree of
Doctor of Philosophy in Biology
Abstract
The retinoblastoma protein (pRB) tumor suppressor is deregulated in the vast majority of human
tumors. pRB is a well-established transcriptional co-regulator that influences many fundamental
cellular processes. It has been most well characterized in its ability to block cell proliferation by
inhibiting the E2F family of transcription factors. Importantly, pRB also plays a pivotal role in
apoptosis. This function has been extensively characterized in the context of genotoxic stress.
Specifically, these studies have revealed that pRB can act in both an anti-apoptotic manner by
inducing cell cycle arrest, and a pro-apoptotic manner by transcriptionally co-activating proapoptotic genes. Here, we show that pRB can also promote TNFU-induced apoptosis.
Moreover, this investigation led us to uncover a novel, non-transcriptional and non-nuclear role
of pRB in the induction of apoptosis. Specifically, we found that pRB can enhance TNFainduced apoptosis even in the presence of an inhibitor of translation, and that a fraction of
endogenous pRB is localized at the mitochondria both in the absence and presence of treatment
with apoptotic stimuli. Further characterization revealed that pRB can directly bind to and
activate BAX, resulting in mitochondrial outer membrane permeabilization and apoptosis.
Importantly, targeting ectopically expressed pRB specifically to the mitochondria generated a
separation-of-function mutant deficient for pRB's classic, nuclear roles. Remarkably, we found
that this mito-tagged pRB mutant can promote apoptosis in response to many apoptotic stimuli,
arguing that mitochondrial pRB is a general mediator of apoptosis. Moreover, expression of this
mito-pRB mutant in vivo was sufficient to suppress tumorigenesis. Taken together, our data
uncover a role for pRB in the direct activation of mitochondrial apoptosis. To our knowledge,
this is the first characterization of a non-nuclear and transcription-independent function for pRB.
Moreover, most human tumors are wild-type for pRB, but contain alterations that result in
constitutive phosphorylation of pRB. While this functionally inactivates pRB's cell cycle
function, we show that pRB's mitochondrial role is unaffected. This raises the possibility that
this novel pro-apoptotic pRB mechanism can be exploited for chemotherapeutic treatment.
Thesis Supervisor:
Jacqueline A. Lees
Title:
Professor of Biology
2
Acknowledgments
First, I would like to thank my advisor Dr. Jacqueline Lees for her support and continuing belief
in me and my abilities. I am grateful for her faith in me and all the time and energy she spent
shaping me into the scientist I have become. I would also like to thank all the members of the
Lees Lab - the many, many hours spent in lab were also spent amongst close friends. You guys
made my time at MIT memorable and I am constantly amazed by both your brilliance and
goodness. In particular I would like to thank Alessandra Ianari, who took my younger self under
her wings and guided my scientific curiosity. I would also like to thank Mindy Maynard and
Simona Nedelcu, whose MIT years coincided almost perfectly with mine and who therefore
shared the crazy though exciting ride that is bench work. Thank you guys for listening, giving
advice, and always being there for me. I will miss you guys. I also want to thank all the other
ladies and lads of the Lees Lab, past and present, for making life at lab fun and making sure there
was always enough caffeine in my system. You guys have become my MIT family!
I would also like to thank my classmates, in particular Lauren Surface, Emily Rosowski, Zach
Whitfield, David Weinberg, and Liron Bar-Peled, for the many amazing graduate school
memories, including our yearly ski trips. I truly believe that the emphasis on class community is
one of the strengths of the MIT biology graduate program. I am grateful for all the life-long
friends I have made amongst my colleagues and can't wait to see the amazing things you all will
achieve in the future.
I want to particularly thank my family for all of their love and support. First and foremost that
means my parents, whose unwavering belief in me and unconditional love are the basis of
everything I do. Thank you for your guidance, but also reminding me that there is life outside
school. Your love for each other and us is an inspiration to me. I also want to thank my other
family members, in particular my brother Ingo, his wife Julia, and my cousin Shalev and his
adorable family. When I moved here to Boston for graduate school, I did not imagine that I
would soon be living in the same city as all of you guys! Shalev, I am so proud of you and wish
you the best of luck with your own career. I miss our coffee breaks and hope that we will have
opportunity to have many more in the future. You are brilliant, both scientifically and
personally, and truly an inspiration to me. Ingo, you are the best big brother anybody could
have! I am beyond proud of the man, doctor, and husband you have become. I wish you and
Julia all the best and will miss living only a T-stop away. But, like with Shalev, I will keep my
fingers crossed that our scientific careers (and therefore geography) will cross paths again at
some point.
Last, but certainly not least I want to thank Zach Whitfield. I can hardly believe that we finally
made it! You were and continue to be my rock and source of sanity and I don't know if I could
have done this without you by my side - understanding and commiserating when necessary, but
also reminding me of what's really important. I am so excited about spending the rest of my life
with you and all the experiences and memories we will continue to make together. You mean
the world to me and I can't (and don't want to) imagine life (past, present, and future) without
you. Ad meah v'esrim beyachad.
3
Table of Contents
A bstract...........................................................................................................................................2
A cknow ledgm ents ..........................................................................................................................
3
Chapter One: Introduction .........................................................................................................
7
Part I: The Retinoblastom a Tum or Suppressor Protein ....................................................
8
A : D iscovery of the Retinoblastom a Protein ..................................................................
8
B: Functions of the Retinoblastom a Protein ..................................................................
9
i: Structure and Posttranslational Modifications of the Retinoblastoma Protein
................................................................................................................................
10
ii: Regulation of Cell Cycle Entry .....................................................................
14
iii: Non-canonical functions of the Retinoblastoma Protein..............................
17
Part II: Apoptosis and the R etinoblastom a Protein.........................................................
A: Cell D eath and Apoptosis ........................................................................................
i:
A poptosis ....................................................................................................
21
21
21
a) The M itochondrial Pathw ay ..............................................................
25
b) The Extrinsic Apoptotic Pathway .....................................................
28
B: The Retinoblastorma Protein functions in Apoptosis................................................
31
i:
The Retinoblastoma Protein as an Anti-apoptotic Factor ...........................
31
ii: The Retinoblastorna Protein as a Pro-apoptotic Factor ..............................
34
References .................................................................................................................................
38
Chapter Two: The retinoblastoma protein induces apoptosis directly at the mitochondria
........................................................................................................................................................
58
A bstract .....................................................................................................................................
59
Introduction ..............................................................................................................................
60
Results .......................................................................................................................................
63
pRB is pro-apoptotic in response to TNFa treatment even in the presence of an inhibitor
of translation ......................................................................................................................
63
4
pRB activates mitochondrial apoptosis in a BAX-dependent manner...........................65
pRB directly activates Bax and induces cytochrome c release from isolated mitochondria
70
............................................................................................................................................
The mitochondrial function of pRB induces apoptosis even in the absence of pRB's
nuclear functions...........................................................................................................
73
M ito-targeted pRB suppresses tumor growth in vivo ....................................................
78
D iscussion..................................................................................................................................83
89
M aterials and M ethods .........................................................................................................
Acknowledgm ents.....................................................................................................................97
98
References .................................................................................................................................
Chapter Three: Regulation of the mitochondrial function of pRB........................................104
A bstract ...................................................................................................................................
105
Introduction ............................................................................................................................
106
Results .....................................................................................................................................
109
Ectopic pRB expression induces effector caspase cleavage and apoptosis within hours
10 9
..........................................................................................................................................
pRB induces mitochondrial apoptosis in a BH3-independent manner ............................ 111
pRB also acts as a sensitizer of Bcl2 to induce transcription-independent apoptosis ..... 116
Other potential m itochondrial pRB functions..................................................................118
Mitochondrial pRB function is regulated differently than pRB's anti-proliferative
function ............................................................................................................................
121
Discussion................................................................................................................................124
M aterials and M ethods ..........................................................................................................
128
Acknowledgm ents...................................................................................................................130
References ...............................................................................................................................
131
Chapter Four: Discussion ..........................................................................................................
135
Part I: Parallels between pRB and p53 ................................................................................
138
Part 11: Characterization of m itochondrial pRB function .................................................
140
A : How is m itochondrial localization of pRB regulated .................................................
140
B: How is m itochondrial pRB activity regulated.............................................................142
5
C: Conclusion...................................................................................................................145
Part III: Contribution of mitochondrial pRB function to tumor suppression ................. 145
A: Contribution of mitochondrial pRB function to tumor suppression and development
..........................................................................................................................................
146
B: Therapeutic Potential ..................................................................................................
149
C : Conclusion...................................................................................................................149
References ...............................................................................................................................
Appendix A: The Role of the Pocket Protein Family and the E2F Transcription Factor
Fam ily in Apoptosis ..................................................................................................................
151
156
Abstract ...................................................................................................................................
157
Introduction ............................................................................................................................
158
Results .....................................................................................................................................
161
In response to genotoxic stress, pRB interacts specifically with E2FI, not E2F2, E2F3,
161
and E2F4 ..........................................................................................................................
In response to genotoxic stress, p107 interacts with E2F1, E2F2, and E2F3..................163
Only pRB, not p107 and p130, promotes TNFa-induced apoptosis................................165
D iscussion................................................................................................................................168
M aterials and M ethods ..........................................................................................................
171
Acknow ledgm ents...................................................................................................................173
R eferences ...............................................................................................................................
Biographical N ote.......................................................................................................................177
6
174
Chapter One
Introduction
7
The retinoblastoma protein (pRB) tumor suppressor is affected in most cancers. pRB
functions as a transcriptional co-regulator in many cellular processes including proliferation and
apoptosis. In investigating its role in TNFa-induced apoptosis, I have uncovered a novel
function of pRB in inducing apoptosis directly at the mitochondria. In this chapter I will
introduce the pRB tumor suppressor and the apoptotic pathway from a historical perspective,
with a particular emphasis on discussing the myriad cellular roles of pRB as well as the
regulation of mitochondrial apoptosis induction. I will conclude with a summary of our current
understanding of pRB's role in apoptosis.
Part I:
A:
The Retinoblastoma Tumor Suppressor Protein
Discovery of the Retinoblastoma Protein
The retinoblastoma protein derives its name from retinoblastoma, a malignant tumor of
the eye and one of several heritable forms of childhood cancer. About half of the cases occur in
young children from affected families, where retinoblastoma can occur bilaterally. The
remaining cases typically occur unilaterally and sporadically in the general population. Analysis
of the hereditary pattern of retinoblastoma led Alfred Knudson to postulate the two-hit
hypothesis (Knudson, 1971), which argues that retinoblastoma is a result of two mutational
events, now known to inactivate both copies of a single gene. In the sporadic form of the
disease, both copies of the gene must be inactivated in the same cell. In contrast, in the inherited
or childhood form of the disease, one inactive copy of the gene is inherited. Thus, only the
second copy needs to be lost somatically, an event referred to as loss of heterozygosity, for
retinoblastoma to develop. This results in a dramatically higher chance of developing the disease
at multiple sites and in both eyes (bilaterally). Analysis of a subset of retinoblastoma samples
8
mapped susceptibility to retinoblastoma to chromosome 13q14 (Benedict et al., 1983; Dryja et
al., 1984), allowing for the subsequent cloning of the retinoblastoma protein gene, RB-1, as the
first tumor suppressor (Friend et al., 1987; Fung et al., 1987; Lee et al., 1987b). Further
molecular analysis of RB-] revealed that it encodes a primarily nuclear phosphoprotein that is
approximately 110 kilodaltons in size (Lee et al., 1987a). It was later shown that pRB function is
deregulated in most, if not all human tumors (Sherr and McCormick, 2002). However,
inactivating mutations in RB-I itself are only found in about one-third of human tumors and are
most prevalent in retinoblastoma, osteosarcoma, and small cell lung carcinoma (Chauveinc et al.,
2001; Kaye and Harbour, 2004; Weinberg, 1992). In contrast, the majority of human tumors
carry mutations in the upstream regulatory pathway, which results in inactivation of some, but
not all of the functions described below (Sherr and McCormick, 2002).
B:
Functions of the Retinoblastoma Protein
Much of the early structural and functional analyses of pRB were informed by the study
of how small DNA tumor viruses cause transformation of cells in vitro and tumor formation in
vivo. Identification of the viral oncoproteins ElA, large T-antigen, and E7 in adenovirus, simian
virus 40, and human papillomavirus, respectively, led to the discovery of pRB as one of their
main cellular targets and suggested that pRB normally functions to suppress cellular
transformation and tumor fornation (DeCaprio et al., 1988; Dyson et al., 1989; Whyte et al.,
1988). It was also found that pRB underwent phosphorylation in a cell cycle dependent manner,
suggesting that this tumor suppressing activity relates to regulation of proliferation (Buchkovich
et al., 1989; Chen et al., 1989; DeCaprio et al., 1989; Milhara et al., 1989). Finally, it was shown
that some viral oncoproteins preferentially bind hypophosphorylated pRB (Ludlow et al., 1990)
and mutational analysis of these viral oncoproteins identified a highly conserved LxCxE motif
9
that is necessary for pRB binding (Dyson et al., 1990; Dyson et al., 1989; Munger et al., 1989;
Stabel et al., 1985; Vousden and Jat, 1989). This led to the hypothesis that the tumor suppressor
pRB can be inactivated in three ways: mutation of RB-1, binding to a viral oncoprotein, or
phosphorylation (either as part of the normal cell cycle or constitutively as a result of mutations
in the regulatory pathways).
i.
Structure and Posttranslational Modifications of the Retinoblastoma Protein
Detailed biochemical analysis of the 928 amino acid pRB protein revealed that it consists
of three structural domains - the N-terminal domain, the Small Pocket, and the C-terminal
domain (Figure 1). Naturally-occurring mutations in RB-] and the LxCxE binding cleft
recognized by viral oncoproteins are located in the Small Pocket (Hu et al., 1990; Huang et al.,
1990; Kaelin et al., 1990), suggesting that this region is particularly important for tumor
suppression. The Small Pocket in turn contains the A and B folds, which interact to form a
dumbbell shaped globular domain (Lee et al., 1998). The two folds are highly conserved
amongst all members of the pocket protein family (pRB, p107 and p13 0) and are separated by a
poorly conserved region called the spacer (Dynlacht et al., 1994; Mulligan and Jacks, 1998; Zhu
et al., 1995). The Small Pocket and C-terminal domain compose the Large Pocket, which has
been shown to be both necessary and sufficient for tumor suppression (Hiebert, 1993; Qin et al.,
1992; Yang et al., 2002). The bipartite nuclear localization signal of pRB maps to the C-terminal
domain. The highly conserved LxCxE binding cleft that was identified by virtue of being
recognized by viral oncoproteins is now known to mediate interactions with many cellular
proteins that also contain the LxCxE motif and that play a role in many cellular processes
including proliferation, apoptosis, and differentiation.
10
P
P
PP
PPPPPPP
N-terminal domain
Small Pocket
C-terminal domain
Large Pocket
LXCXE binding domain
-
Nuclear Localization Signal
Figure 1. Structure of the Retinoblastoma Protein. pRB is comprised of three general
domains, the N-terminal domain, the Small Pocket, and the C-terminal domain. Together the
Small Pocket and C-terminal domain fonn the Large Pocket, which is both necessary and
sufficient for tumor suppression. The LxCxE binding cleft is localized in the Small Pocket
and the Nuclear Localization Signal is localized in the C-terminal domain. pRB contains
several CDK-phosphorylation sites, and their approximate localization is denoted by a "P".
11
As mentioned above, pRB is phosphorylated in a cell-cycle dependent manner, which
inactivates its cell cycle function (described in detail in the next subsection). pRB is
hypophosphorylated in non-proliferating cells and in early G 1, and becomes increasingly more
phosphorylated as cyclin-CDKs become activated and the cell enters the cell cycle (Sherr,
1994). During mitosis, pRB is dephosphorylated, reactivating its cell cycle function (Ludlow et
al., 1993). Phosphorylation does not affect the stability of the protein, but instead affects pRB
activity by disrupting intermolecular interactions and promoting intramolecular interactions
(Chinnam and Goodrich, 2011). To date, 16 putative CDK phosphorylation sites have been
identified and mutation of 11 of these sites together results in a constitutively active pRB protein
with regard to cell cycle regulation (Knudsen and Wang, 1997). Cyclin-CDK kinases are in turn
regulated by CDK inhibitors, including p16 (Lukas et al., 1995; Serrano et al., 1993).
Importantly, several tumorigenic events, including inactivating mutations affecting CDK
inhibitors or gene amplifications and gain-of-function mutations affecting cyclin-CDKs, result in
constitutive hyperphosphorylation of pRB and thus abnormal proliferation (Figure 2).
Interestingly, hyperphosphorylated pRB appears to be less nuclear than hypophosphorylated
pRB (Mittnacht and Weinberg, 1991). It is unclear whether this reflects a loss of nuclear
tethering of hyperphosphorylated pRB as a result of differential protein and chromatin
interactions or a more active export mechanism (Fulcher et al., 2010; Jiao et al., 2006; Jiao et al.,
2008; Roth et al., 2009). Notably, this cytoplasmic pRB species includes pRB that is localized to
mitochondria (Ferecatu et al., 2009). This thesis provides evidence that this mitochondrial pRB
species functions in induction of apoptosis.
pRB also contains phosphorylation sites recognized by kinases other than CDKs.
Furthermore, pRB is also subject to postiranslational modifications other than phosphorylation.
12
Alterations in tumors
Pathway
Approximate Fraction
found mutated in
human tumors
Components
Melanomamesotheloma1
colon cancer, bilary tract,
esophageal& pancreatic
carcinomaJothers
p1
2/3
Melanoma, colon cancer,
sarcomas,brast cancer,
gliomas,others
Retinoblastoma, SCLC,
bladder cancer, osteo
sarcomas,others
c
yCID
CDK4
---
pRB
}
1/3
Cell Cycle Progression
Figure 2. Tumorigenic events resulting in inactivation of pRB's cell cycle function. pRB
plays an important role in regulating entry into the cell cycle. Phosporylation of pRB by
cyclin-CDKs inactivates that function resulting in progression into S phase. Tumorigenic
events that result in constitutive activation of cyclin-CDKs (loss-of-function mutations in the
CDK inhibitor p16 or gain-of-function mutations affecting cyclin-CDKs) therefore induce
formation of constitutively phosphorylated pRB and abnormal cell proliferation.
13
pRB is both phosphorylated and acetylated in response to DNA damage, although the functional
consequence of thesis modifications is poorly understood (Chan et al., 2001; Inoue et al., 2007;
Markham et al., 2006). Additionally, pRB can be sumoylated (Ledl et al., 2005), but the
function of this modification is also unclear. Finally, it has been shown that pRB contains a
caspase cleavage site near the C-terminus, which is cleaved upon TNFt treatment resulting in
removal of the C-terminal 42 amino acids of pRB (Janicke et al., 1996; Tan et al., 1997). A
knock-in mouse model expressing a non-cleavable form pRB is impaired for apoptosis (Chau et
al., 2002). Thus, the cleavage site likely plays a role in apoptosis though the mechanistic
consequence of cleavage is poorly understood.
ii.
Regulation of Cell Cycle Entry
As described above, pRB is phosphorylated in a cell-cycle dependent manner and
preferentially bound by viral oncoproteins when hypophosphorylated. This suggested that pRB's
tumor suppressive activity may relate to the regulation of cell cycle entry. It had also been
shown that adenoviral infection resulted in increased activity of the cellular transcription factor
E2F, which was known to regulate expression of genes important for proliferation (Kovesdi et
al., 1986; La Thangue and Rigby, 1987). Further studies linked these observations, establishing
that in normal cells E2F exists in a protein complex with pRB (Bandara and La Thangue, 1991;
Chellappan et al., 1991). This allowed for the cloning of the gene encoding the E2FI
transcription factor (Helin et al., 1992; Kaelin et al., 1992; Shan et al., 1992). Subsequently, it
was shown that E2F 1 interacts with hypophosphorylated pRB and this interaction results in
repression of E2F1 activity both by masking its transactivation domain (Dynlacht et al., 1994;
Flemington et al., 1993; Helin et al., 1993; Hiebert et al., 1992; Zamanian and La Thangue,
1993) and by recruiting chromatin modifiers such as histone deacetylases that result in formation
14
of more condensed chromatin (Brehm et al., 1998; Luo et al., 1998a; Magnaghi-Jaulin et al.,
1998). It was also shown that E2F1 requires heterodimerization with a second protein, a DP
family member, to activate transcription (Bandara and La Thangue, 1991; La Thangue and
Rigby, 1987). To date, eight E2F family members and three DP family members have been
identified. E2F transcription factors fall into three functional groups based on their ability to
stimulate transcription and their temporal association with promoters - activator E2Fs (1, 2, 3),
repressor E2Fs (4, 5), and a third group whose members (6, 7, 8) function predominantly as
repressors but act independently of pocket proteins (Trimarchi and Lees, 2002).
E2F transcription factors play an important role in regulating entry into the cell cycle.
Overexpression of E2FI is sufficient to drive quiescent cells to proliferate and to prevent cells
from exiting the cell cycle in response to serum starvation (Johnson et al., 1993; Qin et al., 1994;
Singh et al., 1994; Xu et al., 1995). E2F binding sites have been identified in several genes
important for proliferation, including CDC2, DHFR (dihydrofolate reductase), TK (thymidine
kinase), DNA polymerase a, and cyclin A (Nevins, 1992). In non-proliferating cells and early
GI, hypophosphorylated pRB binds and represses E2Fs (Figure 3). Upon mitogenic signaling,
cyclin-CDKs become activated, resulting in phosphorylation of pRB, release of E2Fs, and
transcriptional activation of genes important for cell cycle entry (Weinberg, 1995).
Solving of the crystal structure of the pRB binding domain of E2F bound to the Small
Pocket of pRB (Lee et al., 2002; Xiao et al., 2003) allowed for the generation of a pRB mutant
deficient for general E2F binding. Surprisingly, expression of this pRB mutant was still antiproliferative, despite loss of ability to repress E2F target genes (Chau et al., 2006; Dick and
Dyson, 2003). This suggested that pRB can also regulate proliferation in an E2F-independent
manner. Subsequently, it was shown that pRB can interact with Cdhl, resulting in degradation
15
Mitogen
F
s
cell cycle progression
cyclin/CDK
C)
cell cycle progression
Figure 3. The Retinoblastoma Protein regulates entry into the cell cycle. During GO and
early GI, pRB binds to and represses E2F transcription factors. Upon mitogenic signaling,
cyclin-CDKs become activated, resulting in hyperphosphorylation of pRB, release of E2Fs,
and transcriptional activation of genes essential for progression into S phase.
16
of Skp2 by the Anaphase Promoting Complex and accumulation of the CDK inhibitor p27
(Alexander and Hinds, 2001; Binne et al., 2007; Ji et al., 2004). Thus, pRB regulates cell cycle
entry through both E2F-dependent and -independent mechanisms and the contexts in which and
extents to which these two functions contribute to the regulation of proliferation and tumor
suppression remain to be elucidated. In addition to its role in regulating cell cycle entry, E2F 1
has also been shown to play an important role in many other cellular processes including
apoptosis. In fact, characterization of the pRB mutant deficient for general E2F binding allowed
for the identification of a second interaction site specific for E2F 1 that may be important for
E2F1-induced apoptosis (Carnevale et al., 2012; Chau et al., 2006; Dick and Dyson, 2003; Julian
et al., 2008). Furthermore, pRB has also been shown to play important roles in many other
cellular processes, both in an E2F-dependent and independent manner. In fact, more than 150
pRB-interacting proteins have been identified to date (Chinnam and Goodrich, 2011). A number
of these non-canonical pRB roles are discussed below.
iii.
Non-canonical functions of the Retinoblastoma Protein
In addition to regulating proliferation, pRB has been shown to function in a rapidly
expanding list of other cellular processes including terminal differentiation, senescence, genome
stability, mitochondrial biogenesis, metabolism, and apoptosis. The relative contribution of
these functions to tumor suppression remains an active area of research.
In general, pRB impinges on these diverse processes both via its ability to function as a
transcriptional co-factor and by serving as an adaptor protein to influence chromatin structure
both locally and genome-wide (Chinnam and Goodrich, 2011). pRB's ability to affect gene
expression via multiple mechanisms is best illustrated by its ability to repress E2F activity. As
mentioned above, pRB physically interacts with and blocks the transactivation domain of E2F.
17
In addition, pRB also affects gene expression as an adaptor protein by recruiting chromatin
modifiers to E2F binding sites. pRB has been shown to interact directly with numerous
chromatin modifiers and some of these interactions have been mapped to the LxCxE binding
cleft (Dahiya et al., 2000). Specifically, pRB represses E2F target genes by recruiting histone
modifiers such as histone deacetylates (HDAC I, HDAC2), histone methyltransferases
(DNMT 1), histone demethylases (RBP2), and histone remodeling complexes (Brgl, Brm)
(Benevolenskaya et al., 2005; Brehm et al., 1998; Dunaief et al., 1994; Luo et al., 1998a;
Magnaghi-Jaulin et al., 1998; Robertson et al., 2000; Strober et al., 1996; Trouche et al., 1997).
Thus, pRB influences expression of genes, including E2F target genes important for cell cycle
progression, via multiple mechanisms.
pRB can also promote both stress- and oncogene-induced cellular senescence (Chicas et
al., 2010; Narita et al., 2003; Robertson et al., 2000), a stable form of cell cycle arrest and an
important barrier to cellular transformation (Braig et al., 2005; Collado et al., 2005).
Specifically, re-expression of pRB in cancer cells can result in induction of senescence and,
conversely, loss of pRB in senescent mouse embryonic fibroblasts (MEFs) causes cell cycle reentry (Sage et al., 2003; Xu et al., 1997). pRB functions in senescence by regulating expression
of E2F target genes involved in DNA replication as well as regulating fornation of senescence
associated heterochromatic foci (Chicas et al., 2010; Narita et al., 2003). Thus, pRB regulates
induction of senescence via multiple mechanisms.
Additional studies indicate that loss of pRB function results in chromosome instability
and aneuploidy (Bester et al., 2011; Hernando et al., 2004; Manning and Dyson, 2011). pRB
functions in maintaining genome stability in part by regulating expression of mitotic genes,
including MAD2, an E2F target gene and spindle assembly checkpoint protein (Schvartzman et
18
al., 2011; Sotillo et al., 2010). Furthermore, pRB regulates expression of E2F target genes
important for DNA replication and loss of pRB has been shown to result in insufficient
nucleotide biosynthesis and consequently replication fork stalling (Barbie et al., 2004; Bester et
al., 2011; Knudsen et al., 2000). Finally, pRB loss also results in a general defect in chromatin
condensation particularly at telomeric and centromeric regions, as a result of pRB's interaction
with both chromatin modifiers and condensin II (Coschi et al., 2010; Garcia-Cao et al., 2002;
Gonzalo et al., 2005; Isaac et al., 2006; Longworth et al., 2008; Manning et al., 2010).
pRB also plays an important role in regulating terminal differentiation. Rb-mutant
embryos die in utero and display severe defects, including abnormal proliferation and
differentiation of neuronal tissues and the lens (Clarke et al., 1992; Jacks et al., 1992; Lee et al.,
1992). pRB's importance in differentiation is in part a consequence of its role in mediating cell
cycle exit. However, pRB can also directly interact with and activate or repress lineage-specific
transcription factors. pRB plays an active role in muscle differentiation by potentiating MyoD
activity (Zhang et al., 1999a; Zhang et al., 1999b). pRB also regulates cell fate commitment into
fat and bone via direct interaction with the lineage-specific transcription factors C/EBP, PPARy,
and Runx2, respectively (Berman et al., 2008; Calo et al., 2010; Thomas et al., 2001).
More recently, pRB has been shown to regulate mitochondrial biogenesis and
metabolism. Specifically, loss of pRB is associated with mitochondrial defects in part via its
interaction with RBP2 and regulation of expression of genes encoding mitochondrial proteins
(Lopez-Bigas et al., 2008; Sankaran et al., 2008; Takahashi et al., 2012). Similarly, loss of pRB
is also associated with changes in expression of genes involved in oxidative phosphorylation and
glutathione metabolism (Blanchet et al., 2011; Nicolay et al., 2013). Thus, there is a newly
19
appreciated role of pRB in regulating mitochondrial functions, albeit all by affecting nuclear
gene expression.
Finally, pRB is also an important regulator of apoptosis and can act in both a proapoptotic and anti-apoptotic manner. This dichotomous nature of pRB in regulating apoptosis is
discussed in detail below. Briefly, pRB was originally characterized as an anti-apoptotic factor
and loss of pRB in MEFs results in an increased sensitivity to genotoxic stress (Knudsen and
Knudsen, 2008), perhaps as a consequence of failure to arrest the cell cycle and increased
chromosomal instability (Bosco et al., 2004; Burkhart and Sage, 2008; Knudsen et al., 2000;
Manning and Dyson, 2011). In contrast, and more consistent with its tumor suppressive
function, pRB can also promote apoptosis in highly proliferative cells by activating transcription
of pro-apoptotic E2F I target genes in response to apoptotic stimuli such as DNA damage (Araki
et al., 2008; Carnevale et al., 2012; Ianari et al., 2009; Knudsen et al., 1999; Korah et al., 2012).
This thesis provides evidence that extends the pro-apoptotic role of pRB to a previously
unappreciated, transcription-independent function of pRB directly at the mitochondria.
20
Part 11:
A:
Apoptosis and the Retinoblastoma Protein
Cell Death and Apoptosis
Apoptosis or programmed cell death is a conserved cellular process in all metazoans. It
is essential for organogenesis and tissue formation in development and for cellular homeostasis
in adults. Excessive cell death may result in degenerative diseases, immunodeficiency, and
infertility, while insufficient cell death contributes to cancer and autoimmune diseases (Danial
and Korsmeyer, 2004).
Apoptosis is characterized by distinct morphological changes including cell membrane
blebbing, cell shrinkage and rounding, chromatin condensation, and DNA fragmentation,
ultimately resulting in the formation of apoptotic bodies which are engulfed by macrophages or
neighboring cells (Kerr et al., 1972). The biochemical processes that lead to these morphological
changes are discussed in detail below. However, in addition to apoptosis, cells can also undergo
cell death via other processes including necrosis and autophagy. In contrast to apoptosis,
necrosis involves loss of membrane integrity and disruption of the cell, resulting in an
inflammatory response (Leist and Jaattela, 2001). Finally, cells can also undergo cell death via a
process called autophagy, a conserved lysosomal pathway involved in protein and organelle
turnover.
i.
Apoptosis
The original genetic understanding of apoptosis came from studies performed in C.
elegans, when it became apparent that the same 131 cells of 1090 cells die during development
(Brenner, 1974; Sulston, 1976). This lead to the identification of genes involved in regulating
this process (Ellis and Horvitz, 1986). Specifically, CED-3 and CED-4 were shown to be
21
required for apoptosis (Figure 4). CED-4 acts upstream of CED-3 and can be inhibited by the
anti-apoptotic protein CED-9 (Hengartner and Horvitz, 1994a). Finally, the pro-apoptotic
protein EGL-1 can inhibit CED-9 by displacing CED-4 (Conradt and Horvitz, 1998).
Cloning and characterization of ced-3 revealed that it was related to the mammalian
interleukin 1p converting enzyme (ICE, caspase 1) and that expression of either in mammalian
cells resulted in induction of apoptosis (Yuan et al., 1993). Subsequently, other mammalian
homologs for nematode apoptotic proteins were identified. CED-4 activity could be
reconstituted in vitro by 3 mammalian protein, Apaf-1, cytochrome c, and caspase 9 (Li et al.,
1997; Zou et al., 1997). The anti-apoptotic gene ced-9 turned out to be the worm homolog of the
mammalian oncogene Bcl2 (Hengartner and Horvitz, 1994b; Vaux et al., 1992), first identified at
the chromosomal breakpoint of t(14; 18) in human follicular B cell lymphoma (Bakhshi et al.,
1985; Cleary and Sklar, 1985; Tsujimoto et al., 1985). Finally, the mammalian homolog of
EGL-1 is a BH3-only protein.
There are two general apoptotic pathways in mammals, the intrinsic or mitochondrial
pathway and the extrinsic or death receptor pathway. These two pathways are described in detail
below. However, two protein families (the caspase family and the Bcl2 family) are central to our
understanding of these two pathways and will therefore be introduced first.
Caspases are main effectors of apoptosis. As noted above, the mammalian CED-3
homolog ICE or Caspase 1 is the founding member of this family of proteases. There are 14
mammalian caspases which fall into three functional groups: inflammatory caspases, initiator
apoptotic caspases, and effector apoptotic caspases. The name caspase derives from the fact that
the catalytic triad contains a cysteine and that cleavage occurs after an aspartic acid residue
(Thornberry and Lazebnik, 1998). All caspases are synthesized as inactive zymogens composed
22
Mammals
C. elegans
EGL-1
IH3-ony
I
I
I
CEO-31-
Figure 4. Apoptotic pathway components in C. elegans and mammals. The apoptotic
pathway is highly conserved. Pathway components were first identified in C. elegans via
genetic screens. Simplified schematic of mammalian apoptotic pathway shows nematode
homologs.
23
of a pro-domain, a large subunit, and a small subunit. Caspase cleavage (auto-catalytic or as part
of a cascade) results in the formation of an active tetramer that is composed of two heterodimers,
which in turn consist of a large and small subunit with the active site at the interface (Danial and
Korsmeyer, 2004). Initiator caspases are auto-catalytic, while effector caspases are activated by
initiator caspases and in turn process more than 100 substrates that result in the characteristic
morphological changes associated with apoptosis, including apoptotic proteins, structural
proteins, DNA repair proteins, and cell cycle related proteins (Hotti et al., 2000; Kothakota et al.,
1997; Ku et al., 1997; Levkau et al., 1998; Li et al., 1998; Luo et al., 1998b; Rao et al., 1996;
Schmeiser et al., 1998; Zhou et al., 1998).
The founding member of the Bcl2 family is the mammalian CED-9 homolog Bcl2, which
also founded a new class of oncogenes, regulators of cell death. The realization that Bcl2
localizes to mitochondria, lead to the recognition of the central importance of this organelle to
apoptosis. The identification of BAX as an interactor of Bcl2 and its subsequent characterization
established that the Bcl2 family contains both pro- and anti-apoptotic proteins (Oltvai et al.,
1993). Furthermore, the mammalian homolog of EGL-1, a BH3-only protein, is also a Bcl2
family member. The Bcl2 family is particularly important for the intrinsic apoptotic pathway
and will be discussed in more detail below.
It should be noted that activation of apoptosis via either the intrinsic or extrinsic
pathways does not require new protein synthesis. However, changes in gene expression in
response to various stimuli can alter the concentration of apoptotic regulators, including caspases
and Bcl2 family members, and in this way modulate the sensitivity of cells to apoptotic stimuli.
24
a)
The Mitochondrial Pathway
The intrinsic or mitochondrial pathway is activated in response to diverse signals of stress
and damage. Mitochondria are of central importance to this pathway by sequestering proapoptotic proteins in the intermembrane space. Bcl2 family members regulate activation of the
mitochondrial pathway by regulating permeability of the mitochondrial outer membrane and thus
release of these pro-apoptotic proteins from the intermembrane space into the cytoplasm where
they allow for activation of initiator caspase 9 (Figure 5A).
Bcl2 family members are divided into three subclasses based on the presence of 1-4
homology domains (BHl-4), which roughly correspond to x-helices (Figure 5B). The
multidomain pro-apoptotic family members (BAX, BAK) contain BH 1-3. In the inactive state,
BAX is monomeric and cytoplasmic, while BAK is monomeric and mitochondrial. Activation
of BAX and BAK is a multistep process that involves conformational changes, translocation to
and insertion in the mitochondrial outer membrane (in the case of BAX), and oligonerization
(Youle and Strasser, 2008). The resulting pore permeabilizes the mitochondrial outer membrane
(Mitochondrial Outer Membrane Permeabilization, MOMP) and releases apoptotic proteins into
the cytoplasm. Thus, BAX and/or BAK are required for intrinsic apoptosis (Lindsten et al.,
2000; Wei et al., 2001). Among the pro-apoptotic proteins released upon MOMP is cytochrome
c, identified as one of the three mammalian factors required for reconstituting CED-4 activity in
vitro. In the cytoplasm cytochrome c binds to Apaf-I and caspase 9, forming the apoptosome.
This results in auto-catalytic activation of the initiator caspase 9 and subsequent activation of
effector caspases and apoptosis. BAX/BAK can be inhibited by another subclass of Bcl2 family
proteins called anti-apoptotic Bcl2 family members (e.g. Bcl2). These contain BH1-4, forming a
hydrophobic groove that can accommodate B1H3 domains of pro-apoptotic family members
25
A
Iactivator
cytoc
47
APOPTOSIS
B
Anti-apoptotic
family members
Multidomain, proapop-
totic family members
L
I
H 1:
'Ii
L............................
IzIzIIIz
BH3-only pro-apoptotic
family members
Figure 5. Intrinsic/Mitochondrial Pathway. (A) Activation of B113-only proteins by a
variety of apoptotic stimuli results in activation of multidomain pro-apoptotic proteins BAX
and BAK, MOMP, cytochrome c release and activation of the capsase cascade. (B)
Schematic representation of Bc62 family members and homology domains BH1-4. TM
denotes transmembrane domains.
26
(Muchmore et al., 1996; Sattler et al., 1997). Finally, pro-apoptotic BH-3 only proteins (e.g.
BID, BAD) only contain the BH3 domain and are the upstream sensors of the intrinsic pathway.
Different apoptotic stimuli activate different BH3-only proteins via different mechanisms,
including transcriptional upregulation, changes in subcellular localization, and posttranslational
modifications (Nakano and Vousden, 2001; Oda et al., 2000; Puthalakath et al., 1999; Raff,
1992; Yu et al., 2001; Zha et al., 1996). There are two types of BH3-only proteins, activators
(e.g. BID, BIM) and sensitizers (e.g. BAD, NOXA) (Letai et al., 2002; Llambi et al., 2011).
Activator BH3-only proteins can directly bind and activate BAX and BAK. In contrast,
sensitizer BH3-only proteins bind anti-apoptotic Bcl-2 family members, relieving inhibition of
activator BH3 -only proteins and/or multidomain pro-apoptotic family members BAX and BAK.
It should be noted that specific Bcl2 family members display specificity in their interactions with
other family members (Certo et al., 2006; Chen et al., 2005; Kuwana et al., 2005; Opferman et
al., 2003).
Other (non-Bcl2 family) proteins can also activate BAX and BAK, either by acting like a
BH3-only activator or sensitizer. The absence of an identified BH3 domain precludes these
proteins from being Bcl2 family proteins. One example is p53, an important tunior suppressor
and mediator of many cellular processes including proliferation and apoptosis. p53 has been
shown to promote apoptosis via two mechanisms. In response to DNA damage, p53 can activate
transcription of pro-apoptotic genes including BH3-only proteins PUMA and NOXA (Vousden
and Prives, 2009). In addition, p53 also translocates directly to mitochondria where it can act as
a direct activator of BAX or as a sensitizer by interacting with anti-apoptotic Bcl2 family
members Bcl2 and BcLXL (Caelles et al., 1994; Chipuk et al., 2004; Chipuk et al., 2003; Dumont
et al., 2003; Haupt et al., 1995; Mihara et al., 2003). Neither a mitochondrial targeting sequence
27
nor a BH3 domain has been identified on p53. Similarly, the orphan nuclear steroid receptor
Nur77 can promote apoptosis both by activating transcription of pro-apoptotic genes (Rajpal et
al., 2003) and by translocating to mitochondria and interacting with Bcl2 (Li et al., 2000; Lin et
al., 2004). Since Nur77 does not have a mitochondrial targeting sequence, it has been suggested
that its interaction with Bcl2 localizes it to the mitochondria. No BH3 domain has been
identified yet. Another nuclear protein, histone H 1.2, has also been implicated in inducing
apoptosis directly at the mitochondria. Histone H 1.2 has been shown to trigger MOMP in a
BAK-dependent manner (Gine et al., 2008; Konishi et al., 2003; Okamura et al., 2008). The
exact mechanism of this action remains to be elucidated, including the interaction domain.
Finally, nucleophosmin, a nucleolar phosphoprotein, has been shown to locate to the cytoplasm
in response to apoptotic stimuli and participate in the activation of BAX (Kerr et al., 2007).
Thus, activation of the multidomain pro-apoptotic Bl2 family members BAX and BAK can be
regulated by a wide variety of proteins. These include activator BH3-only Bcl2 family members
as well as non-Bcl2 family members. The relative importance, in particular in vivo, of these nonBcl2 activators of apoptosis compared to BH3-only proteins remains to be determined.
b)
The Extrinsic Apoptotic Pathway
Generation of monoclonal antibodies against cell surface receptors allowed for the
identification of some antibodies that induced apoptosis (Trauth et al., 1989). This lead to the
identification and cloning of cell surface death receptors, including Fas, TNFR, and DR4 and 5
(Itoh et al., 1991; Suda et al., 1993), which mediate the extrinsic or death receptor apoptotic
pathway. In general, death ligand binding results in oligomerization of the receptor, recruitment
of the death-inducing signaling complex (DISC) which contains initiator caspase 8, and autocatalytic activation of caspase 8 (Ashkenazi and Dixit, 1998). Initiator caspase 8 can promote
28
apoptosis via two mechanisms. Caspase 8 can cleave and activate effector caspases directly or it
can cleave the BH3 -only protein BID to form tBID, which translocates to the mitochondrial
outer membrane and activates the intrinsic/mitochondrial pathway (Li et al., 1998; Luo et al.,
1998b). Thus, the two apoptotic pathways are interconnected and affect each other.
The death ligand TNFa is secreted by cells of the immune system in response to bacterial
infection. It binds the death receptor TNFR. There are two TNFRs, TNFR1 which is
ubiquitously expressed in most tissues and TNFR2 which is expressed by cells of the immune
system (Wajant et al., 2003). Binding of TNFa to TNFR1 induces a primary pro-inflammatory
response and a secondary pro-apoptotic response (Figure 6). Briefly, activation of TNFR1
results in recruitment of IKK to the signaling complex and phosphorylation and subsequent
degradation of I-KB, an inhibitor of NF-KB. This allows NF-wB to translocate to the nucleus and
activate transcription of pro-inflammatory proteins. NF-B also activates transcription of antiapoptotic proteins, inhibiting apoptosis. Prolonged exposure to TNFa, results in the recruitment
of DISC and activation of caspase 8 (Aggarwal, 2003).
Apoptosis is an important cellular process and deregulation of apoptosis can result in
diseases like cancer. Over the past few decades, many essential components involved in
apoptosis have been identified and a general picture of how these components work together to
regulate apoptosis has emerged. Nevertheless, new regulators of apoptosis are still being
discovered. This thesis provides evidence for the tumor suppressor pRB as a novel regulator of
mitochondrial apoptosis by acting as a direct activator of BAX.
29
TNFR1
NF-KB
INFLAMMATlON
-- i APOPTOSIS
Figure 6. Schematic of extrinsic/death receptor pathway induced by TNFa. TNFa
treatment elicts a primary NF-KB-mediated pro-inflammatory response which in antiapoptotic. Prolonged exposure to TNFa activates the extrinsic apoptotic pathway, which can
also activate the intrinsic/mitochondiral pathway via the BH3-only protein tBID.
30
B:
The Retinoblastoma Protein functions in Apoptosis
As described above, apoptosis is one of the many cellular processes ascribed to pRB. In
fact, pRB has been characterized as both an anti-apoptotic and pro-apoptotic factor. The
evidence supporting these two opposing mechanisms of action is discussed in detail below.
The Retinoblastoma Protein as an Anti-apoptotic Factor
Earliest evidence for the anti-apoptotic role of pRB emerged from the characterization of
the Rb-null embryo, which displays ectopic proliferation and increased levels of apoptosis in
several tissues including the nervous system, lens, and skeletal muscle (Clarke et al., 1992; Jacks
et al., 1992; Lee et al., 1992). Subsequent studies using tetraploid aggregation and conditional
knockout mouse models revealed that apoptosis in many tissues is rescued by providing the Rbnull embryo with a wildtype placenta and thus is mostly non-cell autonomous (de Bruin et al.,
2003; Wenzel et al., 2007; Wu et al., 2003). Further inspection of the Rb-null placenta revealed
that loss of pRB in trophoblasts results in excessive proliferation and consequently disruption of
the normal placental architecture and vascularization. This results in decreased placental
transport function and hypoxia in embryonic tissues, causing the increased levels of apoptosis
observed in many Rb-null tissues. However, while providing the Rb-null embryo with a
wildtype placenta rescued most of the apoptotic phenotype in the central nervous system, it did
not rescue increased levels of apoptosis observed in the lens and skeletal muscles. Further
inspection showed that there was a coexistence of cell death and ectopic mitosis, suggesting that
apoptosis was linked to a defect of cells to growth arrest and respond to differentiation signals.
As described above, pRB's role in promoting cell cycle arrest and terminal differentiation has
been well established. These observations lead to the postulation of the conflict model, which
31
argues that pRB's anti-apoptotic role is an indirect consequence of its ability to promote cell
cycle arrest and undergo differentiation. Thus, there are two explanations for the increased
levels of apoptosis observed in germline Rb-null embryos. First, the hypoxic stress caused by the
Rb-null placenta (a result of pRB's role in regulating proliferation of trophoblasts) contributes to
increased levels of apoptosis observed in some tissues including the neuronal tissue. Second,
there is a conflict of signals in some tissues, such as the lens and skeletal muscle, which is caused
by an inability to undergo cell cycle arrest and terminal differentiation in response to
differentiation signals in the absence of pRB. This triggers apoptosis as a default outcome of
ectopic mitosis. Analysis of conditional knockout Rb mouse models supports this hypothesis.
For example, loss of pRB in the central nervous system results in increased levels of proliferation
but no apoptotic defect, arguing that the cell cycle defect is cell-autonomous while the apoptotic
phenotype observed in the Rb-null embryo was not (MacPherson et al., 2003). However, loss of
pRB in the lens results in both ectopic mitosis and increased levels of apoptosis in areas of the
lens that normally contain differentiated lens fiber cells (MacPherson et al., 2003). Similarly,
loss of pRB in proliferating myoblasts causes elevated levels of apoptosis in vivo and induction
of differentiation in cultured Rb-deficient primary myoblasts results in high levels of apoptosis
(Huh et al., 2004). In contrast, loss of pRB after differentiation (in differentiatiated myotubes in
vivo) results in a normal muscle phenotype (Huh et al., 2004). Thus, pRB's anti-apoptotic role
appears to be an indirect consequence of its cell cycle and differentiation functions.
Consistent with these in vivo data, analysis of the role of pRB in apoptosis in cultured
cells also shows that pRB can act in an anti-apoptotic manner. Early studies showed that pRB
protects cultured primary murine fibroblasts from apoptosis induced by genotoxic stress
(Almasan et al., 1995; Bosco et al., 2004; Knudsen et al., 2000). Further analysis revealed that in
32
response to treatment with genotoxic agents, MEFs and mouse adult fibroblasts that are deficient
for pRB fail to activate DNA damage checkpoints and inappropriately proceed into S-phase.
Since this triggers apoptosis as a default outcome, pRB deficiency increases sensitivity to
genotoxic stress. Thus, pRB can act in an anti-apoptotic manner both in vivo and in vitro, though
this is at least in part an indirect consequence of pRB's role in mediating cell cycle arrest.
It has also been proposed that pRB can directly inhibit apoptosis by repressing E2F 1, a
known activator of apoptosis. E2FI can promote apoptosis in a manner in a p53-dependent and
-independent manner. Specifically, E2F1 can activate transcription of p 14 AR, resulting in
inhibition of Mdm2-mediated degradation of p53 and consequently induction of apoptosis (Bates
et al., 1998). E2F1 can also promote apoptosis in a p53-independent manner by directly
activating transcription of apoptotic proteins including Apaf-1, caspase 7, and p73 (Ginsberg,
2002; Moroni et al., 2001; Muller et al., 2001). Given pRB's role in repressing E2F's
proliferative function during quiescence and early G 1, it was proposed that pRB can also act to
directly suppress E2F1 's pro-apoptotic function in response to apoptotic stimuli. This model
predicts that pRB is inactivated in response to an apoptotic stimulus. Consistent with this
hypothesis, it has been described that pRB is cleaved at the C-terminus and degraded after
prolonged treatment with an apoptotic stimulus (Fattman et al., 2001; Janicke et al., 1996; Tan et
al., 1997). However, while the appearance of cleaved pRB correlates with induction of
apoptosis, degradation may occur later (Janicke et al., 1996). This argues that cleavage rather
than degradation inactivates pRB function. Finally and most convincingly, a pRB mutant that is
not cleavable displays decreased sensitivity to TNFa treatment both in cultured cells and in a
knock-in mouse model (Chau et al., 2002; Tan et al., 1997). These data are consistent with the
hypothesis that pRB needs to be cleaved for E2F I to promote TNFa-induced apoptosis.
33
However, cleaved pRB can still bind E2F 1 and repress its transcriptional activity (Janicke et al.,
1996). It remains to be seen how exactly pRB cleavage by caspases affects pRB's many cellular
functions to impinge on the apoptotic response.
Taken together, it is apparent that the analysis of the role of pRB in apoptosis is
complicated by its pleiotropic cellular activities. While pRB's anti-apoptotic function is well
established, this is likely an indirect effect of pRB's ability to regulate proliferation and
differentiation. However, pRB can also act in a pro-apoptotic manner in some cellular settings.
These data are discussed below.
ii.
The Retinoblastoma Protein as a Pro-apoptotic Factor
There have been a number of reports revealing a pro-apoptotic role of pRB.
Overexpression of pRB in head and neck squamous cell carcinoma, glioblastoma, prostrate, and
cervical cancer cell lines results in increased levels of apoptosis and sensitizes to radiation
treatment (Araki et al., 2008; Bowen et al., 2002; Bowen et al., 1998; Lanari et al., 2009;
Knudsen et al., 1999; Li et al., 2002). Thus, while pRB inhibits apoptosis in MEFs (Almasan et
al., 1995; Bosco et al., 2004; Knudsen et al., 2000), it promotes apoptosis in several cancer cell
lines. Similarly, expression of retinoblastoma protein in vivo can both promote and inhibit
apoptosis and this may be dependent on the cellular context. For example, expression of the
drosophila homolog of pRB in wing and eye imaginal discs has different effects depending on
the proliferation status of the cells; there is an increase in the levels of apoptosis in proliferative
tissues, while there is no effect on apoptosis in post-mitotic, differentiated cells (Milet et al.,
2010). Moreover, loss of pRB in the intestinal epithelium impairs DNA-damage induced
apoptosis (lanari et al., 2009). Taken together, this led to the hypothesis that the ability of pRB
34
to promote or repress apoptosis may be dependent on the proliferation status of the cell. The
mechanism of how pRB promotes apoptosis is discussed below.
E2F1 is a well-characterized transcriptional activator of apoptosis. Analysis of the role of
pRB in response to genotoxic and oncogenic stress in both primary and transformed cell lines
revealed that these stimuli stabilized the formation of a complex containing pRB and E2F 1,
which localized to promoters of pro-apoptotic, E2F 1 target genes that were transcriptionally
active (Ianari et al., 2009). Another study showed that in response to DNA damage, E2F1 exists
as both a free and a pRB-bound species depending on specific post-translational modifications
(Carnevale et al., 2012). Remarkably, both species of E2F1 contribute toward maximal
induction of apoptosis including transcriptional activation of pro-apoptotic, E2F 1 target genes
(Carnevale et al., 2012). These data reconcile the facts that ectopic expression of E2Fl alone is
apoptotic and that a pRB:E2F1 complex can also promote apoptosis in the context of genotoxic
stress. Finally, the pro-apoptotic function of pR3 has been extended to apoptotic stimuli other
than DNA damage. Specifically, it was also shown that apoptosis induced by TGFP requires the
formation of a pro-apoptotic complex that contains pRB, E2F 1, and the transcriptional coactivator P/CAF (Korah et al., 2012). Taken together these data show that pRB can inhibit
apoptosis in an indirect manner and promote apoptosis by directly co-activating transcription of
pro-apoptotic genes (Figure 7).
It is unclear how pRB differentially interacts with E2F 1 to either suppress proliferation or
activate apoptosis. However, as mentioned above, pRB and E2F can form two distinct
complexes (Carnevale et al., 2012; Dick and Dyson, 2003; Julian et al., 2008). Since pRB
represses E2F's proliferative activity by blocking its transactivation domain, it is unlikely that
this pRB-E2F1 complex can activate transcription of pro-apoptotic genes. It remains to be seen
35
whether the second, E2F 1-specific interaction domain mediates pRB's pro-apoptotic function
and how the formation of such a complex is regulated. Alternatively, it is possible that both free
and pRB-bound E2F1 localizes to promoters of pro-apoptotic genes and pRB contributes to
transcriptional activation by functioning as an adaptor and recruiting transcriptional coactivators. Moreover, it is unknown whether the pro-apoptotic function of pRB is restricted to
participation in a transcriptionally active, pro-apoptotic E2F 1 complex or if pRB can also
promote apoptosis via other, non-E2F-mediated mechanisms. Finally, pRB's role in apoptosis
has primarily been evaluated in response to genotoxic stress. This thesis provides evidence that
pRB can also promote apoptosis in response to TNFa. Furthermore, pRB can promote TNFQinduced apoptosis in a transcription-independent manner by directly activating BAX and
triggering mitochondrial apoptosis.
36
DNA damage
,.POP/CAF
E2F1
E2s
Cell Cycle
Progression
A POPTOSIS
Figure 7. The role of pRB in apoptosis. pRB can act in both an anti-apoptotic manner and
in a pro-apoptotic manner. In response to DNA damage pRB can protect against apoptosis by
inducing cell cycle arrest and promote apoptosis by co-activating transcription of proapoptotic genes.
37
References
Aggarwal, B.B. (2003). Signalling pathways of the TNF superfamily: a double-edged sword. Nat
Rev Immunol 3, 745-756.
Alexander, K., and Hinds, P.W. (2001). Requirement for p27(KIPI) in retinoblastoma proteinmediated senescence. Mol Cell Biol 21, 3616-3631.
Almasan, A., Yin, Y., Kelly, R.E., Lee, E.Y., Bradley, A., Li, W., Bertino, J.R., and Wahl, G.M.
(1995). Deficiency of retinoblastoma protein leads to inappropriate S-phase entry, activation of
E2F-responsive genes, and apoptosis. Proc Natl Acad Sci U S A 92, 5436-5440.
Araki, K., Abmad, S.M., Li, G., Bray, D.A., Jr., Saito, K., Wang, D., Wirtz, U., Sreedharan, S.,
O'Malley, B.W., Jr., and Li, D. (2008). Retinoblastoma RB94 enhances radiation treatment of
head and neck squamous cell carcinoma. Clin Cancer Res 14, 3514-3519.
Ashkenazi, A., and Dixit, V.M. (1998). Death receptors: signaling and modulation. Science 281,
1305-1308.
Bakhshi, A., Jensen, J.P., Goldman, P., Wright, J.J., McBride, O.W., Epstein, A.L., and
Korsmeyer, S.J. (1985). Cloning the chromosomal breakpoint of t(14;18) human lymphomas:
clustering around JH on chromosome 14 and near a transcriptional unit on 18. Cell 41, 899-906.
Bandara, L.R., and La Thangue, N.B. (1991). Adenovirus EIa prevents the retinoblastoma gene
product from complexing with a cellular transcription factor. Nature 351, 494-497.
Barbie, D.A., Kudlow, B.A., Frock, R., Zhao, J., Johnson, B.R., Dyson, N., Harlow, E., and
Kennedy, B.K. (2004). Nuclear reorganization of mammalian DNA synthesis prior to cell cycle
exit. Mol Cell Biol 24, 595-607.
Bates, S., Phillips, A.C., Clark, P.A., Stott, F., Peters, G., Ludwig, R.L., and Vousden, K.H.
(1998). p14ARF links the tumour suppressors RB and p53. Nature 395, 124-125.
Benedict, W.F., Murphree, A.L., Banerjee, A., Spina, C.A., Sparkes, M.C., and Sparkes, R.S.
(1983). Patient with 13 chromosome deletion: evidence that the retinoblastoma gene is a
recessive cancer gene. Science 219, 973-975.
38
Benevolenskaya, E.V., Murray, H.L., Branton, P., Young, R.A., and Kaelin, W.G., Jr. (2005).
Binding of pRB to the PHD protein RBP2 promotes cellular differentiation. Mol Cell 18, 623635.
Berman, S.D., Yuan, T.L., Miller, E.S., Lee, E.Y., Caron, A., and Lees, J.A. (2008). The
retinoblastoma protein tumor suppressor is important for appropriate osteoblast differentiation
and bone development. Mol Cancer Res 6, 1440-1451.
Bester, A.C., Roniger, M., Oren, Y.S., Im, M.M., Sarni, D., Chaoat, M., Bensimon, A., Zamir,
G., Shewach, D.S., and Kerem, B. (2011). Nucleotide deficiency promotes genomic instability in
early stages of cancer development. Cell 145, 435-446.
Binne, U.K., Classon, M.K., Dick, F.A., Wei, W., Rape, M., Kaelin, W.G., Jr., Naar, A.M., and
Dyson, N.J. (2007). Retinoblastoma protein and anaphase-promoting complex physically interact
and functionally cooperate during cell-cycle exit. Nat Cell Biol 9, 225-232.
Blanchet, E., Annicotte, J.-S.b., Lagarrigue, S., Aguilar, V., Clapd , C., Chavey, C., Fritz, V.,
Casas, F.o., Apparailly, F., Auwerx, J., et aL. (2011). E2F transcription factor-i regulates
oxidative metabolism. Nature cell biology 13, 1146-1152.
Bosco, E.E., Mayhew, C.N., Hennigan, R.F., Sage, J., Jacks, T., and Knudsen, E.S. (2004). RB
signaling prevents replication-dependent DNA double-strand breaks following genotoxic insult.
Nucleic Acids Res 32, 25-34.
Bowen, C., Birrer, M., and Gelmann, E.P. (2002). Retinoblastoma protein-mediated apoptosis
after gamma-irradiation. J Biol Chem 277, 44969-44979.
Bowen, C., Spiegel, S., and Gelnann, E.P. (1998). Radiation-induced apoptosis mediated by
retinoblastoma protein. Cancer Res 58, 3275-3281.
Braig, M., Lee, S., Loddenkemper, C., Rudolph, C., Peters, A.H., Schlegelberger, B., Stein, H.,
Dorken, B., Jenuwein, T., and Schmitt, C.A. (2005). Oncogene-induced senescence as an initial
barrier in lymphoma development. Nature 436, 660-665.
Brehm, A., Miska, E.A., McCance, D.J., Reid, J.L., Bannister, A.J., and Kouzarides, T. (1998).
Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597601.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.
39
Buchkovich, K., Duffy, L.A., and Harlow, E. (1989). The retinoblastoma protein is
phosphorylated during specific phases of the cell cycle. Cell 58, 1097-1105.
Burkhart, D.L., and Sage, J. (2008). Cellular mechanisms of tumour suppression by the
retinoblastoma gene. Nat Rev Cancer 8, 671-682.
Caelles, C., Helmberg, A., and Karin, M. (1994). p53-dependent apoptosis in the absence of
transcriptional activation of p53-target genes. Nature 370, 220-223.
Calo, E., Quintero-Estades, J.A., Danielian, P.S., Nedelcu, S., Berman, S.D., and Lees, J.A.
(2010). Rb regulates fate choice and lineage commitment in vivo. Nature 466, 1110-1114.
Carnevale, J., Palander, 0., Seifried, L.A., and Dick, F.A. (2012). DNA damage signals through
differentially modified E2Fl molecules to induce apoptosis. Mol Cell Biol 32, 900-912.
Certo, M., Del Gaizo Moore, V., Nishino, M., Wei, G., Korsmeyer, S., Armstrong, S.A., and
Letai, A. (2006). Mitochondria primed by death signals determine cellular addiction to
antiapoptotic BCL-2 family members. Cancer Cell 9, 351-365.
Chan, H.M., Krstic-Demonacos, M., Smith, L., Demonacos, C., and La Thangue, N.B. (2001).
Acetylation control of the retinoblastoma tumour-suppressor protein. Nat Cell Biol 3, 667-674.
Chau, B.N., Borges, H.L., Chen, T.T., Masselli, A., Hunton, I.C., and Wang, J.Y. (2002). Signaldependent protection from apoptosis in mice expressing caspase-resistant Rb. Nat Cell Biol 4,
757-765.
Chau, B.N., Pan, C.W., and Wang, J.Y. (2006). Separation of anti-proliferation and antiapoptotic functions of retinoblastoma protein through targeted mutations of its A/B domain.
PLoS One 1, e82.
Chauveinc, L., Mosseri, V., Quintana, E., Desjardins, L., Schlienger, P., Doz, F., and Dutrillaux,
B. (2001). Osteosarcoma following retinoblastoma: age at onset and latency period. Ophthalmic
Genet 22, 77-88.
Chellappan, S.P., Hiebert, S., Mudryj, M., Horowitz, J.M., and Nevins, J.R. (1991). The E2F
transcription factor is a cellular target for the RB protein. Cell 65, 1053-1061.
40
Chen, L., Willis, S.N., Wei, A., Smith, B.J., Fletcher, J.I., Hinds, M.G., Colman, P.M., Day,
C.L., Adams, J.M., and Huang, D.C. (2005). Differential targeting of prosurvival Bcl-2 proteins
by their BH3-only ligands allows complementary apoptotic function. Mol Cell 17, 393-403.
Chen, P.L., Scully, P., Shew, J.Y., Wang, J.Y., and Lee, W.H. (1989). Phosphorylation of the
retinoblastoma gene product is modulated during the cell cycle and cellular differentiation. Cell
58, 1193-1198.
Chicas, A., Wang, X., Zhang, C., McCurrach, M., Zhao, Z., Mert, 0., Dickins, R.A., Narita, M.,
Zhang, M., and Lowe, S.W. (2010). Dissecting the unique role of the retinoblastoma tumor
suppressor during cellular senescence. Cancer Cell 17, 376-3 87.
Chinnam, M., and Goodrich, D.W. (2011). RB1, development, and cancer. Curr Top Dev Biol
94, 129-169.
Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D., Schuler, M., and
Green, D.R. (2004). Direct activation of Bax by p53 mediates mitochondrial membrane
permeabilization and apoptosis. Science 303, 1010-1014.
Chipuk, J.E., Maurer, U., Green, D.R., and Schuler, M. (2003). Pharmacologic activation of p53
elicits Bax-dependent apoptosis in the absence of transcription. Cancer Cell 4, 371-381.
Clarke, A.R., Maandag, E.R., van Roon, M., van der Lugt, N.M., van der Valk, M., Hooper,
M.L., Berns, A., and te Riele, H. (1992). Requirement for a functional Rb-I gene in murine
development. Nature 359, 328-330.
Cleary, M.L., and Sklar, J. (1985). Nucleotide sequence of a t(14;18) chromosomal breakpoint in
follicular lymphoma and demonstration of a breakpoint-cluster region near a transcriptionally
active locus on chromosome 18. Proc Natl Acad Sci U S A 82, 7439-7443.
Collado, M., Gil, J., Efeyan, A., Guerra, C., Schuhmacher, A.J., Barradas, M., Benguria, A.,
Zaballos, A., Flores, J.M., Barbacid, M., et al. (2005). Tumour biology: senescence in
premalignant tumours. Nature 436, 642.
Conradt, B., and Horvitz, H.R. (1998). The C. elegans protein EGL- 1 is required for
programmed cell death and interacts with the Bcl-2-like protein CED-9. Cell 93, 519-529.
41
Coschi, C.H., Martens, A.L., Ritchie, K., Francis, S.M., Chakrabarti, S., Berube, N.G., and Dick,
F.A. (2010). Mitotic chromosome condensation mediated by the retinoblastoma protein is tumorsuppressive. Genes Dev 24, 1351-1363.
Dahiya, A., Gavin, M.R., Luo, R.X., and Dean, D.C. (2000). Role of the LXCXE binding site in
Rb function. Mol Cell Biol 20, 6799-6805.
Danial, N.N., and Korsmeyer, S.J. (2004). Cell death: critical control points. Cell 116, 205-219.
de Bruin, A., Wu, L., Saavedra, H.., Wilson, P., Yang, Y., Rosol, T.J., Weinstein, M., Robinson,
M.L., and Leone, G. (2003). Rb function in extraembryonic lineages suppresses apoptosis in the
CNS of Rb-deficient mice. Proc Natl Acad Sci U S A 100, 6546-655 1.
DeCaprio, J.A., Ludlow, J.W., Figge, J., Shew, J.Y., Huang, C.M., Lee, W.H., Marsilio, E.,
Paucha, E., and Livingston, D.M. (1988). SV40 large tumor antigen forms a specific complex
with the product of the retinoblastoma susceptibility gene. Cell 54, 275-283.
DeCaprio, J.A., Ludlow, J.W., Lynch, D., Furukawa, Y., Griffin, J., Piwnica-Worms, H., Huang,
C.M., and Livingston, D.M. (1989). The product of the retinoblastoma susceptibility gene has
properties of a cell cycle regulatory element. Cell 58, 1085-1095.
Dick, F.A., and Dyson, N. (2003). pRB contains an E2F1-specific binding domain that allows
E2F 1-induced apoptosis to be regulated separately from other E2F activities. Mol Cell 12, 639649.
Dryja, T.P., Cavenee, W., White, R., Rapaport, J.M., Petersen, R., Albert, D.M., and Bruns, G.A.
(1984). Homozygosity of chromosome 13 in retinoblastoma. N Engl J Med 310, 550-553.
Dumont, P., Leu, J.I., Della Pietra, A.C., 3rd, George, D.L., and Murphy, M. (2003). The codon
72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33, 357365.
Dunaief, J.L., Strober, B.E., Guha, S., Khavari, P.A., Alin, K., Luban, J., Begemann, M.,
Crabtree, G.R., and Goff, S.P. (1994). The retinoblastoma protein and BRG1 form a complex
and cooperate to induce cell cycle arrest. Cell 79, 119-130.
Dynlacht, B.D., Flores, 0., Lees, J.A., and Harlow, E. (1994). Differential regulation of E2F
transactivation by cyclin/cdk2 complexes. Genes Dev 8, 1772-1786.
42
Dyson, N., Bernards, R., Friend, S.H., Gooding, L.R., Hassell, J.A., Major, E.O., Pipas, J.M.,
Vandyke, T., and Harlow, E. (1990). Large T antigens of many polyomaviruses are able to form
complexes with the retinoblastoma protein. J Virol 64, 1353-1356.
Dyson, N., Howley, P.M., Munger, K., and Harlow, E. (1989). The human papilloma virus-16
E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934-937.
Ellis, H.M., and Horvitz, H.R. (1986). Genetic control of programmed cell death in the nematode
C. elegans. Cell 44, 817-829.
Fattman, C.L., Delach, S.M., Dou, Q.P., and Johnson, D.E. (2001). Sequential two-step cleavage
of the retinoblastoma protein by caspase-3/-7 during etoposide-induced apoptosis. Oncogene 20,
2918-2926.
Ferecatu, I., Le Floch, N., Bergeaud, M., Rodriguez-Enfedaque, A., Rincheval, V., Oliver, L.,
Vallette, F.M., Mignotte, B., and Vayssiere, J.L. (2009). Evidence for a mitochondrial
localization of the retinoblastoma protein. BMC Cell Biol 10, 50.
Flemington, E.K., Speck, S.H., and Kaelin, W.G., Jr. (1993). E2F-1-mediated transactivation is
inhibited by complex formation with the retinoblastoma susceptibility gene product. Proc Nat]
Acad Sci U S A 90, 6914-6918.
Friend, S.H., Horowitz, J.M., Gerber, M.R., Wang, X.F., Bogenmann, L., Li, F.P., and
Weinberg, R.A. (1987). Deletions of a DNA sequence in retinoblastomas and mesenchymal
tumors: organization of the sequence and its encoded protein. Proc Natl Acad Sci U S A 84,
9059-9063.
Fulcher, A., Dias, M., and Jans, D. (2010). Binding of pl 10 retinoblastoma protein inhibits
nuclear import of simian virus SV40 large tumor antigen. The Journal of biological chemistry
285, 17744-17797.
Fung, Y.K., Murphree, A.L., T'Ang, A., Qian, J., Hinrichs, S.H., and Benedict, W.F. (1987).
Structural evidence for the authenticity of the human retinoblastoma gene. Science 236, 16571661.
Garcia-Cao, M., Gonzalo, S., Dean, D., and Blasco, M.A. (2002). A role for the Rb family of
proteins in controlling telomere length. Nat Genet 32, 415-419.
43
Gine, E., Crespo, M., Muntanola, A., Calpe, E., Baptista, M.J., Villamor, N., Montserrat, E., and
Bosch, F. (2008). Induction of histone H1.2 cytosolic release in chronic lymphocytic leukemia
cells after genotoxic and non-genotoxic treatment. Haematologica 93, 75-82.
Ginsberg, D. (2002). E2F1 pathways to apoptosis. FEBS Lett 529, 122-125.
Gonzalo, S., Garcia-Cao, M., Fraga, M.F., Schotta, G., Peters, A.H., Cotter, S.E., Eguia, R.,
Dean, D.C., Esteller, M., Jenuwein, T., et aL. (2005). Role of the RB1 family in stabilizing
histone methylation at constitutive heterochromatin. Nat Cell Biol 7, 420-428.
Haupt, Y., Rowan, S., Shaulian, E., Vousden, K.H., and Oren, M. (1995). Induction of apoptosis
in HeLa cells by trans-activation-deficient p53. Genes Dev 9, 2170-2183.
Hel in, K., Harlow, E., and Fattaey, A. (1993). Inhibition of E2F-1 transactivation by direct
binding of the retinoblastoma protein. Mol Cell Biol 13, 6501-6508.
Helin, K., Lees, J.A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992). A cDNA
encoding a pRB-binding protein with properties of the transcription factor E2F. Cell 70, 337350.
Hengartner, M.O., and Horvitz, 1.R. (1994a). Activation of C. elegans cell death protein CED-9
by an amino-acid substitution in a domain conserved in Bcl-2. Nature 369, 318-320.
Hengartner, M.O., and Horvitz, H.R. (l 994b). C. elegans cell survival gene ced-9 encodes a
functional homolog of the mammalian proto-oncogene bcl-2. Cell 76, 665-676.
Hernando, E., Nahle, Z., Juan, G., Diaz-Rodriguez, E., Alaminos, M., Hemann, M., Michel, L.,
Mittal, V., Gerald, W., Benezra, R., et aL. (2004). Rb inactivation promotes genomic instability
by uncoupling cell cycle progression from mitotic control. Nature 430, 797-802.
Hiebert, S.W. (1993). Regions of the retinoblastoma gene product required for its interaction
with the E2F transcription factor are necessary for E2 promoter repression and pRb-mediated
growth suppression. Mol Cell Biol 13, 3384-3391.
Hiebert, S.W., Chellappan, S.P., Horowitz, J.M., and Nevins, J.R. (1992). The interaction of RB
with E2F coincides with an inhibition of the transcriptional activity of E2F. Genes Dev 6, 177185.
44
Hotti, A., Jarvinen, K., Siivola, P., and Holtta, E. (2000). Caspases and mitochondria in c-Mycinduced apoptosis: identification of ATM as a new target of caspases. Oncogene 19, 2354-2362.
Hu, Q.J., Dyson, N., and Harlow, E. (1990). The regions of the retinoblastoma protein needed for
binding to adenovirus EIA or SV40 large T antigen are common sites for mutations. EMBO J 9,
1147-1155.
Huang, S., Wang, N.P., Tseng, B.Y., Lee, W.H., and Lee, E.H. (1990). Two distinct and
frequently mutated regions of retinoblastoma protein are required for binding to SV40 T antigen.
EMBOJ9, 1815-1822.
Huh, M.S., Parker, M.H., Scime, A., Parks, R., and Rudnicki, M.A. (2004). Rb is required for
progression through myogenic differentiation but not maintenance of terminal differentiation. J
Cell Biol 166, 865-876.
lanari, A., Natale, T., Calo, E., Ferretti, E., Alesse, E., Screpanti, I., Haigis, K., Gulino, A., and
Lees, J.A. (2009). Proapoptotic function of the retinoblastoma tumor suppressor protein. Cancer
Cell 15, 184-194.
Inoue, Y., Kitagawa, M., and Taya, Y. (2007). Phosphorylation of pRB at Ser612 by Chkl/2
leads to a complex between pRB and E2F-1 after DNA damage. EMBO J 26, 2083-2093.
Isaac, C.E., Francis, S.M., Martens, A.L., Julian, L.M., Seifried, L.A., Erdmann, N., Binne, U.K.,
Harrington, L., Sicinski, P., Berube, N.G., et al. (2006). The retinoblastoma protein regulates
pericentric heterochromatin. Mol Cell Biol 26, 3659-3671.
Itoh, N., Yonehara, S., Ishii, A., Yonehara, M., Mizushima, S., Sameshima, M., Hase, A., Seto,
Y., and Nagata, S. (1991). The polypeptide encoded by the cDNA for human cell surface antigen
Fas can mediate apoptosis. Cell 66, 233-243.
Jacks, T., Fazeli, A., Schmitt, E.M., Bronson, R.T., Goodell, M.A., and Weinberg, R.A. (1992).
Effects of an Rb mutation in the mouse. Nature 359, 295-300.
Jan icke, R.U., Walker, P.A., Lin, X.Y., and Porter, A.G. (1996). Specific cleavage of the
retinoblastoma protein by an ICE-like protease in apoptosis. EMBO J 15, 6969-6978.
Ji, P., Jiang, H., Rekhtman, K., Bloom, J., Ichetovkin, M., Pagano, M., and Zhu, L. (2004). An
Rb-Skp2-p27 pathway mediates acute cell cycle inhibition by Rb and is retained in a partialpenetrance Rb mutant. Mol Cell 16, 47-58.
45
Jiao, W., Datta, J., Lin, H.-M., Dundr, M., and Rane, S. (2006). Nucleocytoplasmic shuttling of
the retinoblastoma tumor suppressor protein via Cdk phosphorylation-dependent nuclear export.
The Journal of biological chemistry 281, 3 8098-38206.
Jiao, W., Lin, H.M., Datta, J., Braunschweig, T., Chung, J.Y., Hewitt, S., and Rane, S. (2008).
Aberrant nucleocytoplasmic localization of the retinoblastoma tumor suppressor protein in
human cancer correlates with moderate/poor tumor differentiation. Oncogene 27, 3156-3220.
Johnson, D.G., Schwarz, J.K., Cress, W.D., and Nevins, J.R. (1993). Expression of transcription
factor E2F1 induces quiescent cells to enter S phase. Nature 365, 349-3 52.
Julian, L.M., Palander, 0., Seifried, L.A., Foster, J.E., and Dick, F.A. (2008). Characterization of
an E2F1-specific binding domain in pRB and its implications for apoptotic regulation. Oncogene
27, 1572-1579.
Kaelin, W.G., Jr., Ewen, M.E., and Livingston, D.M. (1990). Definition of the minimal simian
virus 40 large T antigen- and adenovirus ElA-binding domain in the retinoblastoma gene
product. Mol Cell Biol 10, 3761-3769.
Kaelin, W.G., Jr., Krek, W., Sellers, W.R., DeCaprio, J.A., Ajchenbaum, F., Fuchs, C.S.,
Chittenden, T., Li, Y., Farnham, P.J., Blanar, M.A., et al. (1992). Expression cloning of a cDNA
encoding a retinoblastoma-binding protein with E2F-like properties. Cell 70, 351-364.
Kaye, F.J., and Harbour, J.W. (2004). For whom the bell tolls: susceptibility to common adult
cancers in retinoblastoma survivors. J Nat] Cancer Inst 96, 342-343.
Kerr, J.F., Wyllie, A.H., and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon
with wide-ranging implications in tissue kinetics. Br J Cancer 26, 239-257.
Kerr, L.E., Birse-Archbold, J.L., Short, D.M., McGregor, A.L., Heron, I., Macdonald, D.C.,
Thompson, J., Carlson, G.J., Kelly, J.S., McCulloch, J., et al. (2007). Nucleophosmin is a novel
Bax chaperone that regulates apoptotic cell death. Oncogene 26, 2554-2562.
Knudsen, E., and Knudsen, K. (2008). Tailoring to RB: tumour suppressor status and therapeutic
response. Nature reviews Cancer 8, 714-738.
Knudsen, E.S., and Wang, J.Y. (1997). Dual mechanisms for the inhibition of E2F binding to RB
by cyclin-dependent kinase-mediated RB phosphorylation. Mol Cell Biol 17, 5771-5783.
46
Knudsen, K.E., Booth, D., Naderi, S., Sever-Chroneos, Z., Fribourg, A.F., Hunton, I.C.,
Feramisco, J.R., Wang, J.Y., and Knudsen, E.S. (2000). RB-dependent S-phase response to DNA
damage. Mol Cell Biol 20, 7751-7763.
Knudsen, K.E., Weber, E., Arden, K.C., Cavenee, W.K., Feramisco, J.R., and Knudsen, E.S.
(1999). The retinoblastoma tumor suppressor inhibits cellular proliferation through two distinct
mechanisms: inhibition of cell cycle progression and induction of cell death. Oncogene 18, 52395245.
Knudson, A.G., Jr. (1971). Mutation and cancer: statistical study of retinoblastoma. Proc Natl
Acad Sci U S A 68, 820-823.
Konishi, A., Shimizu, S., Hirota, J., Takao, T., Fan, Y., Matsuoka, Y., Zhang, L., Yoneda, Y.,
Fujii, Y., Skoultchi, A.I., et al. (2003). Involvement of histone HI.2 in apoptosis induced by
DNA double-strand breaks. Cell 114, 673-688.
Korah, J., Falah, N., Lacerte, A., and Lebrun, J.J. (2012). A transcriptionally active pRb-E2FIP/CAF signaling pathway is central to TGFbeta-mediated apoptosis. Cell Death Dis 3, e407.
Kothakota, S., Azuma, T., Reinhard, C., Klippel, A., Tang, J., Chu, K., McGarry, T.J., Kirschner,
M.W., Koths, K., Kwiatkowski, D.J., et al. (1997). Caspase-3-generated fragment of gelsolin:
effector of morphological change in apoptosis. Science 278, 294-298.
Kovesdi, I., Reichel, R., and Nevins, J.R. (1986). Identification of a cellular transcription factor
involved in EtA trans-activation. Cell 45, 219-228.
Ku, N.O., Liao, J., and Omary, M.B. (1997). Apoptosis generates stable fragments of human
type I keratins. J Biol Chem 272, 33197-33203.
Kuwana, T., Bouchier-Hayes, L., Chipuk, J.E., Bonzon, C., Sullivan, B.A., Green, D.R., and
Newmeyer, D.D. (2005). BH3 domains of BH3-only proteins differentially regulate Baxmediated mitochondrial membrane permeabilization both directly and indirectly. Mol Cell 17,
525-535.
La Thangue, N.B., and Rigby, P.W. (1987). An adenovirus EtA-like transcription factor is
regulated during the differentiation of murine embryonal carcinoma stem cells. Cell 49, 507-513.
47
Ledl, A., Schmidt, D., and Muller, S. (2005). Viral oncoproteins ElA and E7 and cellular LxCxE
proteins repress SUMO modification of the retinoblastoma tumor suppressor. Oncogene 24,
3810-3818.
Lee, C., Chang, J.H., Lee, H.S., and Cho, Y. (2002). Structural basis for the recognition of the
E2F transactivation domain by the retinoblastoma tumor suppressor. Genes Dev 16, 3199-3212.
Lee, E.Y., Chang, C.Y., Hu, N., Wang, Y.C., Lai, C.C., Herrup, K., Lee, W.H., and Bradley, A.
(1992). Mice deficient for Rb are nonviable and show defects in neurogenesis and
haematopoiesis. Nature 359, 288-294.
Lee, J.O., Russo, A.A., and Pavletich, N.P. (1998). Structure of the retinoblastoma tumoursuppressor pocket domain bound to a peptide from HPV E7. Nature 391, 859-865.
Lee, W.H., Bookstein, R., Hong, F., Young, L.J., Shew, J.Y., and Lee, E.Y. (1987a). Human
retinoblastoma susceptibility gene: cloning, identification, and sequence. Science 235, 13941399.
Lee, W.H., Shew, J.Y., Hong, F.D., Sery, T.W., Donoso, L.A., Young, L.J., Bookstein, R., and
Lee, E.Y. (1987b). The retinoblastoma susceptibility gene encodes a nuclear phosphoprotein
associated with DNA binding activity. Nature 329, 642-645.
Leist, M., and Jaattela, M. (2001). Four deaths and a funeral: from caspases to alternative
mechanisms. Nat Rev Mol Cell Biol 2, 589-598.
Letai, A., Bassik, M.C., Walensky, L.D., Sorcinelli, M.D., Weiler, S., and Korsmeyer, S.J.
(2002). Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as
prototype cancer therapeutics. Cancer Cell 2, 183-192.
Levkau, B., Koyama, H., Raines, E.W., Clunnan, B.E., Herren, B., Orth, K., Roberts, J.M., and
Ross, R. (1998). Cleavage of p21 CipI/Wafl and p27KipI mediates apoptosis in endothelial cells
through activation of Cdk2: role of a caspase cascade. Mol Cell 1, 553-563.
Li, D., Day, K.V., Yu, S., Shi, G., Liu, S., Guo, M., Xu, Y., Sreedharan, S., and O'Malley, B.W.,
Jr. (2002). The role of adenovirus-mediated retinoblastoma 94 in the treatment of head and neck
cancer. Cancer Res 62, 4637-4644.
48
Li, H., Kolluri, S.K., Gu, J., Dawson, M.I., Cao, X., Hobbs, P.D., Lin, B., Chen, G., Lu, J., Lin,
F., et al. (2000). Cytochrome c release and apoptosis induced by mitochondrial targeting of
nuclear orphan receptor TR3. Science 289, 1159-1164.
Li, H., Zhu, H., Xu, C.J., and Yuan, J. (1998). Cleavage of BID by caspase 8 mediates the
mitochondrial damage in the Fas pathway of apoptosis. Cell 94, 491-501.
Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S., and Wang, X.
(1997). Cytochrome c and dATP-dependent formation of Apaf- 1/caspase-9 complex initiates an
apoptotic protease cascade. Cell 91, 479-489.
Lin, B., Kolluri, S.K., Lin, F., Liu, W., Han, Y.H., Cao, X., Dawson, M.I., Reed, J.C., and
Zhang, X.K. (2004). Conversion of Bcl-2 from protector to killer by interaction with nuclear
orphan receptor Nur77/TR3. Cell 116, 527-540.
Lindsten, T., Ross, A.J., King, A., Zong, W.X., Rathmell, J.C., Shiels, H.A., Ulrich, E.,
Waymire, K.G., Mahar, P., Frauwirth, K., et al. (2000). The combined functions of proapoptotic
Bcl-2 family members bak and bax are essential for normal development of multiple tissues. Mol
Cell 6, 1389-1399.
Llambi, F., Moldoveanu, T., Tait, S.W., Bouchier-Ilayes, L., Temirov, J., McCormick, L.L.,
Dillon, C.P., and Green, D.R. (2011). A unified model of mammalian BCL-2 protein family
interactions at the mitochondria. Mol Cell 44, 517-531.
Longworth, M.S., Herr, A., Ji, J.Y., and Dyson, N.J. (2008). RBF1 promotes chromatin
condensation through a conserved interaction with the Condensin II protein dCAP-D3. Genes
Dev 22, 1011-1024.
Lopez-Bigas, N., Kisiel, T., Dewaal, D., Holmes, K., Volkert, T., Gupta, S., Love, J., Murray,
H., Young, R., and Benevolenskaya, E. (2008). Genome-wide analysis of the H3K4 histone
demethylase RBP2 reveals a transcriptional program controlling differentiation. Molecular cell
31, 520-530.
Ludlow, J.W., Glendening, C.L., Livingston, D.M., and DeCarprio, J.A. (1993). Specific
enzymatic dephosphorylation of the retinoblastoma protein. Mol Cell Biol 13, 367-372.
Ludlow, J.W., Shon, J., Pipas, J.M., Livingston, D.M., and DeCaprio, J.A. (1990). The
retinoblastoma susceptibility gene product undergoes cell cycle-dependent dephosphorylation
and binding to and release from SV40 large T. Cell 60, 3 87-396.
49
Lukas, J., Parry, D., Aagaard, L., Mann, D.J., Bartkova, J., Strauss, M., Peters, G., and Bartek, J.
(1995). Retinoblastoma-protein-dependent cell-cycle inhibition by the tumour suppressor p16.
Nature 375, 503-506.
Luo, R.X., Postigo, A.A., and Dean, D.C. (1998a). Rb interacts with histone deacetylase to
repress transcription. Cell 92, 463-473.
Luo, X., Budihardjo, I., Zou, H., Slaughter, C., and Wang, X. (1998b). Bid, a Bcl2 interacting
protein, mediates cytochrome c release from mitochondria in response to activation of cell
surface death receptors. Cell 94, 481-490.
MacPherson, D., Sage, J., Crowley, D., Trumpp, A., Bronson, R.T., and Jacks, T. (2003).
Conditional mutation of Rb causes cell cycle defects without apoptosis in the central nervous
system. Mol Cell Biol 23, 1044-1053.
Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, S., Le Villain, J.P.,
Troalen, F., Trouche, D., and Harel-Bellan, A. (1998). Retinoblastoma protein represses
transcription by recruiting a histone deacetylase. Nature 391, 601-605.
Manning, A.L., and Dyson, N.J. (2011). pRB, a tumor suppressor with a stabilizing presence.
Trends Cell Biol 21, 433-441.
Manning, A.L., Longworth, M.S., and Dyson, N.J. (2010). Loss of pRB causes centromere
dysfunction and chromosomal instability. Genes Dev 24, 1364-1376.
Markham, D., Munro, S., Soloway, J., O'Connor, D.P., and La Thangue, N.B. (2006). DNAdamage-responsive acetylation of pRb regulates binding to E2F-1. EMBO Rep 7, 192-198.
Mihara, K., Cao, X.R., Yen, A., Chandler, S., Driscoll, B., Murphree, A.L., T'Ang, A., and Fung,
Y.K. (1989). Cell cycle-dependent regulation of phosphorylation of the human retinoblastoma
gene product. Science 246, 1300-1303.
Mihara, M., Erster, S., Zaika, A., Petrenko, 0., Chittenden, T., Pancoska, P., and Moll, U.M.
(2003). p53 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.
Milet, C., Rincheval-Arnold, A., Mignotte, B., and Guenal, 1. (2010). The Drosophila
retinoblastoma protein induces apoptosis in proliferating but not in post-mitotic cells. Cell Cycle
9, 97-103.
50
Mittnacht, S., and Weinberg, R.A. (1991). GI/S phosphorylation of the retinoblastoma protein is
associated with an altered affinity for the nuclear compartment. Cell 65, 381-393.
Moroni, M.C., Hickman, E.S., Lazzerini Denchi, E., Caprara, G., Colli, E., Cecconi, F., Muller,
H., and Helin, K. (2001). Apaf-1 is a transcriptional target for E2F and p53. Nat Cell Biol 3, 552558.
Muchmore, S.W., Sattler, M., Liang, H., Meadows, R.P., Harlan, J.E., Yoon, H.S., Nettesheim,
D., Chang, B.S., Thompson, C.B., Wong, S.L., et aL. (1996). X-ray and NMR structure of human
Bcl-xL, an inhibitor of programmed cell death. Nature 381, 335-341.
Muller, H., Bracken, A.P., Vernell, R., Moroni, M.C., Christians, F., Grassilli, E., Prosperini, E.,
Vigo, E., Oliner, J.D., and Helin, K. (2001). E2Fs regulate the expression of genes involved in
differentiation, development, proliferation, and apoptosis. Genes Dev 15, 267-285.
Mulligan, G., and Jacks, T. (1998). The retinoblastoma gene family: cousins with overlapping
interests. Trends Genet 14, 223-229.
Munger, K., Werness, B.A., Dyson, N., Phelps, W.C., Harlow, E., and Howley, P.M. (1989).
Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor
suppressor gene product. EMBO J 8, 4099-4105.
Nakano, K., and Vousden, K.H. (2001). PUMA, a novel proapoptotic gene, is induced by p53.
Mol Cell 7, 683-694.
Narita, M., Nunez, S., Heard, E., Lin, A.W., Hearn, S.A., Spector, D.L., Hannon, G.J., and
Lowe, S.W. (2003). Rb-mediated heterochromatin formation and silencing of E2F target genes
during cellular senescence. Cell 113, 703-7116.
Nevins, J.R. (1992). E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.
Science 258, 424-429.
Nicolay, B.N., Gameiro, P.A., Tschop, K., Korenjak, M., Heilmann, A.M., Asara, J.M.,
Stephanopoulos, G., Iliopoulos, 0., and Dyson, N.J. (2013). Loss of RBFI changes glutamine
catabolism. Genes Dev 2,7, 182-196.
Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino, T., Taniguchi,
T., and Tanaka, N. (2000). Noxa, a BH3-only member of the Bcl--2 family and candidate
mediator of p53-induced apoptosis. Science 288, 1053-1058.
51
Okamura, H., Yoshida, K., Amorim, B.R., and Haneji, T. (2008). Histone H1.2 is translocated to
mitochondria and associates with Bak in bleomycin-induced apoptotic cells. J Cell Biochem 103,
1488-1496.
Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl-2 heterodimerizes in vivo with a
conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619.
Opferman, J.T., Letai, A., Beard, C., Sorcinelli, M.D., Ong, C.C., and Korsmeyer, S.J. (2003).
Development and maintenance of B and T lymphocytes requires antiapoptotic MCL- 1. Nature
426, 671-676.
Puthalakath, H., Huang, D.C., O'Reilly, L.A., King, S.M., and Strasser, A. (1999). The
proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein
motor complex. Mol Cell 3, 287-296.
Qin, X.Q., Chittenden, T., Livingston, D.M., and Kaelin, W.G., Jr. (1992). Identification of a
growth suppression domain within the retinoblastoma gene product. Genes Dev 6, 953-964.
Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. (1994). Deregulated
transcription factor E2F- 1 expression leads to S-phase entry and p53-mediated apoptosis. Proc
Natl Acad Sci U S A 91, 10918-10922.
Raff, M.C. (1992). Social controls on cell survival and cell death. Nature 356, 397-400.
Rajpal, A., Cho, Y.A., Yelent, B., Koza-Taylor, P.H., Li, D., Chen, E., Whang, M., Kang, C.,
Turi, T.G., and Winoto, A. (2003). Transcriptional activation of known and novel apoptotic
pathways by Nur77 orphan steroid receptor. EMBO J 22, 6526-6536.
Rao, L., Perez, D., and White, E. (1996). Lamin proteolysis facilitates nuclear events during
apoptosis. J Cell Biol 135, 1441-1455.
Robertson, K.D., Ait-Si-Ali, S., Yokochi, T., Wade, P.A., Jones, P.L., and Wolffe, A.P. (2000).
DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2Fresponsive promoters. Nat Genet 25, 338-342.
Roth, D., Harper, I., Pouton, C., and Jans, D. (2009). Modulation of nucleocytoplasmic
trafficking by retention in cytoplasm or nucleus. Journal of cellular biochemistry 107, 11601167.
52
Sage, J., Miller, A.L., Perez-Mancera, P.A., Wysocki, J.M., and Jacks, T. (2003). Acute mutation
of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 424, 223-228.
Sankaran, V., Orkin, S., and Walkley, C. (2008). Rb intrinsically promotes erythropoiesis by
coupling cell cycle exit with mitochondrial biogenesis. Genes & development 22, 463-475.
Sattler, M., Liang, H., Netteshein, D., Meadows, R.P., Harlan, J.E., Eberstadt, M., Yoon, H.S.,
Shuker, S.B., Chang, B.S., Minn, A.J., et al. (1997). Structure of Bcl-xL-Bak peptide complex:
recognition between regulators of apoptosis. Science 275, 983-986.
Schmeiser, K., Hammond, E.M., Roberts, S., and Grand, R.J. (1998). Specific cleavage of
gamma catenin by caspases during apoptosis. FEBS Lett 433, 51-57.
Schvartzman, J.M., Duijf, P.H., Sotillo, R., Coker, C., and Benezra, R. (2011). Mad2 is a critical
mediator of the chromosome instability observed upon Rb and p53 pathway inhibition. Cancer
Cell 19, 701-714.
Serrano, M., Hannon, G.J., and Beach, D. (1993). A new regulatory motif in cell-cycle control
causing specific inhibition of cyclin D/CDK4. Nature 366, 704-707.
Shan, B., Zhu, X., Chen, P.L., Durfee, T., Yang, Y., Sharp, D., and Lee, W.H. (1992). Molecular
cloning of cellular genes encoding retinoblastoma-associated proteins: identification of a gene
with properties of the transcription factor E2F. Mol Cell Biol 12, 5620-5631.
Sherr, C.J. (1994). GI phase progression: cycling on cue. Cell 79, 551-555.
Sherr, C.J., and McConnick, F. (2002). The RB and p53 pathways in cancer. Cancer Cell 2, 103112.
Singh, P., Wong, S.H., and Hong, W. (1994). Overexpression of E2F-1 in rat embryo fibroblasts
leads to neoplastic transformation. EMBO J 13, 3329-3338.
Sotillo, R., Schvartzman, J.M., Socci, N.D., and Benezra, R. (2010). Mad2-induced chromosome
instability leads to lung tumour relapse after oncogene withdrawal. Nature 464, 436-440.
Stabel, S., Argos, P., and Philipson, L. (1985). The release of growth arrest by microinjection of
adenovirus ElA DNA. EMBO J 4, 2329-2336.
53
Strober, B.E., Dunaief, J.L., Guha, and Goff, S.P. (1996). Functional interactions between the
hBRM/hBRG 1 transcriptional activators and the pRB family of proteins. Mol Cell Biol 16,
1576-1583.
Suda, T., Takahashi, T., Golstein, P., and Nagata, S. (1993). Molecular cloning and expression of
the Fas ligand, a novel member of the tumor necrosis factor family. Cell 75, 1169-1178.
Sulston, J.E. (1976). Post-embryonic development in the ventral cord of Caenorhabditis elegans.
Philos Trans R Soc Lond B Biol Sci 275, 287-297.
Takahashi, C., Sasaki, N., and Kitajima, S. (2012). Twists in views on RB functions in cellular
signaling, metabolism and stem cells. Cancer science.
Tan, X., Martin, S.J., Green, D.R., and Wang, J.Y. (1997). Degradation of retinoblastoma protein
in tumor necrosis factor- and CD95-induced cell death. J Biol Chem 272, 9613-9616.
Thomas, D.M., Carty, S.A., Piscopo, D.M., Lee, J.S., Wang, W.F., Forrester, W.C., and Hinds,
P.W. (2001). The retinoblastoma protein acts as a transcriptional coactivator required for
osteogenic differentiation. Mol Cell 8, 303-316.
Thornberry, N.A., and Lazebnik, Y. (1998). Caspases: enemies within. Science 281, 1312-1316.
Trauth, B.C., Klas, C., Peters, A.M., Matzku, S., Moller, P., Falk, W., Debatin, K.M., and
Krammer, P.H. (1989). Monoclonal antibody-mediated tumor regression by induction of
apoptosis. Science 245, 301-305.
Trimarchi, J.M., and Lees, J.A. (2002). Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol
3,11-20.
Trouche, D., Le Chalony, C., Muchardt, C., Yaniv, M., and Kouzarides, T. (1997). RB and hbrm
cooperate to repress the activation functions of E2F1. Proc Natl Acad Sci U S A 94, 1126811273.
Tsujimoto, Y., Cossman, J., Jaffe, E., and Croce, C.M. (1985). Involvement of the bcl-2 gene in
human follicular lymphoma. Science 228, 1440-1443.
Vaux, D.L., Weissman, I.L., and Kim, S.K. (1992). Prevention of programmed cell death in
Caenorhabditis elegans by human bcl-2. Science 258, 1955-1957.
54
Vousden, K.H., and Jat, P.S. (1989). Functional similarity between HPV16E7, SV40 large T and
adenovirus El a proteins. Oncogene 4, 153-158.
Vousden, K.H., and Prives, C. (2009). Blinded by the Light: The Growing Complexity of p53.
Cell 137, 413-43 1.
Wajant, H., Pfizenmaier, K., and Scheurich, P. (2003). Tumor necrosis factor signaling. Cell
Death Differ 10, 45-65.
Wei, M.C., Zong, W.X., Cheng, E.H., Lindsten, T., Panoutsakopoulou, V., Ross, A.J., Roth,
K.A., MacGregor, G.R., Thompson, C.B., and Korsmeyer, S.J. (2001). Proapoptotic BAX and
BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292, 727-730.
Weinberg, R.A. (1992). The retinoblastoma gene and gene product. Cancer Surv 12, 43-57.
Weinberg, R.A. (1995). The retinoblastoma protein and cell cycle control. Cell 81, 323-330.
Wenzel, P.L., Wu, L., de Bruin, A., Chong, J.L., Chen, W.Y., Dureska, G., Sites, E., Pan, T.,
Sharma, A., Huang, K., et al. (2007). Rb is critical in a mammalian tissue stem cell population.
Genes Dev 21, 85-97.
Whyte, P., Buchkovich, K.J., Horowitz, J.M., Friend, S.H., Raybuck, M., Weinberg, R.A., and
Harlow, E. (1988). Association between an oncogene and an anti-oncogene: the adenovirus EIA
proteins bind to the retinoblastoma gene product. Nature 334, 124-129.
Wu, L., de Bruin, A., Saavedra, H.I., Starovic, M., Trimboli, A., Yang, Y., Opavska, J., Wilson,
P., Thompson, J.C., Ostrowski, M.C., et al. (2003). Extra-embryonic function of Rb is essential
for embryonic development and viability. Nature 421, 942-947.
Xiao, B., Spencer, J., Clements, A., Ali-Khan, N., Mittnacht, S., Broceno, C., Burghammer, M.,
Perrakis, A., Marmorstein, R., and Gamblin, S.J. (2003). Crystal structure of the retinoblastoma
tumor suppressor protein bound to E2F and the molecular basis of its regulation. Proc Natl Acad
Sci U S A 100, 2363-2368.
Xiao, Z.X., Chen, J., Levine, A.J., Modjtahedi, N., Xing, J., Sellers, W.R., and Livingston, D.M.
(1995). Interaction between the retinoblastoma protein and the oncoprotein MDM2. Nature 375,
694-698.
55
Xu, G., Livingston, D.M., and Krek, W. (1995). Multiple members of the E2F transcription
factor family are the products of oncogenes. Proc Natl Acad Sci U S A 92, 1357-1361.
Xu, H.J., Zhou, Y., Ji, W., Perng, G.S., Kruzelock, R., Kong, C.T., Bast, R.C., Mills, G.B., Li, J.,
and Hlu, S.X. (1997). Reexpression of the retinoblastoma protein in tumor cells induces
senescence and telomerase inhibition. Oncogene 15, 2589-2596.
Yang, H., Williams, B.O., Hinds, P.W., Shih, T.S., Jacks, T., Bronson, R.T., and Livingston,
D.M. (2002). Tumor suppression by a severely truncated species of retinoblastoma protein. Mol
Cell Biol 22, 3103-3110.
Youle, R.J., and Strasser, A. (2008). The BCL-2 protein family: opposing activities that mediate
cell death. Nat Rev Mol Cell Biol 9, 47-59.
Yu, J., Zhang, L., Hwang, P.M., Kinzler, K.W., and Vogelstein, B. (2001). PUMA induces the
rapid apoptosis of colorectal cancer cells. Mol Cell 7, 673-682.
Yuan, J., Shaham, S., Ledoux, S., Ellis, H.M., and Horvitz, H.R. (1993). The C. elegans cell
death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta-converting enzyme.
Cell 75, 641-652.
Zarnanian, M., and La Thangue, N.B. (1993). Transcriptional repression by the Rb-related
protein p 107. Mol Biol Cell 4, 3 89-396.
Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S.J. (1996). Serine phosphorylation of
death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell
87, 619-628.
Zhang, J.M., Wei, Q., Zhao, X., and Paterson, B.M. (1999a). Coupling of the cell cycle and
myogenesis through the cyclin DI-dependent interaction of MyoD with cdk4. EMBO J 18, 926933.
Zhang, J.M., Zhao, X., Wei, Q., and Paterson, B.M. (1999b). Direct inhibition of G(1) cdk kinase
activity by MyoD promotes myoblast cell cycle withdrawal and terminal differentiation. EMBO
J 18, 6983-6993.
Zhou, B.B., Li, H., Yuan, J., and Kirschner, M.W. (1998). Caspase-dependent activation of
cyclin-dependent kinases during Fas-induced apoptosis in Jurkat cells. Proc Natl Acad Sci U S A
95, 6785-6790.
56
Zhu, L., Harlow, E., and Dynlacht, B.D. (1995). p107 uses a p21CIPI-related domain to bind
cyclin/cdk2 and regulate interactions with E2F. Genes Dev 9, 1740-1752.
Zou, H., Henzel, W.J., Liu, X., Lutschg, A., and Wang, X. (1997). Apaf-1, a human protein
homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase3. Cell 90, 405-413.
57
Chapter Two
The retinoblastoma protein induces apoptosis directly
at the mitochondria
Keren I Hilgendorf, Elizaveta S Leshchiner, Simona Nedelcu, Mindy A Maynard,
Eliezer Calo, Alessandra lanari, Loren D Walensky, Jacqueline A Lees
K.I.H. conducted all of the cell and in vivo studies, including xenograft assays with S.N. and p16
knockdown studies with M.A.M. E.S.L. contributed Fig. 5B-D. E.C. developed the OS cell
xenograft assay. A.I. and L.D.W. were involved in the study design and data analysis. K.I.H.
and J.A.L. designed the study, analyzed the data and wrote the paper.
Published: Genes and Development. 2013. 27 (9), 1003-1015.
58
Abstract
The retinoblastoma protein gene, RB-1, is mutated in one third of human tumors. Its protein
product, pRB, functions as a transcriptional co-regulator in many fundamental cellular processes.
Here, we report a non-nuclear role for pRB in apoptosis induction via pRB's direct participation
in mitochondrial apoptosis. We uncovered this activity by finding that pRB potentiated TNFLinduced apoptosis, even when translation was blocked. This pro-apoptotic function was highly
BAX-dependent, suggesting a role in mitochondrial apoptosis, and accordingly a fraction of
endogenous pRB associated with mitochondria. Remarkably, we found that recombinant pRB
was sufficient to trigger the BAX-dependent permeabilization of mitochondria or liposomes in
vitro.
Moreover, pRB interacted with BAX in vivo, and it could directly bind and
conformationally activate BAX in vitro. Finally, by targeting pRB specifically to mitochondria
we generated a mutant that lacked pRB's classic nuclear roles. This mito-tagged pRB retained
the ability to promote apoptosis in response to TNFa and also additional apoptotic stimuli. Most
importantly, induced expression of mito-tagged pRB in Rb-/-;p53-/- tumors was sufficient to
block further tumor development. Together, these data establish a non-transcriptional role for
pRB in direct activation of BAX and mitochondrial apoptosis in response to diverse stimuli,
which is profoundly tumor suppressive.
59
Introduction
Regulation of pRB is perturbed in most, if not all, cancers (Sherr and McCormick, 2002).
pRB functions in many cellular processes and is a key regulator of the cell cycle by interacting
with and inhibiting E2F transcription factors (van den Heuvel and Dyson, 2008). Upon
mitogenic signaling, cdk/cyclin complexes phosphorylate pRB, resulting in release of E2Fs and
cell cycle progression (van den Heuvel and Dyson, 2008). Notably, the two thirds of human
tumors that are RB-1 wildtype typically carry mutations in upstream regulators of pRB (p16 nka,
cyclinD or cdk4) that promote cdk/cyclin activation and thus pRB phosphorylation (Sherr and
McCormick, 2002). Since these mutations all inactivate pRB's anti-proliferative function, little
attention has been paid to the status of RB-1 in considering tumor treatment. However, we note
that pRB also functions as a transcriptional co-regulator of differentiation, senescence, and
apoptosis genes (Calo et al., 2010; Gordon and Du, 2011; lanari et al., 2009; Viatour and Sage,
2011). In addition, a portion of the pRB protein exists in the cytoplasm (Fulcher et al., 2010;
Jiao et al., 2006; Jiao et al., 2008; Roth et al., 2009) and even at mitochondria (Ferecatu et al.,
2009), but no known roles have been assigned to these species.
This current study concerns the role of pRB in the regulation of apoptosis. It is already
well established that pRB can either promote or suppress apoptosis through both direct and
indirect transcriptional mechanisms (Gordon and Du, 2011; lanari et al., 2009). Earliest
evidence for the anti-apoptotic role of pRB emerged from the characterization of the Rb-null
mouse, which exhibits increased levels of apoptosis in the nervous system, lens, and skeletal
muscle (Jacks et al., 1992). Subsequent studies showed that this phenotype is mostly non-cell
autonomous, resulting from the deregulation of cell cycle genes and the consequent overproliferation of placental tissues that disrupts its nonnal architecture and vascularization, and
60
causes hypoxia in embryonic tissues (de Bruin et al., 2003; Wenzel et al., 2007; Wu et al., 2003).
Loss of pRB in mouse embryonic fibroblasts (MEFs) results in increased sensitivity to genotoxic
stress (Knudsen and Knudsen, 2008). However, this is thought to be an indirect consequence of
failure to prevent cell cycle entry in the absence of pRB, as well as increased chromosomal
instability (Bosco et al., 2004; Burkhart and Sage, 2008; Knudsen et al., 2000; Manning and
Dyson, 2012). In contrast, and more consistent with a tumor suppressor role, pRB can also act in
.a pro-apoptotic maimer in highly proliferative cells (Araki et al., 2008; Carnevale et al., 2012;
lanari et al., 2009; Knudsen et al., 1999; Milet et al., 2010). In this context, pRB and also
hyperphosphorylated pRB contributes directly to apoptosis by functioning in a transcriptionally
active pRB:E2F1 complex that promotes expression of pro-apoptotic genes, such as caspase 7
and p73, in response to DNA damage (lanari et al., 2009). Taken together, these studies suggest
that the ability of pRB to promote or repress apoptosis, at least in response to genotoxic stress,
may be dictated by the cellular context.
The pro-apoptotic role of pRB has been primarily investigated in the context of DNA
damage. The findings in this current study followed from our analysis of pRB's apoptotic
function in response to another apoptotic stimulus, TNFa. TNFc can promote apoptosis via
both the extrinsic and mitochondrial/intrinsic pathways (Jin and El-Deiry, 2005). The extrinsic
pathway involves direct activation of the caspase cascade. In contrast, the intrinsic pathway
depends on activation of the Bcl-2 protein family members BAX and BAK, which trigger
mitochondrial outer membrane perineabilization (MOMP) and release of pro-apoptotic factors,
such as cytochrome c, that lead to effector caspase activation (Brunelle and Letai, 2009; Chipuk
et al., 2010; Jin and El-Deiry, 2005; Martinou and Youle, 2011; Wyllie, 2010). Notably, in
addition to its pro-apoptotic response, TNFa also induces a NFKB-mediated, pro-inflammatory
61
response, which inhibits apoptosis (Karin and Lin, 2002). Thus, to study its apoptotic function,
TNFa is commonly used in conjunction with a factor that abrogates the pro-inflammatory
response such as the proteasome inhibitor MG- 132 or the translational inhibitor cycloheximide
(Karin and Lin, 2002; Traenckner et al., 1994).
In this current study, we show that pRB enhances apoptosis in response to TNFa, and can
exert this effect in the presence of translation inhibition. This finding led us to discover a novel,
non-nuclear function for the pRB protein. Specifically, pRB is associated with mitochondria and
it can induce MOMP by directly binding and activating BAX. By localizing pRB specifically to
the mitochondria, we showed that this mitochondrial apoptosis function is capable of yielding
potent tumor suppression in the absence of pRB's canonical nuclear functions. Importantly,
mitochondrial pRB can respond to a wide variety of pro-apoptotic signals, suggesting that this
represents a general and potent tumor suppressive mechanism. Additionally, we find that cdkphosphorylated pRB is present at the mitochondria and pRB's mitochondrial apoptosis function
remains intact in the presence of tumorigenic events, such as p16 inactivation, that promote pRB
phosphorylation. Thus, we believe that it may be possible to exploit pRB's mitochondrial
apoptosis role as a therapeutic treatment in the majority of human tumors that retain wildtype
Rb-1.
62
Results
pRB is pro-apoptotic in response to TNFa treatment even in the presence of an inhibitor of
translation.
Our initial interest in exploring pRB's role in TNFa-induced apoptosis stemmed from
prior reports that a phosphorylation-site mutant version of pRB played a pro-apoptotic role in the
TNFa response (Masselli and Wang, 2006). We began our studies using a stable variant of an
immortalized rat embryonic fibroblast cell line, RAT16, in which doxycycline withdrawal
induces ectopic pRB expression. RAT 16 cells with basal or induced pRB expression were
treated with TNFa in concert with the proteasome inhibitor MG132 to block the TNFa-induced
activation of NFKB and its pro-inflammatory response. We found that ectopic pRB expression
significantly enhanced 'TNFa-induced apoptosis as measured by AnnexinV staining (Fig. 1 A).
Additionally, we note that pRB also caused a subtle increase in apoptosis even in the absence of
TNFa treatment (Fig. IA). We further confirmed these data by analysis of cleaved effector
caspases 3 and 7 protein levels (Fig. 1B). We wanted to confirm that this was not simply a
consequence of pRB overexpression, and thus also assessed the role of the endogenous pRB
using knockdown cell lines. Notably, even partial knockdown of endogenous pRB in RAT16
cells was sufficient to significantly impair TNFa-induced apoptosis (Fig. IC), without any
detectable disruption of cell cycle phasing (Fig. ID). Similar results were observed in a second
cell line, human primary IMR90 fibroblasts, in which pRB knockdown also suppressed TNFainduced apoptosis (Fig. IE). Thus, modulation of pRB levels by either overexpression or
knockdown is sufficient to enhance or depress the apoptotic response to TNFa.
63
35
A
RAT16
0 pRB basal
C
0 PRB induced
30
E
D
OpRB basal
OpRB basal UpRB kd
20 RAT16
P
l
100
:2
40 IMR90
15 PRB
75
=G1
30
.525
RAT16
UpRB kd
p 5e5
PB
0
20
20
20
L1
MG132
5
0
B
untreated
pRB indu
MG132
only
TNFaI
MG132
od
pRS basal
F
shLuc
2 12
S1casp3
p7
CL
cl. casp7
procasp 3
c. cap 3
unreeaed
TNFa
noe
~
IBcI2
0
ULA+Rb
2
untreafed
II
o
apwl
4
capi
T~
+MG132
~~untreated
0.0
*
TNFa
4dG132
+MG132
-
0-B
N*+Rb
_FL
.!
pR8
1MG132
shRB
.21
0-R
+Rb
procsp7
10
25
MAP3K5
0R
p21
caspl
cGS$4
I
Beclin
Flip
Figure 1. pRB is pro-apoptotic in response to TNFa and MG132. (A) RAT16 cells with
and without induced expression of pRB for 24 hours were treated with TNFa and MG 132 for
48 hours and analyzed for apoptosis by AnnexinV staining. Induced expression of pRB
resulted in increased levels of apoptosis without TNFa treatment and greatly enhanced
TNFa/MG132-induced apoptosis. (B) Western blot showing induction of pRB expression in
RAT16 cells and procaspase 3, cleaved caspase 3, procaspase 7, and cleaved caspase 7
protein levels. Induced expression of pRB for 24 hours resulted in increased levels of
cleaved caspase 3 and 7 protein levels in response to 48 hours of TNFa/MG132 treatment.
(C) Stable pRB knockdown in RAT16 cells decreased levels of apoptosis in response to
treatment with TNFa/MG132 for 48 hours and (D) did not affect cell cycle phasing. Western
blot verifying knockdown of pRB in inset. (E) Stable pRB knockdown in IMR90 cells
decreased TNFa/MG132-induced. Western blot verifying knockdown of pRB in inset. (F)
Induced expression of pRB does not significantly change expression levels of apoptotic,
inflammatory, or autophagic genes with or without TNFa/MG 132 treatment as assessed by
RT-qPCR and normalized to ubiquitin. (A-F) Bars, average of at least three independent
experiments (±SD).
64
We anticipated that pRB's contribution to the pro-apoptotic TNFa response would reflect
its ability to transcriptionally activate pro-apoptotic genes, as observed in our prior DNA damage
studies (Ianari et al., 2009). However, we did not detect any significant changes in the levels of
apoptotic, inflammatory, or autophagic mRNAs, including known pRB:E2F1 targets, in response
to pRB induction in our RATI 6-TNFa experiments (Fig. IF). This led us to consider that
perhaps pRB might be acting independently of transcription. To explore this possibility, we took
advantage of the fact that cycloheximide (CHX) can be used instead of MG132 to block
activation of NFKB (Karin and Lin, 2002; Traenckner et al., 1994). Since CHX acts to block
translation, this would preclude any effects that required gene expression changes. Strikingly,
induction of pRB in RAT16 cells was able to potentiate apoptosis in response to TNFca and CHX
(Fig. 2A), with control experiments verifying translation inhibition by CHX (Fig. 2B).
Moreover, pRB knockdown in IMR90s impaired TNFa/CHX-induced apoptosis (Fig. 2C).
Thus, taken together, our data show that pRB synergizes with TNFa to promote apoptosis in both
primary and immortalized human and rodent cell lines in the absence of translation. This
strongly suggests that pRB can act through a previously unappreciated mechanism.
pRB activates mitochondrial apoptosis in a BAX-dependent manner.
TNFa can induce apoptosis through both the extrinsic and mitochondrial pathways. To
further pinpoint pRB's role, we exploited the fact that the mitochondrial pathway is highly
dependent on BAX and/or BAK (Chipuk et al., 2010; Martinou and Youle, 2011). Specifically,
we generated stable pools of immortalized wildtype, Bak -, Bax , or Bax;Bak - MEFs that
would allow for doxycycline-inducible pRB expression (Fig. 3A) and assayed for apoptosis in
the absence and presence of TNFa/CHX treatment. To ensure that we were assaying the
65
OpRBbasal *pRBind
pgZ#-3
50 RAT16
040
A
-
Oh]
030
-20
B
p=0.01
+
untreated CHX
only
TNFa/
CHX
Ct,
4)
C
C
+
24hl-
1.n
CJ
4)
I4
4)
-
C
-
-
-
+
+
-
+
+
30 ' IMR90
0~20
0.
4)
* pRB kd
C
<U
-j
-
- pRBON
-
-pRB ON
-
+TNFa/CHX
c o I e c t all
48h-4
(N
C opRB basal
(0
C
C
4)
C
(U
4)
C
C
(U
p<0.05
>RB
P=0.01L
>rocasp 3
C~ 1C
0
4)
a-
1"
.1.casp 3
untreated
TNFa/
CHX
20, RAT16
" untreated
" TNFa/CHX 24h
15
0
0.
0-10,
C
01
pRB ON 24h pRB OFF
Figure 2. pRB promotes TNFa-induced apoptosis in a transcription-independent
manner. (A) Induced expression of pRB for 24 hours in RAT] 6 cells increased apoptosis
resulting from 24 hours of TNFa and CHX treatment. (B) Upper panel: Schematic of
experiment. Lanes 1 and 2, pRB expression was induced for 24 hours and subsequently cells
were left untreated or treated with TNFa/CHX, respectively. Lane 3 and 4, pRB expression
was induced and concurrently cells were left untreated or treated with TNFa/CHX,
respectively. Lane 5 and 6, pRB expression was never induced and cells were left untreated
or treated with TNFa/CHX, respectively. Samples were collected after 24 hours of
TNFa/CHX treatment and analyzed by western blotting (middle panel) and by FACS (lower
panel). The addition of CHX concurrently to induction of pRB expression in Lane 4 resulted
in no visible pRB protein, similar levels of apoptosis as no pRB expression (Lane 6) and less
apoptosis than pRB expression for 24 hours prior to treatment (Lane 2). This suggests that
CH4X inhibited expression of pRB. (C) Stable knockdown of pRB in IN4R90 cells decreased
apoptosis induced by 24 hour treatment with TNFa and CHX. (A, C) Graph bars represent
average of at least three independent experiments (±SD).
66
A
wt
-
pRB ind
Bak- ~
+
-
Bax-/~
-
-+
+
DKO
+
pRB
BAK
BAX
tubulin
B
25
pRB basal
N pRB induced
O
p=0.01
20
p<0.005
0
0.15
H
I
0
5
0
_.
_
wt
-+
-
Bak-
1I fIn1
1
--
Bax~I~
TNFa/CHX
DKO
Figure 3. pRB promotes mitochondrial apoptosis in a BAX-dependent manner.
(A) pRB expression was induced for 24 hours in stable pools of wild-type, Bak ~,Bax'-, and
Bar ;Bak(- immortalized MEFs by doxycycline addition and confirmed by western blotting
using antibodies against pRB, BAK, BAX, and tubulin. (B) Wild-type, Bak", Bax~~, and
Bax- ;Bak"~ immortalized MEFs with or without 24 hours of pRB expression were left
untreated or treated with TNFa and CHX for 10 hours and analyzed for apoptosis by
AnnexinV staining. Induction of pRB in wildtype and Bak-~, but not Bax~ or Bax ;Bak",
MEFs sensitized to TNFca/CHX-induccd apoptosis. Each MEF variant was independently
generated twice. Graph bars represent average of three representative, independent
experiments (±SD).
67
BAX/BAK-dependence of any pRB effect, rather than a general difference in the apoptotic
potential of the various Bax/Bak genotypes, we conducted these experiments using treatment
conditions that yielded minimal response to TNFa/CHX in the uninduced (basal pRB) cells (Fig.
3B). Remarkably, pRB induction enhanced TNFa-induced apoptosis in both wildtype (p=0.01)
and Bak - (p<0.005) MEFs, but had no effect in either Bax- or Bax ;Bakl(- MEFs (Fig. 3B).
This analysis yielded two important conclusions. First, pRB exerts its effect on TNFa-induced
apoptosis by acting specifically on the mitochondrial pathway. Second, pRB requires BAX, but
not BAK, for this activity.
pRB is thought of primarily as a nuclear protein, but it also exists in the cytoplasm
(Fulcher et al., 2010; Jiao et al., 2006; Jiao et al., 2008; Roth et al., 2009). Indeed, pRB has even
been reported at mitochondria (Ferecatu et al., 2009), albeit without any known function. Thus,
we speculated that pRB might act directly at mitochondria. To validate and further explore the
mitochondrial localization of pRB, we first fractionated IMR90 cells. We note that our goal was
not to necessarily recover all mitochondria, but rather to obtain a mitochondrial fraction free of
nuclear and cytoplasmic contamination, as confirmed by western blotting for various nuclear,
cytoplasmic and mitochondrial markers (Fig. 4). Intriguingly, we detected a portion of
endogenous pRB in the isolated mitochondria, and found that this exists even in the absence of
treatment with TNFa or genotoxic agents (Fig. 4A, B). Furthermore, using phospho-specific
pRB antibodies, we showed that this mitochondrial pRB includes the cdk-phosphorylated species
(Fig. 4A). Based on the relative loading and western blot signals, we estimate that about 5% of
the total cellular pRB is present in the mitochondrial fraction. Since we optimized the
mitochondrial fractionation for purity, not completeness, this is likely a conservative estimate of
the level of mitochondrial pRB.
68
A
IMR90
Milo
C
Total
Mouse Uver
Mito
D
B
Total
Mouse Uver
IMR90
Mitochondria
Total Lysate
0
F
PCNA
ATPB
(mito)
Figure 4. A fraction of pRB localizes to mitochondria. (A) IMR90 cell mitochondria were
fractionated and equal amounts (in pg) of mitochondrial fraction (mito) versus total lysate
were analyzed by western blotting using an antibody against pRB and a cocktail of
antibodies against phosphorylated pRB. A fraction of pRB, including phospho-pRB
localizes to mitochondria. The purity of the mitochondrial fraction was verified using
control nuclear and cytoplasmic markers. (B) Mitochondria of IMR90 cells treated with
camptothecin (CPT; 5 hours) or TNFa (24 hours) were isolated and analyzed by western
blotting. The levels of mitochondrial pRB are unaffected by treatment with these drugs. (C)
Mitochondria were isolated from mouse livers and analyzed by western blotting. A fraction
of pRB is present at mouse liver mitochondria. (D) Mouse liver mitochondria were
subfractionated into mitoplast and non-mitoplast (SN). Mitochondrial pRB localizes outside
the mitoplast. (A-D) Data are representative of at least three independent experiments.
69
To further validate the mitochondrial localization of pRB in vivo, we next examined
mitochondria from mouse livers. Again, western blotting showed that a fraction of pRB existed
within the mitochondrial fraction (Fig. 4C). Finally, subfractionation of mouse liver
mitochondria localized pRB outside of the mitoplast (inner mitochondrial membrane and
enclosed matrix; Fig. 4D), consistent with the notion that it is associated with the outer
mitochondrial membrane and therefore coincident with the site of BAX/BAK action.
pRB directly activates Bax and induces cytochrome c release from isolated mitochondria.
Having established that pRB is associated with mitochondria in vivo, we hypothesized
that pRB might act to trigger mitochondrial outer membrane permeabilization (MOMP). To test
this, we performed in vitro cytochrome c release assays. First, we isolated mitochondria from
wildtype mouse livers and added recombinant monomeric BAX, because BAX is not associated
with mitochondria in unstressed conditions (Walensky et al., 2006). As expected, addition of
BAX alone did not result in cytochrome c release (Fig. 5A). Remarkably, co-addition of
purified, baculovirus-expressed human pRB and monomeric BAX was sufficient to induce
cytochrome c release (Fig. 5A). This was comparable to the effect of cleaved BID, a BH3-only
member of the BCL-2 family that is a physiologic trigger of MOMP. Thus, recombinant pRB
can induce MOMP in isolated mitochondria supplemented with monomeric BAX.
Next, we wanted to investigate the BAX/B3AK-dependence of this activity. As isolated
mitochondria contain monomeric BAK, we repeated this assay using mitochondria isolated from
Alb-creP";Baxf;BakI mouse livers (Walensky et al., 2006). Consistent with our cellular studies,
pRB (up to 500nM) only induced cytochrome c release when these mitochondria were supplemented with BAX (Fig. 5B). Thus, pRB induces MOMP in a dose- and BAX-dependent manner.
70
A
500 nM pRB
D
Supematant
Pellet
_
12Oi nMBAX
45nMc.d BO
-
+
+
+
-
-
-
+
-
-
-
-
-
+
+
-+
+
IP 6A7(aMBAX)
+
-
BAX
pRB
+
cto c
-
-
+
+
-
+
-
+
Input
-
+
-
+
BAX
SirT3
(mit- Am4M40.wwpRB
B RBE
cyto c
PRB
cyto C
C60
2Dr2ApRB
10.
10UnApRS
_"M4060
6000 8d00
Timne, sec
10A
Figure 5. pRB induces MOMP by directly activating BAX. (A) Mouse liver
mitochondria were isolated, supplemented with recombinant, monomeric BAX and incubated
with and without recombinant cleaved BID (positive control) or baculovirus-expressed,
recombinant human pRB. Cytochrome c release was assessed following incubation and
centrifugation by western blotting of pellet versus supernatant. Addition of either pRB or
cleaved BID was sufficient to release cytochrome c into the supernatant. (B) Mitochondria
isolated from Bax~ ;Bak~~ mouse livers were incubated with indicated amounts of
recombinant pRB only or recombinant pRB and monomeric BAX. Recombinant pRB
promotes cytochrome c release in a dose-dependent and BAX-dependent manner. Data are
representative of two independent experiments. (C) ANTS/DPX-loaded liposomes were
incubated with 50, 100, and 250nM recombinant pRB in the presence or absence of
recombinant, monomeric BAX. ANTS/DPX release was assessed over time. pRB yielded
dose-dependent liposome permeabilization in a BAX-dependent manner. (D) In vitro
binding assay using recombinant pRB and recombinant, monomeric BAX. Activated BAX
was immunoprecipitated using an active-conformation specific BAX antibody (6A7) and
binding was assessed by western blotting using an antibody against total BAX (inactive +
active) and pRB. When co-incubated with inactive BAX, pRB bound to (lower panels) and
stimulated formation of (upper panels) conformationally active BAX. (E) Coimmunoprecipitation experiment using IMR90 cells treated with TNFa/CHX for 3 hours.
Endogenous pRB was immunoprecipitated from cell extracts and endogenous BAX
association was assessed by western blotting. pRB and BAX form an endogenous complex
in vivo in TNFa/CHX-treated cells. (A, C-E) Data are representative of at least three
independent experiments.
71
To further explore this BAX specificity, we performed a liposome release assay in which
freshly prepared ANTS/DPX-loaded liposomes were incubated with increasing concentrations of
purified pRB in the absence or presence of recombinant, monomeric BAX (Fig. 5C). As
expected, addition of either BAX or pRB (up to 250nM) alone was insufficient to yield
ANTS/DPX release. In contrast, upon co-addition, pRB was sufficient to trigger BAXdependent liposome penneabilization in a dose- and time-dependent manner.
We wanted to further investigate pRB's ability to directly activate BAX. It is well
established that BAX undergoes a conformational change upon activation that can be detected
using an antibody (6A7) specific for the active conformation of BAX (Hsu and Youle, 1997).
Thus, we performed an in vitro binding assay in which recombinant pRB and/or monomeric
BAX were incubated separately or together in the absence of mitochondria or liposomes. We
then screened for BAX activation by immunoprecipitation with 6A7, and assayed pR.B
association by western blotting (Fig. 5D). Notably, we found that addition of pRB promoted
formation of the active BAX conformation (Fig. 5D, upper panels). Moreover, pRB coimmunoprecipitated with this active BAX species (Fig. 5D, lower panels). Thus, pRB can both
associate with BAX, and trigger its conformational activation. Since the liposome and coimmunoprecipitation assays were both conducted in the absence of any other proteins, we can
conclude that pRB is sufficient to directly activate BAX and induce BAX-mediated membrane
permeabilization.
We next sought to validate the pRB:BAX interaction in the in vivo context and with
endogenous proteins. Endogenous interactions between BAX and pro-apoptotic proteins,
including BH3-only proteins, are notoriously difficult to observe due to the dynamic, 'hit and
run' nature of these interactions (Eskes et al., 2000; Perez and White, 2000; Walensky and
72
Gavathiotis, 2011). Thus, to enable detection of such transient interactions, we treated primary
human IMR90 fibroblasts with TNFa/CHX and then crosslinked using the amine-reactive
crosslinking agent DSP. Using this approach, we were able to detect BAX within
immunoprecipitates of the endogenous pRB protein (Fig. 5E). Thus, taken together, our in vitro
and in vivo experiments show that pRB can bind directly to BAX and induce it to adopt the
active conformation that triggers MOMP and cytochrome c release.
The mitochondrial function of pRB induces apoptosis even in the absence of pRB's nuclear
functions.
Our data have identified a mitochondrial function for pRB. We next wanted to address
how this function contributes to pRB's tumor suppressive activity. First, we asked which region
of pRB is required for transcription-independent apoptosis. The tumor suppressor pRB is
traditionally divided up into three domains (Fig. 6A): the N-terminus (residues 1-372), the small
pocket domain (residues 373-766) and the C-terminus (residues 767-928). The small pocket is
required for pRB's known biological functions and most of the mutations found in human tumors
disrupt this domain. We expressed the three domains (RB_N RB_SP, and RBC) in an
inducible manner using stable RATI 6 cell lines (Fig. 6A, B). Notably, expression of the small
pocket of pRB, but not the N-terminal or C-terminal domains promoted apoptosis in response to
TNFa and CHX (Fig. 6C). Thus, pRB's ability to induce transcription-independent apoptosis
mapped to the small pocket domain. Since this domain is essential for pRB's tumor suppressive
activity, these data are consistent with functional significance. Unfortunately, the small pocket is
also required for most other pRB functions.
73
A
B
z
RB
RBN
RB SP
RBC
W
CO Ia
a.
0
I
250
150
100
C 25'
TNFa/CHX
75
p=5e-5
20
<
---
_
HA
50
37
0
015
<
25
10
20
0.
Gapdh
Basal
RB
RB_N
RB_SP
RB_C
Figure 6. The Small Pocket of pRB is sufficient to induce transcription-independent
apoptosis. (A) Schematic of pRB domains: the N-terminus (RB N; residues 1-372), the
small pocket domain (RB_SP; residues 373-766) and the C-terminus (RB _C; residues 767928). (B) Stable variants of RAT16 cells allowing for inducible expression of HA-tagged
full-length pRB, RB_N, RB_SP, and RBC by doxycycline withdrawal were generated and
expression was verified after 24 hours by western blotting using an HA-antibody. (C)
RAT 16 cells with and without expression of pRB, RB_N, RB_SP, and RBC for 24 hours
were treated with TNFa and CHX for 24 hours and levels of apoptosis were assessed by
AnnexinV staining. Induced expression of full-length pRB and RBSP, but not RBN or
RBC, sensitized to TNFa/CHX-induced apoptosis. (B-C) Each RAT16 variant was
independently generated three times. Graph bars represent average of three representative,
independent experiments (±SD).
74
As an alternative approach, we sought to study the impact of the mitochondrial pRB
activity in the absence of pRB's canonical nuclear functions by targeting pRB specifically to the
mitochondria. Mutation of the NLS and direct targeting to the outside of the mitochondria using
the transmembrane domain of Bcl2 proved insufficient for exclusive mitochondrial localization
(data not shown), and instead we combined NLS mutation with fusion to the mitochondrial
leader peptide of ornithine transcarbamylase (mitoRBANLS; Fig. 7A). We note that this leader
peptide targets to the matrix of mitochondria, but it has been used successfully to study protein
function at the outer mitochondrial membrane, presumably by allowing resorting to other
mitochondrial compartments (Marchenko et al., 2000). We confirmed that expression of
mitoRBANLS did not cause general mitochondrial cytotoxicity, as judged by the absence of
increased ROS production (data not shown). We also localized a control protein, REL, to
mitochondria to further control for any non-specific effect of mitochondrial targeting. Stable,
inducible RAT16 cell lines were used to express mitoRBANLS, wildtype pRB, or mitoREL upon
doxycycline withdrawal. Importantly, we confirmed specific targeting of mitoRBANLS and the
control mitoREL protein to mitocliondria (Fig. 7B, C). Consistent with its restricted localization,
mitoRBANLS was unable to perform nuclear pRB functions, as judged by its inability to mediate
the transcriptional repression of cell cycle genes that are known pRB targets (cdc2, mcm3, mcm5,
mcm6, PCNA, and cyclinA2) in stark contrast to the wildtype pRB protein (Fig 7D). Importantly,
mitoRBANLS retained the ability to enhance TNFa/CHX-induced apoptosis (Fig. 7E). This was
not a non-specific effect of mitochondrial targeting, as the mitoREL control did not modulate
apoptosis (Fig. 7E). We note that wildtype pRB was expressed at much higher levels than the
mitoRBANLS protein, even when considering only the mitochondrially-localized fraction (Fig.
7C). Nevertheless, mitoRBANLS was almost as efficient as wildtype pRB at promoting
75
-
A
pRB
al
D2
Cdc2
p<Q05
*_00 i
0
pRB
-p=1.e-3
--
C
MCM5
p=!%1
exp
PCW
251
p<3e-3
p<7e-4
20
T
u basal
Minduced
0
01
Bax' +
+
-
DKO
+
+
TNFa/CHX
0 mito B
p<005
* mitp
25
C 20
S
d! 15
10
5
Bak -
p
CycA2
Bax-
DKO
0 mitoBALS
160 44
50
00
LS
p<0.05
wt
2
-
30
2
-TNFa-xX
+
+
.L 35
P<0.05
2
40
pRB
E2 PCNA
1
Bak-
tubulin
G 45
njg
E
+
+
BAX
D
-low
wt
pRB
BAK
MCM6
>
1
pRE
F
mitoRB
ANLS ind
0 mitoRB
S
40
.15
02
C
810
"
pRB
MCM3
p<&-3
0.
30
20
10
5
0
pRB
mitoREL
REL
E0
f ill
basal winduced
Figure 7. Mitochondria-targeted pRB is deficient for pRB's nuclear function, but
induces apoptosis in response to various apoptotic stimuli. (A) Schematic of
mitoRBANLS construct. pRB was targeted to mitochondria by fusion to the mitochondrial
leader peptide of ornithine transcarbamylase and mutation of the NLS. (B) Stable variants of
RAT16 cells allowing for inducible expression of mitoRBANLS, wildtype pRB, mitoREL,
and wildtype REL were generated and cellular localization following 24 hours induction was
assessed by immunofluorescence using antibodies against pRB and REL. Mitochondria were
visualized using MitoTracker. mitoRBANLS and mitoREL localized to mitochondria. (C)
Western blotting showing induced expression levels of mitoRBANLS and wildtype pRB at
mitochondria and total lysate. mitoRBANLS expressed at lower levels than wildtype pRB,
even when considering the mitochondrial fraction. (D) pRB, but not mitoRBANLS,
repressed E2F target genes cdc2, mci3, mcm5, mcm6, PCNA, cycA2 as measured by RT-
qPCR and normalized to ubiquitin. Average of two independent experiments (+SD). (E)
Induced expression of mitoRBANLS and wildtype pRB, but not mitoREL or REL, sensitized
to apoptosis induced by 24 hour treatment with TNFa and CHX. (B-E) Each RAT] 6 variant
was independently generated three times. Graph bars represent average of three
representative, independent experiments (±SD). (F) mitoR.BANLS expression was induced
by doxycycline addition for 24 hours in stable variants of wild-type, Bak-, Bax~
76
,
andBax -
TNFa/CHX-induced apoptosis. As an additional control against non-specific mitochondrial
cytotoxicity, we wanted to verify that mitoRBANLS works through the same directed
mechanism as wildtype pRB. Thus, we assessed the BAX/BAK dependence of this protein by
generating stable variants of immortalized wildtype, Bak", Bax"-, or Bax~ -;Bak--MEFs to allow
doxycycline-inducible mitoRBANLS expression (Fig. 7F). Expression of mitoRBANLS in
wildtype and Bakl-, but not Bak - or Ba"~;BakI - MEFs, enhanced TNFa-induced apoptosis (Fig.
7G). Thus, mitoRBANLS promotes apoptosis in a BAX-dependent manner, exactly like wildtype
pRB. Targeting pRB directly to the mitochondria therefore successfully generates a separation
of function mutant that is deficient for pRB's classic nuclear functions but retains the ability
induce apoptosis in a transcription-independent, BAX-dependent manner in response to TNFa.
In our earlier experiments, induction of wildtype pRB and RBSP consistently yielded a
small, but significant increase in apoptosis even in the absence of TNFa treatment. This led us to
hypothesize that mitochondrial pRB may function in a broader manner in apoptosis. We
therefore evaluated the effect of mitoRBANLS expression on apoptosis induced by apoptotic
factors other than TNFa. Immortalized wildtype or Bax~ ;Bak'- MEFs with and without
mitoRBANLS expression were treated with two drugs, etoposide and staurosporine (STS), that
work via distinct mechanisms. Notably, mitoRBANLS expression enhanced both etoposide and
STS-induced apoptosis (Fig. 7H). Thus, mitochondrial pRB can be activated in response to a
;Bak - immortalized MEFs and confirmed by western blotting using antibodies against pRB,
BAK, BAX, and tubulin. (G) Induction of mitoRBANLS in wildtype and Bak -, but not Bax~or Bax -;Bak -, MEFs sensitized to 10 hour treatment with TNFa and CHX. (H) Wildtype and
Bax ;Bak-- MEFs with and without induced expression of mitoRBANLS were treated with
staurosporine (STS; 1pM) for 6 hours or etoposide (25pM) for 12 hours. Induction of
mitoRBANLS in wildtype, but not Bay ;Bak MEFs enhanced apoptosis in response to STS
and etoposide. (F-H) Each MEF variant was independently generated twice. Graph bars
represent average of three representative, independent experiments (±SD).
77
variety of apoptotic stimuli, including both intrinsic and extrinsic stimuli. This argues that
mitochondrial pRB function may contribute to pRB-induced apoptosis in various settings.
Mito-targeted pRB suppresses tumor growth in vivo.
We next wanted to evaluate whether the mitochondrial function of pRB can contribute to
tumor suppression in vivo. For this analysis, we used a murine Rb-p53
-
osteosarcoma cell line
(DKO-OS) that is capable of forming xenografts in mice. We generated stable variants of DKOOS cells that would allow doxycycline inducible expression of mitoRBANLS or control proteins
(Fig. 8A, B). hlnportantly, mitoRBANLS localized specifically to mitochondria in these tumor
cells and it, but not mitoREL, promoted apoptosis in either the presence or absence of TNFu
treatment (Fig.8C and data not shown). We injected DKO-OS-mitoRBANLS or DKO-OS-wtRb
cells into immuno-compromised mice (12 injections/cell line) and switched half of the animals to
doxycycline once the tumor volume reached approximately 0.05cm 3 to yield tumors without
(herein referred to as basal) or with mitoRBANLS and wildtype pRB induction. We note that
these tumor cells were not treated with apoptotic stimuli but presumably were subject to
oncogenic stress. Control experiments (with parental DKO-OS cells) showed that the
doxycycline treatment itself was not tumor suppressive (Fig. 8D). Strikingly, expression of
wildtype pRB, versus mitoRBANLS, was similarly efficient in blocking further tumor expansion
(Fig. 9A). Specifically, after 11 days, the tumor volume with basal expression was three fold
greater than the tumor volume with either mitoRBANLS or pRB expression (Fig. 9A).
Importantly, despite this equivalent impact on tumor growth, examination of tumor sections
confirmed that there were clear differences in the cellular response to mitoRBANLS versus pRB
expression (Fig. 9B). Ki67, a proliferation marker and pRB-repression target, was
78
A
B
pRB mitoRB
- + ANLS
- + .ind
mitoRB
ANLS
I RB
ub
pRB
C
30
25
2020
CL
0
o basal
2 induced
p=0.01
D .1o
p<,-4
I
1
C0
a. 5
01
empty
m basal; n=5
m induced; n=4
D9i
mitoRB
ANLS
pRB
mito
REL
EQ0 1
4 6 8 11
Days after Induction
Figure 8. Mitochondria-targeted pRB induces apoptosis in transformed Rhb;p53'
osteosarcoma cells. (A) Representative image showing localization of mitoRBANLS and
pRB in transformed, Rb-~;p53- osteosarcoma cells by immunofluorescence. mitoRBANLS
localized to mitochondria and not the nucleus. (B) Western blot showing relative expression
levels of mitoRBANLS and pRB after 24 hours of induction. mitoRBANLS expressed
poorly compared to pRB. (C) Expression of mitoRBANLS or pRB, but not mitoREL, in
transformed, Rb~~;p3 ~osteosarcoma cells for 24 hours resulted in increased levels of
apoptosis, even in the absence of TNFa treatment. Graph bars represent average of three
independent experiments (±SD). (D) Rb~-;p53~ -osteosarcoma cells (parental) were injected
into the flank of nude mice. Once a tumor volume of approximately 0.05 cm 3 was reached,
half the mice were fed dox food and tumor volume was monitored for I I days (±SEM).
Doxycycline had no effect on the growth of xenografted tumors. Tumor volume normalized
to Day 1.
79
A 2
mitoRBANLS
a basal; n=6
2D minduced; n=6
.
C 45 opRB basal
pRB
a basal; n=6
22dDed
n6
*pRB induced
3
40
pI205
pa05
25
15
P1
tL
-37 5 7 9 1T10
Days after Induction
F- 1
1
3 5 7 9 11
Days after Induction
-
.=05
B
mitoRBANLS
basal
induced
+~
~
-
~
sR~161
-esooie
~~~'"TNF/CHX
SAp1i
pRB
basal
induced
Figure 9. Mitochondria-targeted pRB induces apoptosis in vivo and is tumorsuppressive. (A) Rb~;p53- osteosarcoma cell variants allowing for doxycycline inducible
expression of mitoRBANLS or wildtype pRB were injected into the flank of nude mice (2
injection sites per mouse; 12 injections per cell line variant). Once a tumor volume of
approximately 0.05 cm 3 was reached, mitoRBANLS or wildtype pRB expression was
induced in half the mice and tumor volume was monitored for 11 days (n=6/condition,
±SEM). Induced expression of mitoRBANLS or wildtype pRB suppressed growth of
xenografted tumors. Tumor volume normalized to Day 1. (B) Induced expression of
mitoRBANLS or wildtype pRB resulted in increased levels of apoptosis as measured by
immunohistochemistry using a cleaved caspase 3 antibody (top). Tumors expressing
mitoRBANLS also contained small areas with very high levels of apoptosis (inset). Induced
expression of wildtype pRB, but not mitoRBANLS decreased proliferation as measured by
Ki67 staining (bottom). Images representative of respective 6 tumor sections. (C) Murine
p16 was knocked down in immortalized wildtype MEF variants that allow for doxycyclineinducible expression of pRB. Phosphorylation status of pRB (as judged by mobility) and
knockdown of p16 using two distinct siRNAs was confirmed by western blotting. Induced
expression of pRB enhances TNFa/CHX-induced apoptosis in the presence and absence of
p16 and this activity is not inactivated by pRB phosphorylation. Bars, average of two
independent experiments (±SD).
80
downregulated in tumors expressing wildtype pRB, but completely unaffected by mitoRBANLS
(Fig. 9B, lower panels), in accordance with mitoRBANLS's inability to perform nuclear
functions. Both pRB proteins promoted apoptosis, as judged by cleaved caspase 3 staining, but
we observed qualitative differences in this response (Fig. 9B, upper panels). Tumors with
wildtype pRB showed a uniform increase in apoptosis (2.5 fold increase relative to basal,
p<0.01). Tumors with mitoRBANLS had regions comparable to the wildtype pRB response (2.3
fold increase relative to basal, p<0.001), but also included smaller regions (Fig. 9B, insert box)
that were profoundly apoptotic. Thus, wildtype pRB promotes both cell cycle arrest and
apoptosis, while mitoRBANLS is solely apoptotic. Importantly, despite its restricted biological
activity, mitoRBANLS was as efficient, if not more efficient, than wildtype pRB at mediating
tumor suppression in vivo.
These observations raise the possibility that the mitochondrial function of pRB could be
employed as a tumor suppressive mechanism, even in p53-deficient cells, at least when reexpressed in Rb null cells. This is very intriguing because approximately two thirds of human
tumors are wildtype for the Rb-1 gene, but instead carry alterations in upstream regulators of
pRB (p16e"J4 , cyclin D or cdk4) that promote its cdk-phosphorylation. Thus, we wanted to
determine whether pRB can mediate its mitochondrial apoptosis function in the presence of such
tumorigenic changes. This question was further spurred by our finding that cdk-phosphorylated
pRB is observed in the mitochondrial fractions (Fig. 4A). To address the influence of pRB
phosphorylation on mitochondrial pRB function we used two distinct siRNAs to knockdown p16
in our immortalized MEF populations that allow for doxycycline-inducible expression of pRB.
We confirmed that these siRNAs yielded near complete p16 knockdown and promoted hyperphosphorylation of the doxycycline-induced pRB (Fig. 9C). Importantly, pRB enhanced
81
TNFa/CHX-induced apoptosis with similar efficiency in MEFs with p16-knockdown versus
those transfected with a negative control duplex (Fig. 9C). These data strongly suggest that cdkphosphorylated pRB is competent to induce mitochondrial apoptosis and that this function will
persist in the majority of human tumors that contain wildtype, constitutively phosphorylated
pRB.
82
Discussion
We have known for more than two decades that pRB is localized in both the nucleus and
cytoplasm. However, prior studies have largely focused on pRB's nuclear functions, particularly
its widespread transcriptional roles. To our knowledge, no biological function has been assigned
to cytoplasmic pRB. In fact, it has been suggested that this species is essentially inactive, and its
existence simply reflects the loss of nuclear tethering of cdk-phosphorylated pRB (Mittnacht and
Weinberg, 1991; Templeton, 1992). By following the interplay between pRB and TNFa-induced
apoptosis, we have uncovered clear evidence for a biological role for pRB at mitochondria in
various cellular settings including normal, immortalized, and tumor cells. Initially, we found
that pRB not only enhanced TNFa-induced apoptosis, but could do so even in the presence of
cycloheximide. This argued that pRB could act in a novel manner to promote apoptosis. We
then discovered that this pRB function was BAX-dependent, indicating crosstalk to the
mitochondrial/intrinsic apoptotic pathway. Importantly, additional observations argue that pRB
plays a direct, and broadly applicable, role in this pathway. First, a fraction of endogenous pRB,
including some cdk-phosphorylated pRB, is localized on the outside of mitochondria. Second,
recombinant pRB is able to induce MOMP and liposome permeabilization in vitro. Third, pRB
can directly bind and activate BAX in vitro in the absence of any other proteins, and we confirm
an interaction between the endogenous pRB and BAX proteins in vivo. Fourth, targeting pRB to
mitochondria generates a separation of function mutant that is deficient for pRB's nuclear
functions but able to induce apoptosis in response to various stimuli including TNFa, etoposide,
staurosporine, and presumably (since it is active in tumor cells) oncogenic stress. Finally, and
most importantly, this mitochondrially-tethered pRB is sufficient to suppress tumorigenesis.
Given these findings, we believe that endogenous, mitochondrial pRB acts non-transcriptionally,
83
and in a broadly engaged manner, to promote apoptosis by activating BAX directly and inducing
MOMP. To our knowledge, this is the first reported non-transcriptional and non-nuclear
function for pRB.
Of course, we are not arguing that pRB is essential for mitochondrial apoptosis; this
process is consistently impaired, but not ablated, by pRB-deficiency. Instead, we conclude that
pRB is one of a growing list of proteins that are able to modulate the activity of core apoptotic
regulators. We suspect that pRB acts at the mitochondria to fine-tune the apoptotic threshold,
because its effects are dose-dependent (both in vitro and with overexpression/knockdown in
vivo), it is localized to mitochondria both in the absence and presence of apoptotic stimuli, and it
can potentiate many different pro-apoptotic signals. pRB's pro-apoptotic role is highly
reproducible, but the fold change in our cell studies could be judged as relatively modest (often
2-3 fold). However, we note that these experiments sample only one snapshot in time. Indeed,
in the context of the in vivo xenograft experiments, mitoRBANLS yielded the same modest
increase in the frequency of apoptotic cells within tumor sections (2-3 fold), but we can now see
the cumulative effects of pRB action and it is profoundly tumor suppressive.
As described above, our data provide some insight into the underlying mechanism of
mitochondrial pRB action; it requires BAX, but not BAK, both in vivo and in vitro, and pRB can
directly bind to and activate formerly inactive monomeric BAX. Clearly, additional questions
remain regarding this activity. The first concerns the precise nature of the pRB-BAX interaction.
Given pRB's preference for BAX over BAK, we conclude that the pRB binding site is either
specific to BAX, and not BAK, or it represents a shared domain that is somehow masked in the
BAK protein. We note that we have recently identified a novel, and unique, activation site on
the BAX protein (Gavathiotis et al., 2010; Gavathiotis et al., 2008) and thus are interested to
84
learn whether this might mediate pRB binding. In the case of pRB, we have shown here that the
small pocket domain is both necessary and sufficient for transcription-independent apoptosis and
thus likely contains sequences essential for BAX binding. This is gratifying, because the small
pocket is essential for pRB's tumor suppressive activity. However, this region is still relatively
large and mediates interactions with many other known pRB-associated proteins. Thus,
additional analysis will be required to further define the critical BAX-interacting sequence(s) and
determine how this might compete with the binding of other pRB targets. The second key
question concerns the mechanisms by which pro-apoptotic signals trigger mitochondrial pRB to
activate BAX. One obvious candidate is post-translational modifications. Our data show that
cdk-phosphorylated pRB is present at mitochondria and capable of promoting mitochondrial
apoptosis, based on the retention of mitochondrial pRB activity in p16 knockdown MEFs.
However, we have yet to understand whether phosphorylation by cdks (or other kinases) is
simply permissive for, or actively enables, pRB's mitochondrial apoptosis role. We also note
that it has been previously reported that TNFa treatment induces cleavage of pRB at the Cterminus releasing a 5kDa fragment (Huang et al., 2007; Tan et al., 1997). We were intrigued by
the possibility that this cleavage might be responsible for the activation of mitochondrial pRB
function by TNFa, presumably by exposing/activating the required small pocket domain.
However, our exploratory analyses of both pre-cleaved (i.e. delta 5kDa) and uncleavable forms
of pRB in stable inducible cell lines were inconsistent with the notion that cleavage is necessary
and sufficient for pRB activation (data not shown). Thus, it remains an open question how proapoptotic signals including TNFa trigger the mitochondrial pRB response.
85
Regardless of the remaining mechanistic questions, our findings considerably expand our
appreciation of pRB's role in apoptosis. It is already clear that pRB can either suppress
apoptosis by enforcing cell cycle arrest, or promote DNA damage-induced apoptosis by
transcriptionally co-activating pro-apoptotic genes (lanari et al., 2009). Here, we show that in
addition to these transcriptional mechanisms, pRB can also promote apoptosis directly at
mitochondria. We believe that pRB's overall pro-apoptotic function is likely a result of the
combined effect of nuclear and mitochondrial pRB. The relative extent to which these two
functions contribute to apoptosis is likely context specific. However, our mito-tagged pRB
experiments clearly showed that the mitochondrial function of pR3 can contribute to apoptosis
in response to a broad range of stimuli, including the oncogenic context of tumor cells. Most
importantly, our in vivo xenograft studies establish the tumor suppressive potential of
mitochondrial pRB in the absence of classic, nuclear pRB functions. Given these observations,
we conclude that mitochondrial apoptosis represents a novel, and bona fide, mechanism of tumor
suppression for pRB. This adds to a growing list of ways in which pRB has the potential to be
tumor suppressive, including its classic cell cycle function (Burkhart and Sage, 2008),
transcriptional co-regulation of apoptosis, autophagy, and metabolic genes (Blanchet et al., 2011;
Ciavarra and Zacksenhaus, 2011; Takahashi et al., 2012; Tracy et al., 2007; Viatour and Sage,
2011), and its ability to control fate commitment by modulating the transcriptional activity of
core differentiation regulators (Calo et al., 2010; Viatour and Sage, 2011). The extent to which
each of these mechanisms of pRB action contributes to overall tumor suppression remains to be
fully elucidated. The ability to localize pRB specifically to the mitochondria allowed us to study
pRB's mitochondrial role in the absence of all other known pRB functions. Remarkably, at least
in this context, this mito-specific pRB was as efficient, if not more efficient, than wildtype pRB
86
at suppressing tumorigenesis. This unequivocally establishes the potential potency of pRB's
mitochondrial apoptosis function. However, it does not disavow the potential contribution of
other pRB functions. It remains an open question whether the myriad roles of pRB collaborate
consistently in tumor suppression or whether, in specific contexts, one or more functions have
more physiological relevance than others. It is also interesting to note that the multiple functions
of pRB are highly reminiscent of those of the p53 tumor suppressor. p53 was also initially
linked to cell cycle arrest and then shown to play a central role in promoting apoptosis both
through the transcriptional activation of pro-apoptotic genes and by directly inducing MOMP at
the mitochondria in a transcription-independent manner (Chipuk et al., 2004; Leu et al., 2004;
Mihara et al., 2003; Speidel, 2010; Vousden and Prives, 2009). Our data now suggest that the
direct promotion of mitochondrial apoptosis is a general mechanism of tumor suppression.
Finally, we believe that our findings have significant implications for therapeutic
treatment in the approximately two-thirds of human tumors that retain wildtype pRB but instead
carry mutations that promote cdk/cyclin activation and pRB phosphorylation (Sherr and
McCormick, 2002). Historically, little attention has been paid to RB-1 status in
chemotherapeutic response because the absence of pRB or the presence of phospho-pRB
similarly inactivates pRB-mediated GI arrest. However, we have previously found that
phospho-pRB can activate transcription of pro-apoptotic genes (lanari et al., 2009). In this
current study, we show that the endogenous mitochondrial pRB includes the cdk-phosphorylated
form, and it retains its pro-apoptotic role in highly proliferative tumor cells and after inactivation
of the cdk inhibitor p16. Moreover, both the transcriptional and the mitochondrial, pro-apoptotic
functions of pRB occur independent of p53. Thus, we believe that it should be possible to
develop chemotherapeutic strategies for the majority of human tumors that retain wildtype RB-1,
87
which engage phospho-pRB and promote apoptosis through both transcriptional and
mitochondrial mechanisms.
88
Materials and Methods
Cell Culture and Drug Treatment
RAT16 and IMR90 cells were grown in MEM with Earle's Salts and 10% FBS, Pen-Strep, LGlutamine, Sodium Pyruvate, and NEAA. All other cell lines were grown in DMEM with 10%
FBS and Pen-Strep. For TNFL treatments, 50ng/ml of recombinant mouse TNFa (Sigma) was
used with 0.1 pM MG 132 (Calbiochem) for 48 hours or 0.5pg/ml CHX (Sigma) for 24 hours
unless noted otherwise. MEFs were treated with TNFa/CHX for 10 hours, IjpM staurosporine
(Sigma) for 6 hours, or 25piM etoposide (Sigma) for 12 hours. TET System approved FBS
(Clontech) and I jig/ml doxycycline (Clontech) were used for inducible cell lines unless noted
otherwise. Overexpression was induced for 24 hours prior to TNFa treatment. 20ptg/ml and
15pjg/ml doxycycline were used in wildtype, Bax"-, and Bak - MEFS to induce expression of
pRB and mitoRBANLS, respectively. 5pg/ml doxycycline was used in Bax- -;Bak - MEFs to
adjust for expression levels.
FACS Apoptosis Analysis
Cell suspensions were stained with AnnexinV-FITC or APC (Becton Dickinson) and Propidium
Iodide (Sigma) or 7AAD (Becton Dickinson). Total apoptotic cells were assessed by gating for
AnnexinV positive using a FACScan or FACSCalibur System (Becton Dickinson). Similar
trends were observed for all experiments when only early apoptotic (AnnexinV+;PI/7AAD-)
cells were considered (data not shown). For cell cycle profiling, cell suspensions were processed
as previously described (Ianari et al., 2009) and analyzed by FACScan and FlowJo.
89
Plasmid and Stable Cell Line Generation
Human pRB knockdown was performed as described previously (Chicas et al., 2010) and the
rodent Rb target sequence was TATAATGGAATCAAACTCCTC, Luc control
GAGCTCCCGTGAATTGGAATCC. 10pM siRNAs (IDT, murine p16) were transfected into
MEFs using RNAiMax (Invitrogen) according to manufacturer recommendations. The lentiviral
vector pCW22 (tet-on) was used for expression studies. Since RAT] 6 cells already contained
tTA (tet-off), the rtTA was removed by AgeI and XmaI digestion. mitoRBANLS was generated
by amplifying the mitochondrial leader peptide of ornithine transcarbamylase
(caaaagcgctatgctgtttaatctgagga, ggaaggcgcctgcactttattttgtag) and human RB
(ctatggcgcccaaaacccccc, gattttaattaatcatttctcttccttgt). The NLS was mutated using
gcaaaactaagctttgatattgaagg, tatcaaagcttagttttgccagtgg, followed by HindIl digestion. mitoREL
was generated by amplifying the mitochondrial leader peptide of ornithine transcarbamylase
(caaagttaacatgctgtttaatctgagga, gtttccggaggcctgcactttatlttgtag) and human REL
(tggcctccggagcgtataaccc,caaattaattaacttatacttgaaaaaattcatatg). pCW22 3HIA was generated using
3HA peptide (IDT) and ligated to RBN (caaagtcgacatgccgcccaaaac,
gattttaattaatcagtgtggaggaattacattcacct), RB_SP (caaagtcgacactccagttagga,
gattttaattaatcatgtttteagtctctgcatg), and RBC (caaagtcgacaatattttgcagtatgc,
gattttaattaatcatttctcttccttgt). Cells infected with the inducible construct underwent blasticidin
(Invitrogen) selection. All RAT16 variants were independently generated three times and all
MEF variants were independently generated twice.
90
Mitochondrial Fractionations
IMR90 mitochondria were fractionated as follows: cells were resuspended in cold Buffer A
[250mM Sucrose, 20mM Hepes pH 7.5, 10mM KCI, 1.5mM MgCl 2, 1mM EDTA, 1mM EGTA,
1mM DTT, protease inhibitors (Roche)] and homogenized using 20 strokes in a 1/4" cylinder cell
homogenizer (H&Y Enterprises, Redwood City, CA), 0.1558" ball. Nuclei and unlysed cells
were removed by low-speed centrifugation and mitochondria and 10% of initial cell suspension
(for Total Lysate) were lysed using RIPA buffer (0.5% Sodium Deoxycholate, 50mM Tris IICl
pH 7.6, 1% NP40, 0.1% SDS,140mM NaCl, 5mM EDTA, 100mM NaF, 2mM NaPPi, protease
inhibitors) and quantified using BCA Protein Assay reagent (Pierce).
Mitochondria were isolated from livers of 2-6 month old mice maintained on a mixed C57B1/6
xl29sv background as follows: Livers were minced in Buffer A (0.3M Mannitol, 10mM
HEPES/K p1 7.4, 0.1% BSA, 0.2mM EDTA/Na pH 8.0) and homogenized using 3 strokes in a
Teflon Dounce Homogenizer. A small fraction was removed for total lysate. Nuclei and unlysed
cells were removed from the remaining supernatant by low-speed centrifugation and
mitochondria were washed in Buffer B (0.3M Mannitol, 10mM HEPES/K pH 7.4, 0.1% BSA).
For whole mitochondria analysis, mitochondria and total lysate were lysed in RIPA buffer. For
subfractionation, the mitochondrial pellet was resuspended at 2mg/ml in Hypotonic Buffer
(10mM KCI, 2mM HEPES/K pH7.9), incubated on ice for 20 minutes and centrifuged at
14000rpm. The pellet was washed twice with Wash Buffer (150mM KCI, 2mM HEPES/K
pH7.9) and all three supernatants combined yielded the non-mitoplast fraction. The mitoplast
was resuspended in Hypotonic/Wash Buffer and equal fractions were analyzed by SDS-PAGE
91
and western blotting. Mitochondria were isolated from livers of Alb-creP4";BacI;Bak"-mice as
reported previously (Walensky et al., 2006).
In Vitro Cytochrome C Release Assay
The assay was performed as previously described (Chipuk et al., 2005). Briefly, wildtype
mitochondria were resuspended in Mitochondrial Isolation Buffer (200mM Mannitol, 68mM
Sucrose, 10mM HEPES/K pH 7.4, 100mM KCl, 1mM EDTA, ImM EGTA, 0.1%BSA) to a
concentration of 1pg/pl and incubated with pRB (Sigma), GST-Bax (Sigma), or cl. BID (R&D
Systems) for 1 hour, 37*C. DKO mitochondria were resuspended in experimental buffer
(125mM KCI, 10mM Tris-MOPS [pH 7.4], 5mM glutamate, 2.5mM malate, ImM KPO4, 10pM
EGTA-Tris [pH 7.4]) to a concentration of 1.5 mg/ml, and incubated with monomeric BAX
(purified as previously described (Gavathiotis et al., 2008)) and pRB (ProteinOne) for 45 min,
room temperature. Samples were centrifuged at 5500g and pellets versus supernatants were
analyzed by SDS-PAGE and immunoblotting.
Liposomal Release Assay
The liposomal release assay was performed as described previously (LaBelle et al., 2012; Lovell
et al., 2008). Briefly, large unilamellar vesicles (LUVs) were generated from a lipid mixture of
48% phosphatidylcholine, 28% phosphatidylethanolamine, 10% phosphatidylinositol, 10%
dioleoyl phosphatidylserine and 4% tetraoleoyl cardiolipin as chloroform stocks (Avanti Polar
Lipids). The lipid mixture was dried in glass test tubes under nitrogen gas and then under
vacuum for 15 h. The fluorescent dye ANTS (6.3 mg) and the quencher DPX (19.1 mg) were
added to I mg of dry lipid film, and the mixture resuspended in assay buffer (200mM KCl, ImM
92
MgCl2, 10mM HEPES, pH 7.0). After five freeze-thaw cycles, the lipid mixtures were extruded
through a 100 nm nucleopore polycarbonate membrane (Whatman) using a mini extruder
(Avanti). Liposomes were isolated by gravity flow SEC using a crosslinked Sepharose CL-2B
column (Sigma Aldrich). LUVs (5 tl) were treated with the indicated concentrations of BAX
and pRB in 384-well format (Coming) in a total reaction volume of 30 pl. After time-course
fluorescence measurement on a Tecan Infinite M1000 spectrophotometer (excitation 355 nm,
emission 520 rim), Triton X-100 was added to a final concentration of 0.2% (v/v) to determine
maximal release.
Immunoprecipitation
For the in vitro binding assay, recombinant, monomeric BAX (1 pM) and pRB (1 pM) were
mixed in 1 OR] TBS (50 mM Tris, 150 mM NaCl) and pre-incubated for 30 minutes, room
temperature. The samples were diluted with 1% BSA in TBS to 80pl, and incubated with preequilibrated Protein A/G-agarose beads (Santa Cruz) and 5pl 6A7 antibody (sc-23959, Santa
Cruz) with rotation for I h, room temperature. Beads were collected and washed three times with
0.5 ml 1% (w/v) BSA/TBS buffer.
For the endogenous interaction study, IMR90 cells were treated with 50ng/ml TNFx and
0.5 [g/mI CHX for 3 hours total and crosslinked with lmg/ml DSP (Pierce) for 1 hour. Proteins
were extracted using an NP40 based buffer (50mM HEPES pH7.9, 10% glycerol, 150mM NaCl,
1 %NP40, 1mM NaF, 10mM B-Glycerophosphate, protease inhibitors). The following antibodies
were used: pRB (Cell Signaling, 9309), normal rabbit IgG (Santa Cruz).
93
Western Blotting
Samples were loaded in SDS Lysis Buffer (8% SDS, 250mM TrisHCl pH 6.6, 40 % glycerol,
5% 2-Mercaptoethanol, bromophenol blue), separated by SDS-PAGE, transferred to a
nitrocellulose membrane, and blocked in 5% nonfat milk. The following antibodies were used in
2.5% nonfat milk: human pRB (Cell Signaling, 9309), rodent pRB (Becton Dickinson, 554136),
phospho-pRB (Cell Signaling, 2181,9301,9307,9308), procaspase 7 (Cell Signaling, 9492),
cleaved caspase 7 (Cell Signaling, 9491), procaspase 3 (Cell Signaling, 9662), cleaved caspase 3
(Cell Signaling, 9661), actin (Santa Cruz, SC 1616 IIRP), tubulin (Sigma, T9026), BAX (Cell
Signaling, 2772; Santa Cruz, sc-493), BAK (Cell Signaling, 3814), cyclin A (Santa Cruz,
sc594), HDACI (Upstate, 05-614), PCNA (Abcam, ab29), Lamin A/C (Cell Signaling, 2032),
COXIV (Cell Signaling, 4850), Histone H3 (Santa Cruz, sc8654), ATPB (Abcam, ab5432),
SirT3 (Cell Signaling, 5490), cytochrome c (Becton Dickinson, 556433), p16 (Santa Cruz,
sc7440 1), HA. 11 (Covance) and GAPDII (Ambion, 4300). Secondary HRP-conjugated
antibodies (Santa Cruz) were used at 1:5000 in 1% nonfat milk.
RealTime PCR
RNA was isolated using RNAeasy Kit (Qiagen) and reverse transcribed using Superscript III
reverse transcriptase (Invitrogen). RealTime PCR reactions were performed with SYBR Green
(Applied Biosystems) on the ABI Prism 7000 Sequence Detection System and analyzed using
the 7000 SDS software. The following primers were used:
Cdc2 (CTGGCCAGTTCATGGATTCT, ATCAAACTGGCAGATTTCGG),
Cyclin A2 (GAGAATGTCAACCCCGAAAA, ATAAACGATGAGCACGTCCC),
Mcm3 (GTACGAGGAGTTCTACATAG, TCTTCTTAGTAGCAGGACAG),
94
Mcm5 (GAGGACCAGGAGATGCTGAG, CTTTACCGCCTCAAGTGAGC),
Mcm6 (CACGATTTGGAGGGAAAGAA, TCCACGGCAATGATGAAGTA),
PCNA (TCCCAGACAAGCAATGTTGA, TTATTTGGCTCCCAAGATCG),
UB (TTCGTGAAGACCCTGACC, ACTCTTTCTGGATGTTGTAGTC),
Casp3 (ACTGCGGTATTGAGACAGAC, CGCAAAGTGACTGGATGAAC),
Casp7 (GCTCCACCATCATCTCATCC, TGCCCATCTTCTCGAAGTCC),
Bcl2 (AGTACCTGAACCGGCATCTG, AGGTCTGCTGACCTCACTTG),
Apafl (CATGCCCTCCTAGAAGGTTG, GAACACGGAGACGGTCTTTG),
Casp9 (GTAGTGAAGCTGGACCCATC, TTCCCTGGAGTACAGACATC),
MAP3K5 (CGTTGGCCGAATCTACAAAG, ACTGTAGTGTTGGCTCAGAC),
p21 (TGGCCTTGTCGCTGTCTTGC, AGACCAATCGGCGCTTGGAG),
CaspI (CTAAGGGAGGACATCCTTTC, CAGATAATGAGGGCAAGACG),
Casp4 (AAGAGGAGCTTACGGCTGAG, CCTGCAATGTGCCATGAGAC),
Beclin (TAGCTGAAGACCGGGCGA TG, TGCTGCTGGACGCCTTAGAC),
Flip (ATAAAGCAGCGGTGGAGGAC, TTGCCTCGGCCTGTGTAATC)
Xenograft Model: All animal procedures followed protocols approved by MIT's Committee on
Animal Care. Nude/SCID mice (Taconic) were injected subcutaneously with 107 tumor cells per
site, 2 sites per mouse. After euthanasia, tumors were removed, fixed overnight in formalin
followed by overnight incubation in 70% ethanol, and subjected to histological processing.
Immunofluorescence and Immunohistochemistry
Cells were plated at low density on coverslips and protein expression was induced for 48 hours.
Mitochondria were labeled using MitoTracker Deep Red (Invitrogen) at I 00nM for 45 minutes,
95
37*C. Cells were fixed in 4% Formaldehyde (Thermo Scientific), permeabilized with 0.25%
TritonX-100/PBS, and blocked with 5% Goat Serum in 0.2% Tween20/PBS for 30 minutes,
37*C. The following antibodies were used at 1:200 for 1 hour, room temperature: pRB (Cell
Signaling, 9309), c-REL (Cell Signaling, 4727). Alexa Fluor 488 (Invitrogen) was used at
1:1000 for 1 hour, room temperature and slides were mounted using SlowFade Gold Antifade
Reagent with DAPI (Invitrogen) and observed under a fluorescence microscope (Zeiss).
Ki67 and cleaved caspase 3 immunohistochemistry was performed with a modified citric acid
unmasking protocol. Briefly, paraffin was removed from slides, followed by incubation in 0.5%
H2 0 2/methanol for 15 minutes and antigen retrieval using citrate buffer, pH 6.0 in a microwave
for 15 minutes. Slides were blocked for 1 hour at room temperature in 2% normal horse serum
(Ki67) or 10% goat serum (cc3) in PBS. Ki67 (Becton Dickinson, 550609, 1:50) and cleaved
caspase 3 (Cell Signaling, 9661, 1:200) antibodies were used in 0.15% Triton/PBS overnight at
4'C. Secondary antibodies (Vector Laboratories) were used at 1:200 in PBS with 0.4% normal
horse serum (Ki67) or 2% goat serum (cc3), detected using a DAB Substrate Kit (Vector
Laboratories), and counterstained with haematoxylin.
96
Acknowledgments
We thank E. Knudsen for providing the RATI 6 parental and LP-RB inducible cell lines, A. Letai
for wildtype and Bacx /Bak MEFs, S. Lowe for human Rb shRNA, and M. Hemann for rodent
Rb shRNA. We also thank the members of the Lees laboratory for input during the study and
manuscript preparation. This work was supported by an NCI/NIH grant to J.A.L. who is a
Ludwig Scholar at MIT. K.I.H. was supported by an NSF pre-doctoral fellowship and D.H. Koch
Graduate Fellowship.
97
References
Araki, K., Ahmad, S.M., Li, G., Bray, D.A., Jr., Saito, K., Wang, D., Wirtz, U., Sreedharan, S.,
O'Malley, B.W., Jr., and Li, D. (2008). Retinoblastoma RB94 enhances radiation treatment of
head and neck squamous cell carcinoma. Clin Cancer Res 14, 3514-3519.
Blanchet, E., Annicotte, J.-S.b., Lagarrigue, S., Aguilar, V., Clap6 , C., Chavey, C., Fritz, V.,
Casas, F.o., Apparailly, F., Auwerx, J., et al. (2011). E2F transcription factor-I regulates
oxidative metabolism. Nature cell biology 13, 1146-1152.
Bosco, E.E., Mayhew, C.N., Hennigan, R.F., Sage, J., Jacks, T., and Knudsen, E.S. (2004). RB
signaling prevents replication-dependent DNA double-strand breaks following genotoxic insult.
Nucleic Acids Res 32, 25-34.
Bnnelle, J., and Letai, A. (2009). Control of mitochondrial apoptosis by the Bcl-2 family.
Journal of cell science 122, 437-478.
Burkhart, D.L., and Sage, J. (2008). Cellular mechanisms of tumour suppression by the
retinoblastoma gene. Nat Rev Cancer 8, 671-682.
Calo, E., Quintero-Estades, J.A., Danielian, P.S., Nedelcu, S., Berman, S.D., and Lees, J.A.
(2010). Rb regulates fate choice and lineage commitment in vivo. Nature 466, 1110-1114.
Carnevale, J., Palander, 0., Seifried, L.A., and Dick, F.A. (2012). DNA damage signals through
differentially modified E2Fl molecules to induce apoptosis. Mol Cell Biol 32, 900-912.
Chicas, A., Wang, X., Zhang, C., McCurrach, M., Zhao, Z., Mert, 0., Dickins, R., Narita, M.,
Zhang, M., and Lowe, S. (2010). Dissecting the unique role of the retinoblastoma tumor
suppressor during cellular senescence. Cancer Cell 17, 376-463.
Chipuk, J., Bouchier-Hayes, L., Kuwana, T., Newmeyer, D., and Green, D. (2005). PUMA
couples the nuclear and cytoplasmic proapoptotic function of p53. Science (New York, NY) 309,
1732-1737.
Chipuk, J., Kuwana, T., Bouchier-Hayes, L., Droin, N., Newmeyer, D., Schuler, M., and Green,
D. (2004). Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization
and apoptosis. Science (New York, NY) 303, 1010-1014.
98
Chipuk, J., Moldoveanu, T., Llambi, F., Parsons, M., and Green, D. (2010). The BCL-2 family
reunion. Molecular cell 37, 299-609.
Ciavarra, G., and Zacksenhaus, E. (2011). Direct and indirect effects of the pRb tumor
suppressor on autophagy. Autophagy 7, 544-546.
de Bruin, A., Wu, L., Saavedra, H.I., Wilson, P., Yang, Y., Rosol, T.J., Weinstein, M., Robinson,
M.L., and Leone, G. (2003). Rb function in extraembryonic lineages suppresses apoptosis in the
CNS of Rb-deficient mice. Proc Natl Acad Sci U S A 100, 6546-655 1.
Eskes, R., Desagher, S., Antonsson, B., and Martinou, J.C. (2000). Bid induces the
oligomerization and insertion of Bax into the outer mitochondrial membrane. Mol Cell Biol 20,
929-935.
Ferecatu, I., Le Floch, N., Bergeaud, M., Rodriguez-Enfedaque, A., Rincheval, V., Oliver, L.,
Vallette, F.M., Mignotte, B., and Vayssiere, J.L. (2009). Evidence for a mitochondrial
localization of the retinoblastoma protein. BMC Cell Biol 10, 50.
Fulcher, A., Dias, M., and Jans, D. (2010). Binding of p 10 retinoblastoma protein inhibits
nuclear import of simian virus SV40 large tumor antigen. The Journal of biological chemistry
285, 17744-17797.
Gavathiotis, E., Reyna, D.E., Davis, M.L., Bird, G.H., and Walensky, L.D. (2010). BH3triggered structural reorganization drives the activation of proapoptotic BAX. Mol Cell 40, 481492.
Gavathiotis, E., Suzuki, M., Davis, M.L., Pitter, K., Bird, G.H., Katz, S.G., Tu, H.C., Kim, H.,
Cheng, E.H., Tjandra, N., et al. (2008). BAX activation is initiated at a novel interaction site.
Nature 455, 1076-1081.
Gordon, G., and Du, W. (2011). Conserved RB functions in development and tumor suppression.
Protein & cell 2, 864-942.
Hsu, Y.T., and Youle, R.J. (1997). Nonionic detergents induce dimerization among members of
the Bcl-2 family. J Biol Chem 272, 13829-13834.
Huang, X., Masselli, A., Frisch, S.M., Hunton, I.C., Jiang, Y., and Wang, J.Y. (2007). Blockade
of tumor necrosis factor-induced Bid cleavage by caspase-resistant Rb. J Biol Chem 282, 2940129413.
99
Ianari, A., Natale, T., Calo, E., Ferretti, E., Alesse, E., Screpanti, I., Haigis, K., Gulino, A., and
Lees, J.A. (2009). Proapoptotic function of the retinoblastoma tumor suppressor protein. Cancer
Cell 15, 184-194.
Jacks, T., Fazeli, A., Schmitt, E.M., Bronson, R.T., Goodell, M.A., and Weinberg, R.A. (1992).
Effects of an Rb mutation in the mouse. Nature 359, 295-300.
Jiao, W., Datta, J., Lin, H.-M., Dundr, M., and Rane, S. (2006). Nucleocytoplasmic shuttling of
the retinoblastoma tumor suppressor protein via Cdk phosphorylation-dependent nuclear export.
The Journal of biological chemistry 281, 38098-3 8206.
Jiao, W., Lin, H.M., Datta, J., Braunschweig, T., Chung, J.Y., Hewitt, S., and Rane, S. (2008).
Aberrant nucleocytoplasmic localization of the retinoblastoma tumor suppressor protein in
human cancer correlates with moderate/poor tumor differentiation. Oncogene 27, 3156-3220.
Jin, Z., and El-Deiry, W.S. (2005). Overview of cell death signaling pathways. Cancer Biol Ther
4, 139-163.
Karin, M., and Lin, A. (2002). NF-kappaB at the crossroads of life and death. Nat Immunol 3,
221-227.
Knudsen, E., and Knudsen, K. (2008). Tailoring to RB: tumour suppressor status and therapeutic
response. Nature reviews Cancer 8, 714-738.
Knudsen, K.E., Booth, D., Naderi, S., Sever-Chroneos, Z., Fribourg, A.F., Hunton, I.C.,
Feramisco, J.R., Wang, J.Y., and Knudsen, E.S. (2000). RB-dependent S-phase response to DNA
damage. Mol Cell Biol 20, 7751-7763.
Knudsen, K.E., Weber, E., Arden, K.C., Cavenee, W.K., Feramisco, J.R., and Knudsen, E.S.
(1999). The retinoblastoma tumor suppressor inhibits cellular proliferation through two distinct
mechanisms: inhibition of cell cycle progression and induction of cell death. Oncogene 18, 52395245.
LaBelle, J.L., Katz, S.G., Bird, G.H., Gavathiotis, E., Stewart, M.L., Lawrence, C., Fisher, J.K.,
Godes, M., Pitter, K., Kung, A.L., et al. (2012). A stapled BIM peptide overcomes apoptotic
resistance in hematologic cancers. J Clin Invest 122, 2018-2031.
Leu, J., Dumont, P., Hafey, M., Murphy, M., and George, D. (2004). Mitochondrial p53 activates
Bak and causes disruption of a Bak-Mcll complex. Nature cell biology 6, 443-493.
100
Lovell, J.F., Billen, L.P., Bindner, S., Shamas-Din, A., Fradin, C., Leber, B., and Andrews, D.W.
(2008). Membrane binding by tBid initiates an ordered series of events culminating in membrane
penneabilization by Bax. Cell 135, 1074-1084.
Manning, A., and Dyson, N. (2012). RB: mitotic implications of a tumour suppressor. Nature
reviews Cancer 12, 220-226.
Marchenko, N., Zaika, A., and Moll, U. (2000). Death signal-induced localization of p53 protein
to mitochondria. A potential role in apoptotic signaling. The Journal of biological chemistry 275,
16202-16214.
Martinou, J.-C., and Youle, R. (2011). Mitochondria in apoptosis: Bcl-2 family members and
mitochondrial dynamics. Developmental cell 21, 92-193.
Masselli, A., and Wang, J.Y. (2006). Phosphorylation site mutated RB exerts contrasting effects
on apoptotic response to different stimuli. Oncogene 25, 1290-1298.
Mihara, M., Erster, S., Zaika, A., Petrenko, 0., Chittenden, T., Pancoska, P., and Moll, U.M.
(2003). p53 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.
Milet, C., Rincheval-Amold, A., Mignotte, B., and Guenal, I. (2010). The Drosophila
retinoblastoma protein induces apoptosis in proliferating but not in post-mitotic cells. Cell Cycle
9, 97-103.
Mittnacht, S., and Weinberg, R.A. (1991). GIl/S phosphorylation of the retinoblastoma protein is
associated with an altered affinity for the nuclear compartment. Cell 65, 381-393.
Perez, D., and White, E. (2000). TNF-alpha signals apoptosis through a bid-dependent
conformational change in Bax that is inhibited by El B 19K. Mol Cell 6, 53-63.
Roth, D., Harper, I., Pouton, C., and Jans, D. (2009). Modulation of nucleocytoplasmic
trafficking by retention in cytoplasm or nucleus. Journal of cellular biochemistry 107, 11601167.
Sherr, C.J., and McCormick, F. (2002). The RB and p53 pathways in cancer. Cancer Cell 2, 103112.
101
Speidel, D. (2010). Transcription-independent p53 apoptosis: an alternative route to death.
Trends in cell biology 20, 14-38.
Takahashi, C., Sasaki, N., and Kitajima, S. (2012). Twists in views on RB functions in cellular
signaling, metabolism and stem cells. Cancer science.
Tan, X., Martin, S.J., Green, D.R., and Wang, J.Y. (1997). Degradation of retinoblastoma protein
in tumor necrosis factor- and CD95-induced cell death. J Biol Chem 272, 9613-9616.
Templeton, D.J. (1992). Nuclear binding of purified retinoblastoma gene product is determined
by cell cycle-regulated phosphorylation. Mol Cell Biol 12, 435-443.
Tracy, K., Dibling, B.C., Spike, B.T., Knabb, J.R., Schumacker, P., and Macleod, K.F. (2007).
BNIP3 is an RB/E2F target gene required for hypoxia-induced autophagy. Mol Cell Biol 27,
6229-6242.
Traenckner, E.B., Wilk, S., and Baeuerle, P.A. (1994). A proteasome inhibitor prevents
activation of NF-kappa B and stabilizes a newly phosphorylated form of I kappa B-alpha that is
still bound to NF-kappa B. EMBO J 13, 5433-5441.
van den Heuvel, S., and Dyson, N.J. (2008). Conserved functions of the pRB and E2F families.
Nat Rev Mol Cell Biol 9, 713-724.
Viatour, P., and Sage, J. (2011). Newly identified aspects of tumor suppression by RB. Disease
models & mechanisms 4, 581-586.
Vousden, K., and Prives, C. (2009). Blinded by the Light: The Growing Complexity of p53. Cell
137, 413-444.
Walensky, L.D., and Gavathiotis, E. (2011). BAX unleashed: the biochemical transformation of
an inactive cytosolic monomer into a toxic mitochondrial pore. Trends Biochem Sci 36, 642-652.
Walensky, L.D., Pitter, K., Morash, J., Oh, K.J., Barbuto, S., Fisher, J., Smith, E., Verdine, G.L.,
and Korsmeyer, S.J. (2006). A stapled BID BH3 helix directly binds and activates BAX. Mol
Cell 24, 199-210.
102
Wenzel, P.L., Wu, L., de Bruin, A., Chong, J.L., Chen, W.Y., Dureska, G., Sites, E., Pan, T.,
Sharma, A., Huang, K., et aL. (2007). Rb is critical in a mammalian tissue stem cell population.
Genes Dev 21, 85-97.
Wu, L., de Bruin, A., Saavedra, H.I., Starovic, M., Trimboli, A., Yang, Y., Opavska, J., Wilson,
P., Thompson, J.C., Ostrowski, M.C., et aL. (2003). Extra-embryonic function of Rb is essential
for embryonic development and viability. Nature 421, 942-947.
Wyllie, A. (2010). "Where, 0 death, is thy sting?" A brief review of apoptosis biology.
Molecular neurobiology 42, 4-13.
103
Chapter Three
Regulation of the mitochondrial function of pRB
Keren I Hilgendorf, Jeremy Ryan, Elizaveta S Leshchiner, Anthony Letai,
Loren D Walensky, Jacqueline A Lees
K.I.H. contributed to all experiments and text. J.R. contributed Fig. 3A, B. E.S.L contributed
Fig. 5B, C.
104
Abstract
The retinoblastoma protein (pRB) is an important tumor suppressor and functions as a
transcriptional co-regulator of a multitude of cellular processes including proliferation,
differentiation, and apoptosis. We have recently extended our appreciation of pRB's tumor
suppressive roles to show that a fraction of pRB localizes to mitochondria and directly binds to
and activates BAX to induce apoptosis. Thus, pRB can promote apoptosis both via a nuclear,
transcriptional mechanism and a mitochondrial, non-transcriptional mechanism. This study has
yielded many more questions, including how mitochondrial pRB function is regulated. Here we
present our initial attempts toward addressing these follow-up questions. Specifically, we show
that ectopic pRB expression induces apoptosis within a few hours. We were unable to identify a
BH3 domain, but show that pRB impinges on the mitochondrial apoptotic pathway by interacting
with several Bcl2 family members.
Finally, we show that mitochondrial pRB function is
regulated in a manner that is distinct from pRB's anti-proliferative function. Together, these data
reinforce and expand our previous observations about mitochondrial pRB function.
105
Introduction
There are two general apoptotic pathways: the intrinsic/mitochondrial pathway induced
by stimuli like DNA damage and the extrinsic pathway induced by death ligands like TNFa. The
extrinsic pathway can feed into the mitochondrial pathway and both activate initiator caspases
(caspases 8, 9), which in turn cleave and activate effector caspases (caspases 3, 6, 7) (Chipuk et
al., 2010). The Bcl2 protein family controls initiation of the mitochondrial pathway and is
divided into three subclasses based on the presence of Bcl2 homology domains (BH1-4), which
correspond to a-helices. Anti-apoptotic Bcl2 family members (e.g. Bcl2, BclXL) contain all four
BH domains, while pro-apoptotic, multidomain family members (BAX, BAK) contain three.
Finally, pro-apoptotic BH3-only proteins act as upstream sensors of apoptotic stimuli.
Activation of BH3-only proteins results in activation and oligomerization of BAX/BAK,
formation of a pore and permeabilization of the mitochondrial outer membrane (MOMP), and
release of apoptotic regulators (e.g. cytochrome c) from the intermembrane space into the
cytoplasm. This in turn causes initiator caspase activation and apoptosis (Wyllie, 2010). Thus,
the mitochondrial pathway is dependent on BAX or BAK (Lindsten et al., 2000; Wei et al.,
2001). Inactive BAX is cytoplasmic, while BAK is constitutively localized to the outer
mitochondrial membrane. BAX/BAK activation is a multi-step process involving translocation
of BAX to the mitochondrial outer membrane and conformational changes in BAX and BAK
(Youle and Strasser, 2008). BH3-only proteins can effect these changes in BAX/BAK by either
acting as activators and directly binding BAX/BAK or by acting as sensitizers and binding antiapoptotic Bcl2 family members to relieve their inhibition of pro-apoptotic family members (Letai
et al., 2002). In addition, a number of non-Bcl2 family members have been identified that can
act as activators or sensitizers to promote activation of BAX/BAK and apoptosis. These include
106
the tumor suppressor p53, the orphan nuclear steroid receptor Nur77, the nuclear protein histone
H1.2, and the nucleolar phosphoprotein nucleophosmin (Chipuk et al., 2004; Chipuk et al., 2003;
Dumont et al., 2003; Gine et al., 2008; Kerr et al., 2007; Konishi et al., 2003; Li et al., 2000; Lin
et al., 2004; Mihara et al., 2003; Okamura et al., 2008).
We have recently uncovered a novel, non-transcriptional role of the tumor suppressor
pRB in promoting apoptosis directly at the mitochondria (Hilgendorf et al., 2013). pRB is a
pleiotropic protein and has been most well characterized as a transcriptional co-regulator of
proliferation. Specifically, pRB regulates entry into the cell cycle by interacting with and
inhibiting the E2F family of transcription factors during the GO/G 1 phase of the cell cycle. Upon
mitogenic signaling, cyclin-CDK complexes are activated and hyperphosphorylate pRB,
resulting in release of E2F transcription factors and expression of genes important for S phase
entry (van den Heuvel and Dyson, 2008). While the RB-I gene itself is found mutated in some
tumors (e.g. retinoblastoma, osteosarcoma), most tumors contain alterations upstream of pRB,
resulting in constitutive hyperphosphorylation of the pRB protein and inactivation of its cell
cycle function (Burkhart and Sage, 2008; Gordon and Du, 2011). Nuclear pRB has also been
shown to regulate other cellular processes, including apoptosis. Specifically, pRB can
transcriptionally co-activate expression of pro-apoptotic genes in response to various apoptotic
stimuli, including genotoxic stress, oncogenic stress, and TGFP treatment (Carnevale et al.,
2012; lanari et al., 2009; Korah et al., 2012).
We have shown that pRB can also promote apoptosis in the presence of an inhibitor of
translation and that a fraction of pRB is localized to mitochondria. Moreover, this mitochondrial
pRB can directly bind to and activate BAX to induce MOMP. Thus, in addition to its many
nuclear functions, pRB can promote apoptosis directly at the mitochondria. Moreover, pRB that
107
is targeted directly to mitochondria via fusion to a mitochondrial leader peptide is tumorsuppressive in vivo. This shows that mitochondrial pRB function can contribute toward pRB's
overall role as a tumor suppressor.
We do not understand yet how pRB localizes to mitochondria (including in untreated
cells) and is regulated to bind and activate BAX. Moreover, we do not know how this pRB
function fits into overall activation of mitochondrial apoptosis. Here we present our initial
forays into answering these questions. We note that much of this data is negative and should
therefore be interpreted with caution. Nonetheless, these data are important in shaping how we
propose to move our study of mitochondrial pRB function forward. In particular, we present
evidence that pRB functions as a general, and rapid, modulator of apoptosis by binding BAX as
well as Bcl2. Furthermore, we show that mitochondrial pRB activity is regulated in a manner
distinct from nuclear pRB's anti-proliferative function. Taken together, we therefore provide
further proof for mitochondrial pRB function and have initiated the process of elucidating
mitochondrial pRB's mechanism of action.
108
Results
Ectopic pRB expression induces effector caspase cleavage and apoptosis within hours.
We have previously shown that pRB localizes to mitochondria both in the absence and
presence of treatment and can induce mitochondrial apoptosis directly in a transcriptionindependent manner and in response to various apoptotic stimuli, including TNFa, etoposide,
staurosporine, and in tumors (Hilgendorf et al., 2013). Moreover, ectopic expression of pRB
resulted in a small, but highly reproducible increase in levels of apoptosis (Hilgendorf et al.,
2013). This lead us to hypothesize that pRB acts as a general modulator of mitochondrial
apoptosis, which can be activated in response to various cellular damages and stresses.
However, the mechanism of how pRB localizes to mitochondria and gets activated to promote
apoptosis remains to be determined. Since ectopic pRB expression induces apoptosis, we first
wanted to investigate the kinetics of mitochondrial pRB function. To study this, we used an
immortalized rat embryonic fibroblast cell line variant, RAT16, which is inducible for pRB
expression upon withdrawal of doxy-cycline. We induced pRB expression and analyzed cells for
apoptosis and effector caspase protein levels every 4 hours for 24 hours in the absence of any
apoptotic treatment (Fig. 1). Ectopic expression of pRB did not affect procaspase 3 and 7 protein
levels (Fig. I A). This is consistent with our prior data showing no upregulation of effector
caspase mRNA upon ectopic pRB expression (Hilgendorf et al., 2013). Notably, apoptosis
levels, as assessed by cleaved caspase 3 and 7 protein levels and AnnexinV staining, were
increased within about 12 hours of ectopic pRB expression (Fig. IA, B). We note that the
overall levels of apoptosis were small, but that this experiment was conducted in the absence of
an apoptotic stimulus. There was also a small initial increase in apoptosis at the 4 hour time
point. Since we observed this both with and without induction of pRB expression, this is likely a
109
A
4h
- +
8h
12h
-+
+
16h
-+
20h 24h
-+
-+
RBinduction
Rb
C
Nuclear
4
Procasp 7
24
Mitochondria
4
24 h pRB ind.
RB
cl. casp 7
Lamin A/C
Procasp 3
cl. casp 3
ATP Synthetase
actin
B
12
0 basal
Minduced
10
2
0
4
8
12
16
20
24h
Figure 1. Ectopic pRB expression promotes apoptosis with a few hours. pRB
expression was induced in RAT 16 cells and cells were collected every four hours for 24
hours and analyzed by both western blotting and AnnexinV staining. (A) Western blot
showing pRB, procaspase 3 and 7, and cleaved caspase 3 and 7 protein levels. pRB is
maximally expressed within 8 hours of induction. Increased levels of cleaved caspase 3
and 7 are observed after about 12 hours of pRB expression. Procaspase 3 and 7 levels are
unchanged. (B) Levels of apoptosis as assessed by AnnexinV staining. Induced
expression of pRB results in a small increase in apoptosis after about 16 hours of
treatment. This is consistent with the western blot data. (C) Western blot showing
nuclear and mitochondrial pRB levels after 4 and 24 hours of induced pRB expression.
Mitochondrial pRB levels accumulate over time.
110
result of stress induced by the experimental handling of the cells. Importantly, approximately 8
hours of doxycycline withdrawal were required for maximal ectopic pRB expression and the
kinetics of mitochondrial pRB protein accumulation mimicked those of nuclear pRB (Fig. IA,
C). Thus, ectopic pRB expression induces apoptosis within a few hours, consistent with the
hypothesis that it can function as a modulator of apoptosis to fine-tune the apoptotic response.
pRB induces mitochondrial apoptosis in a BH3-independent manner.
We next wanted to investigate which region of pRB is important to directly trigger
MOMP. We have previously shown that pRB's transcription-independent, pro-apoptotic
function maps to the small pocket domain. Moreover, we have shown using both genetic and
biochemical approaches that pRB acts as a direct activator of the pro-apoptotic multidomain
Bcl2 family member BAX (Hilgendorf et al., 2013). Next, we wanted to investigate whether
pRB contains a BH3 domain and is therefore a Bcl2 family member. Analysis of the human
pRB sequence identified 8 putative BH3 domains based on the presence of the B13 consensus
sequence (LxxxxD), with none of them highly conserved across species. The Small Pocket
contains four of these domains (henceforth referred to as peptide #1-4 based on position within
the protein) (Fig 2A). Analysis of the crystal structure of the unliganded pRB pocket (Balog et
al., 2011) revealed that all four putative domains are exposed, but only peptide #2 forms an ahelix, the secondary structure adopted by BH3 domains to promote apoptosis (Fig. 2B).
However, we note that activation of pRB, perhaps via post-translational modifications, may
change the structure of pRB to form additional exposed alpha-helices (Burke et al., 2012; Rubin,
2012). We synthesized peptides containing the putative BH3 domain and surrounding residues
(20-mer) and assayed for ability to interact with Bcl2 family members. Specifically, we
performed an in vitro competitive fluorescence polarization assay and tested for ability of one of
111
B
Ppfs1
Pplftiden
pepkde#3 ppWOm4
CL
Homo sapiens
... 4
..
Mus musculus
Bos taurus
Gallus gallus
Xenopus laevis
...
..T
Danio rerio
... T
...N
Fundulus heteroclitus ...LP$ND ...C
Zea mays
.S...TATD... L
'H...C W ...
L
E...DVS ...
I
H ...
D GN ...I
C
E ... DSKVISN... A
...
ISSL PO...T
Arabidopsis thaliana ...1 SPLL P...T
Nicotiana benthamiana ...I APLP..I
Nctb0p hkeeoens.AASA
...Q
Ostreococcus tauri ...VCASSD...H
11 ...
HKT I TM ...1
Vl ...
HKTVTM ...A
IN...
I SRETO ..A
IV...
YKT STL ...
k
V
CL
CL
-CI
Figure 2. Putative BH3 domain in the Small Pocket of pRB. (A) Schematic showing four
putative BH3 domains in the small pocket of pRB based on the consensus sequence LxxxxD
and conservation across species. (B) Analysis of the crystal structure of the unliganded pRB
pocket reveals that all four putative BH3 domains, in red, are exposed. Only peptide #2
forms an alpha helix.
112
the peptides to displace a fluorescently labeled BIM B13 peptide from the hydrophobic pocket
of several recombinant anti-apoptotic Bcl2 family members. Peptides #1-3 did not interact with
any of the Bcl2 family members tested (Fig. 3A). Remarkably, peptide #4 was able to interact
with, and specifically displace a BIM BH3 peptide from, all five anti-apoptotic Bcl2 family
members in vitro (Fig. 3A). The efficiency of this ability ranged depending on the Bcl2 family
member tested, with binding to MclI being the strongest and comparable to that of the BH3
peptide from PUMA, a physiological trigger of MOMP. Importantly, a mutant PUMA peptide
(PUMA2A, L and D residues of LxxxxD replaced with alanines) did not show this activity,
arguing for the specificity of this assay.
Next, we investigated the ability of peptide #4 to permeabilize mitochondria. We tested
both wild-type (AML2 and MOLM 13) and BAX/BAK mutant cells (DHL 10) and assayed for
depolarization of mitochondria using the nembrane-perneable JC-1 dye. Remarkably, peptide
#4 was able to permeabilize mitochondria of AML2 and MOLM 13, but not DH-L10 cells in a
dose-dependent manner (up to 50uM) (Fig. 3B). This activity was above the threshold
permeabilization triggered by the negative control PUMA2A, though not as efficient as the
depolarization induced by the BI13 peptides from BIM and PUMA, physiological triggers of
MOMP. We note that at higher concentrations, peptide #4 also permeabilizes mitochondria in a
BAX, BAK-independent manner (data not shown). Moreover, peptide #1 induces
hyperpolarization of mitochondria even at very low concentrations, though the physiological
relevance of this finding remains to be elucidated. Regardless, our in vitro assays suggest that
pRB peptide#4 may contain a BH3 domain.
113
k2D,
.. pFspepfet#
44
.ppepft#4
40-
--
RM-*A2A
PRR
so
* AML2
* MOLM13
* DHLIO
III
IIII
Ii.
II
-1OW
BC12
io.
-
III
4
log nM peptl
-.
04
40-
0
col
2D,
a.
U.
li i
I9
-i
log nuMMld
50.
0.
i
0
CL
Z CL
M
:.
Name
consensus
wildtype pRB
RB2A
S567L
S567LE
C
BdMXL
IN
404W
4W
.10
log nM pfte
sequence
Lxx xx DE
LAWLSDSP
AAWLSASP
LAWLSDLP
LAWLSDEP
M1
"414
TNFa/CHX
i
40
AN
o basal
Sinducea
.1
P<4e-4
P<5-
log ftm Pepti
,
p<5e-5
5@.m
120
.1091.
49
4
4
7
log im peptide
4
.4
0
wtRB
RB2A
SS67L
S567E
Figure 3. pRB does not appear to contain a BH3 domain. (A) Competitive fluorescence
polarization assay using peptides containing one of the four putative pRB BH3 domains.
Peptide #4 displaces the BIM BH3 peptide from all five recombinant anti-apoptotic Bcl2
family members tested. PUMA BH3 peptide serves as a positive control, mutant PUMA
BH3 peptide (PUMA2A) as a negative control. (B) Cells wildtype (AML2, MOLM13) or
mutant (DHL 10) for BAX and BAK were incubated with peptides and permeabilization of
mitochondria was assessed over 3 hours (AUC). Data is normalized to treatment with
114
We wanted to test this BH3 domain in vivo. Further analysis of the sequence surrounding
this domain revealed that the residues immediately following the aspartic acid of the BH3
consensus sequence are serine and proline (Fig. 3C). It has been shown that p38 phosphorylates
this serine (Ser567) in response to genotoxic stress and that this event may play a role in
induction of apoptosis (Delston et al., 2011). As mentioned above, post-translational
modifications can affect the structure of the protein and it is therefore conceivable that Ser567
phosphorylation would result in the formation of an exposed alpha-helix. Moreover, many but
not all BH3 sequences contain a glutamic acid residue following the BH3 motif (LxxxxDE)
(Lomonosova and Chinnadurai, 2008). This is intriguing, since phosphorylation of serine would
mimic a glutamic acid residue and may therefore regulate formation of a more efficient BH3
domain to activate pRB's mitochondrial, pro-apoptotic function. Finally, mutation analysis of
retinoblastoma cases has previously identified a bilateral retinoblastoma case with a missense
mutation at residue 567 resulting in a serine to leucine substitution, suggesting that this residue
confers a tumor suppressive function to pRB (Yandell et al., 1989). We were intrigued by these
observations and wanted to both validate this B113 domain in vivo as well as investigate the role
of Ser567 phosphorylation in transcription-independent induction of apoptosis. We therefore
generated RAT16 variants that upon doxycycline withdrawal express wildtype pRB or one of
three mutant pRB forms (Fig. 3C). Specifically, we made a non-BH3 mutant in which the
leucine and aspartic acid of the putative BH3 domain were mutated to alanine (RB2A). In
addition, we generated two mutants in which Ser567 was substituted with leucine to recapitulate
DMSO (0%) and treatment with mitochondrial uncoupler FCCP (100%). 50uM of Peptide #4
permeabilizes mitochondria in a BAX/BAK-dependent manner. (C) Schematic of pRB
mutants generated in vivo. (D) RAT16 cells expressing wildtype or mutant pRB for 24 hours
were treated with TNFct and CHX. None of the mutations tested inactivated pRB's
mitochondrial, pro-apoptotic function. Graph bars represent average of three experiments
(±SD).
115
the naturally occurring mutation (S567L) or glutamic acid to mimic the phosphorylated serine
residue (S567E). RAT16 cells with basal or induced wildtype or mutant pRB expression were
treated with TNFa and CHX and levels of apoptosis were assessed by AnnexinV staining.
However, all three pRB mutants sensitized to TNFa treatment and to a similar extent as wildtype
pRB (Fig. 3D). Thus, we conclude that this specific sequence is not required for mitochondrial
pRB function. Considering the in vitro and in vivo data together, we suspect that pRB does not
contain a BH3 domain. We note that we cannot formally exclude that peptide #1-3 contain a
BH3 domain, since they may not be folded correctly in the in vitro assay, either because they are
not in the proper structural context of the full-length protein or because they have not been
modified correctly as a result of an activating event. Further analysis, either using hydrocarbonstapled peptides which have greater a-helicity in solution (Walensky et al., 2006) or in vivo by
mutation analysis, may be required to draw a more rigorous conclusion. However, these data
considered as a whole suggest that while pRB is a direct activator of BAX, it is not a Bl2 family
member. The domains within the small pocket of pRB involved in triggering MOMP as well as
the nature of regulation of this function therefore remain to be elucidated.
pRB also acts as a sensitizer of Bl2 to induce transcription-independent apoptosis.
We also wanted to investigate whether pRB can trigger MOMP via multiple mechanisms.
Our genetic data strongly argue that mitochondrial pRB function is dependent on BAX since
pRB promotes TNFQ-induced apoptosis in wildtype and Bak', but not Bax- and DKO MEFs.
Furthermore, we've shown in vitro and in vivo that pRB is a direct activator of BAX (Hilgendorf
et al., 2013). We next asked whether pRB can also act as a sensitizer to trigger BAX-dependent
MOMP. Sensitizers promote mitochondrial apoptosis by binding anti-apoptotic Bcl2 family
members and relieving inhibition of BAX/BAK and/or activator BH3-only proteins. This
116
A
input
IP: Flag
-
+
-
-
+
-
--
+
-
-
+
BcI2-FIag
BcIXL-Flag
RB
Flag
al +TNFaJMG132
B IP:
IgG
Bcl2
input 3%
+
+
+
TNFa/MG132
Bc12
RB
C IP:
Bcl2
+
-
input 0.5%
-
+
TNFa/MG132
RB
RB
D IP:
-
+
input 0.5%
- + TNFa/MG132
RB
-W
Bcl2
Figure 4. pRB interacts with BcI2. (A) Western blot assessing pRB binding to Flag-tagged
Bcl2 or BclXL transiently expressed in IMR90 cells treated with TNFa and MG132. pRB
co-immunoprecipitates with Flag-tagged Bl2. (B, C) Immunoprecipitation of Bcl2 from
IMR90 cells that were (B) treated with TNFa and MG 132 (C) or also left untreated. pRB
binds Bl2 only upon treated TNFa/MG 132 treatment (D) Immunoprecipitation of pRB
from untreated and TNFa/MG132-treated IMR90 cells. Bcl2 only binds pRB upon
TNFa/MG132 treatment.
117
approach was in part infonned by our in vitro competitive fluorescence polarization data (Fig.
3C), which showed some binding of a pRB peptide to anti-apoptotic Bcl2 proteins. We therefore
performed co-immunoprecipitation experiments in primary human fibroblasts (IMR90) treated
with TNFa and MG 132 and transiently overexpressing flag-tagged Bcl2 or BcIXL, two major
anti-apoptotic Bcl2 family members. Notably, we observed some pRB co-immunoprecipitating
with BcI2 (Fig. 4A). We also wanted to confirm this interaction with endogenous proteins. We
immunoprecipitated endogenous Bcl2 from TNFa/MG 132 treated IMR90 cells and assessed
endogenous pRB binding by western blotting. Importantly, pRB again co-immunoprecipitated
with Bcl2 (Fig. 4B). Remarkably, this interaction was only observed upon treatment with TNFa
and MG 132 (Fig. 4C). We also confirmed the endogenous interaction with the reciprocal coimmunoprecipitation experiment; Bcl2 co-immunoprecipitates with pRB in IMR90 cells and this
interaction is only observed upon treatment with TNFa and MG 132 (Fig. 4D). Given pRB's
localization at mitochondria even in the absence of treatment, these data argue that the regulation
of apoptosis induction by pRB at the mitochondria may occur at the level of Bcl2 interaction.
Other potential mitochondrial pRB functions.
We also wanted to address the possibility that mitochondrial pRB function extends
beyond BAX-dependent induction of MOMP. This question was spurred by an unexpected
observation we made during our in vitro analysis of pRB action at isolated mitochondria. We
have previously shown that recombinant pRB permeabilizes mitochondria and liposomes in a
BAX-dependent manner at concentrations of less than 500nM (Hilgendorf et al., 2013).
However, at higher concentrations, we observed that addition of recombinant pRB to isolated
mouse liver mitochondria also resulted in some cytochrome c release even in the absence of
monomeric BAX addition (Fig. 5A). We note that this permeabilization was less efficient than
118
A
Pellet
_
+
+
+
supernftant
+
-
+
4.
+
+
in
-
+
-
+
-
00
10
500
2OnMBax
45nM cf. Bid
nM pRB
cytochrome c
SirT3
B
0 100 250 500 1000 0 100 250 500 10OOnM pRB
+
+
+
+
+
-
-
-
-
C
BAX
1cyto
21
ww
c
C6
o
12C
10C
sC
4C
-- 10nMpRd3+WA
-0 -EAXcndy
2C
C6
0
o
TueMSe
Figure 5. Mitochondrial pRB function may extend beyond BAX-dependent induction of
MOMP. (A) Isolated mouse liver mitochondria were incubated with 0, 10, or 500nM
recombinant pRB in the absence or presence of monomeric BAX. Recombinant pRB
induces cytochrome c release efficiently and in a dose-dependent manner in the presence of
BAX and to a lesser extent in the absence of BAX. (B) Mouse liver mitochondria null for
BAX and BAK were incubated with 0-1 OOOnM pRB in the absence and presence of
monomeric BAX. While pRB induces cytochrome c release in a BAX-dependent manner at
low concentrations, 1000nM pRB permeabilizes mitochondria independently of BAX. (C)
Recombinant pRB was added to ANTS/DPX-loaded liposomes in the absence or presence of
BAX. pRB permeabilizes membranes in a BAX-independent manner at very high
concentrations.
119
in the presence of monomeric BAX and that isolated (untreated) mitochondria already contain
some Bl2 family members including BAK, which may substitute for BAX to mediate pRB's
ability to trigger MOMP. Therefore we repeated the assay using mitochondria from AlbcrePs;BaxI-;Bak~- mouse livers in the absence and presence of recombinant BAX (Walensky et
al., 2006). As shown previously, pRB triggers MOMP in an entirely BAX-dependent manner at
concentrations of up to 250nM. At 500nM, recombinant pRB promotes a small amount of
cytochrome c release even in the absence of BAX, though to a much smaller extent than in the
presence of BAX or with wildtype mitochondria (and therefore in the presence of BAK) (Fig.
5A, B). Finally, at a concentration of I [pM, recombinant pRB permeabilizes mitochondria
completely in a BAX/BAK-independent manner (Fig. 5B).
We sought to validate these data and performed an in vitro liposome release assay, in
which recombinant pRB and/or BAX were added to freshly prepared, ANTS/DPX-loaded
liposomes. We have previously shown that at concentrations of up to 250nM, pRB
permeabilizes liposomes in an entirely BAX-dependent manner. However, consistent with the
cytochrome c release data, we saw some BAX-independence with 500nM of recombinant pRB
and complete BAX-independence at a concentration of 1p.M (Fig. 5C). Thus, while pRB acts as
a direct activator of BAX at low concentrations, our in vitro data show that pRB is also capable
of permeabilizing membranes in a BAX/BAK-independent manner, albeit only at very high
concentrations. The significance of this result remains to be determined. We note that we only
see this BAX-independence in vitro and with high pRB concentrations. Thus, it is entirely
possible that this is an artifact of the in vitro assays used. Additionally, only a small fraction of
endogenous pRB localizes to mitochondria (Hilgendorf et al., 2013). Hence, we do not know
whether this pRB activity, only apparent at high concentrations in vitro, has any significance in a
120
physiological context. Nonetheless, these data raise the possibility that pRB function may
extend beyond BAX-dependent induction of MOMP.
Mitochondrial pRB function is regulated differently than pRB's anti-proliferative
function.
pRB is a pleiotropic protein that functions in both proliferation and apoptosis. Nuclear
pRB's ability to regulate cell cycle entry is regulated by CDK-phosphorylation. We note that
pRB's cell cycle function is inactivated in most if not all tumors, either by mutation of the RB-1
gene itself or, in approximately two thirds of human tumors, alterations in the upstream
regulatory pathway resulting in constitutive pRB phosphorylation. We have previously shown
that CDK-phosphorylated pRB localizes to mitochondria and can promote apoptosis in a
transcription-independent manner (Hilgendorf et al., 2013). However, it is not clear whether
CDK-phosphorylation is required for mitochondrial pRB function. We therefore sought to
investigate whether the mitochondrial function of a pRB mutant deficient for regulation by
CDK-phosphorylation is affected. We used a RAT 16 variant that upon doxycycline withdrawal
expresses a pRB mutant with substitutions in 7 CDK- phosphorylation sites in the Large Pocket
(PSM-RB) (Fig. 6A). Importantly, consistent with previous observations (Chew et al., 1998;
Knudsen et al., 1998; Knudsen and Wang, 1997; Sever-Chroneos et al., 2001), this pRB mutant
is constitutively active for pRB's anti-proliferative function (Fig. 6C). RAT16 cells with basal or
induced PSM-RB expression were treated with TNFa and MG132 and levels of apoptosis were
assessed by AnnexinV staining. Induced expression of PSM-RB sensitized to apoptosis induced
by TNFa treatment (Fig. 6B). This argues that CDK-phosphorylations involved in the regulation
of nuclear pRB's cell cycle function do not affect pRB's ability to promote TNFa-induced
apoptosis. We note that cells were treated with TNFa and MG132, not CHX, and that we can
121
A
B
PP
70
PSM-RB
60
wt pRB
I
pRB
50
0
actin
40,
E PSM-RB OFF
-
*30
0 PSM-RB ON
20
I
PS35
0 3
'925
.. 20
9
0TNFa
TNFu+MG132
~
p<A
4
10
5
Suntreated~t
MG132
p<3e-4
~
15p<4e-3
10
untreated
Owt pRB basal
*wt pRB induced
only
Nq
MG132
C 100%
75%
Ed
50%
MG2
1
EGI
25%
0% 4-
-RB
+RB
-PSM-RB
+PSM-RB
Figure 6. Mitochondrial pRB activity is regulated in a manner distinct from pRB's
nuclear cell cycle function. (A) Schematic of PSM-RB mutant. Large Pocket of pRB with
CDK-phosphorylation sites S780, S788, S795, S807, S811, T82 I, T826 mutated to alanines.
(B) Left: RAT16 cells with and without induced expression of phosphorylation site mutant
pRB (PSM-RB) for 24 hours were treated with TNFa and MG132 for 48 hours. Levels of
apoptosis were assessed by AnnexinV staining. Graph bars represent average of two
experiments (±SD). Induced expression of PSM-RB promotes TNFa -induced apoptosis.
Western blot showing induced PSM-RB expression in inset. Right: Levels of apoptosis with
and without induced expression of wildtype pRB. Graph bars represent average of three
experiments (±SD). (C) Cell cycle phasing of RAT 16 cells with and without induced
expression of wildtype or phosphorylation site mutant pRB. Induced expression of PSM-RB
results in an accumulation of cells in G1. Graph bars represent average of two experiments
(±SD).
122
therefore not exclude the possibility that PSM-RB solely promotes apoptosis in a transcriptiondependent manner. However, another study has previously shown that PSM-RB also promotes
TNFa/CHX-induced apoptosis (Masselli and Wang, 2006). We also note that we cannot exclude
the possibility that mitochondrial pRB function is regulated by one of the CDK-phosphorylation
sites not mutated in the PSM-RB mutant. However, our data clearly argue that in general pRB's
pro-apoptotic function is regulated in a manner that is distinct from the one regulating pRB's
anti-proliferative function.
123
Discussion
We have previously shown that in addition to its many nuclear roles, pRB can also act
directly at the mitochondria to activate BAX and trigger mitochondrial outer membrane
permeabilization. Here we have expanded these findings to show that ectopic pRB expression
promotes low levels of apoptosis within a few hours of induction even in the absence of an
apoptotic stimulus. This supports the hypothesis that mitochondrial pRB is a general modulator
of apoptosis in response to various apoptotic stimuli and acts to fine-tune the apoptotic threshold.
Moreover, we show that in addition to directly activating BAX, pRB can also bind to the antiapoptotic protein Bcl2. Thus, pRB can impinge on mitochondrial apoptosis as both an activator
and sensitizer-like protein. Importantly, we only observe the pRB:Bcl2 complex upon TNFa
treatment, reconciling the facts that endogenous pRB is always localized to mitochondria, but
only modulates the apoptotic effect upon treatment. However, the mechanism through which
apoptotic stimuli activate endogenous pRB to trigger MOMP remains to be fully elucidated. Our
data presented here have extended our understanding of how mitochondrial pRB function is
regulated. Specifically, we show that pRB's pro-apoptotic function is regulated independently of
pR3's anti-proliferative function, since both hyperphosphorylated pRB and phosphorylation-site
mutant pRB are capable of triggering MOMP. Moreover, we present data arguing that pRB is a
non-Bcl2 family activator of BAX. In particular, we show using both in vitro and in vivo assays
that the Small Pocket of pRB does not appear to contain a fanctional BH3 domain. Thus, we
have been able to eliminate some possible mechanisms of mitochondrial pRB regulation.
Finally, we have also addressed the possibility that mitochondrial pRB has roles beyond
activating BAX to trigger MOMP. Specifically, we show that recombinant pRB can also
permeabilize mitochondria independent of Bcl2 family members. We note, that the
124
physiological relevance and function of this observation remains to be elucidated. Taken
together, our observations further validate the existence of mitochondrial pRB and extend our
understanding of how mitochondrial pRB function is regulated to promote apoptosis directly.
As alluded to above, we have not yet identified the post-translational modifications
necessary to activate mitochondrial pRB. Indeed, we do not yet know if pRB activity is
regulated by posttranslational modifications. In fact, since BAX is cytoplasmic and sequestered
in untreated cells, it would not interact with mitochondrial pRB under normal (untreated)
conditions. Consistent with the hypothesis that mitochondrial pRB function is not actively
regulated, we show here that ectopic pRB expression promotes some apoptosis even in the
absence of treatment. Moreover, we have previously shown that recombinant (and thus likely
unmodified) pRB interacts with BAX in vitro. We note that BAX activation is a multistep
process that involves both translocation to the mitochondria and profound conformational
changes (Youle and Strasser, 2008). Moreover, one of the major physiologic activators of BAX,
tBID, is mitochondrial (though only upon treatment with an apoptotic stimulus) and requires
prior changes in BAX to occur in order to activate it (including exposure of the N-tenninal
region of BAX to reveal the tBID interaction site) (Ghibelli and Diederich, 2011). We envision
that, consistent with its mitochondrial localization, pRB may act in a later step in the BAX
activation pathway and therefore require prior steps of activation to occur first.
Whether there
is an additional layer of regulation of mitochondrial pRB function via post-translational
modifications is still unknown. However, here we have presented data arguing that we can
exclude the importance of 7 CDK-phosphorylation sites in this regulation. We note that pRB can
also be phosphorylated at other sites, including by kinases other than CDK-cyclins and in
response to genotoxic stress (Inoue et al., 2007). The role of these phosphorylation events in
125
regulating mitochondrial pRB function remains to be determined. Moreover, pRB is also subject
to other posttranslational modifications including acetylation and sumoylation (Chan et al., 2001;
Ledl et al., 2005; Markham et al., 2006). Thus, it remains unclear whether and how pRB
posttranslational modifications affect its mitochondrial, pro-apoptotic function.
As described above, we have shown here that mitochondrial pRB not only acts as an
activator of BAX, but also as a sensitizer of apoptosis by binding Bcl2. Intriguingly, pRB only
interacts with Bcl2 upon TNFa/MG132 treatment despite its localization to mitochondria even in
the absence of treatment. Thus, mitochondrial pRB activity may also be regulated at the level of
Bcl2 interaction. We do not yet know how the formation of this pRB:Bcl2 complex is regulated
and whether this involves a similar mechanism as that regulating pRB binding to BAX. We also
note that it is unclear whether this pRB:Bcl2 interaction even has physiological relevance, since
pRB does not promote transcription-independent apoptosis in BAX-null MEFs, which are wildtype for Bcl2. Thus, we suspect that pRB's mitochondrial apoptotic function is primarily
mediated by its ability to act as an activator of BAX. However, this function may be supported
by pRB's ability to act as a sensitizer and bind Bl2, perhaps as a consequence of availability
upon treatment, when Bcl2 no longer binds and inhibits BAX.
We have also been able to show that pRB is likely a non-Bcl2 family, direct activator of
mitochondrial apoptosis. This adds to a growing list of non-Bel2 family proteins that can
promote apoptosis via both nuclear and mitochondrial mechanisms, including the tumor
suppressor p53, the orphan nuclear steroid receptor Nur77, the nuclear protein histone H1i.2, and
the nucleolar phosphoprotein nucleophosmin (Chipuk et al., 2004; Chipuk et al., 2003; Dumont
et al., 2003; Gine et al., 2008; Kerr et al., 2007; Konishi et al., 2003; Li et al., 2000; Lin et al.,
2004; Mihara et al., 2003; Okamura et al., 2008). Further characterization of this new class of
126
pro-apoptotic proteins, including identifying the domains involved in mediating interactions with
Bcl2 family members, is necessary to understand how and when these proteins contribute to the
apoptotic response in vivo.
Taken together, we have presented data that extend our understanding of mitochondrial
pRB function and regulation. Further analysis is necessary to draw a more complete picture of
this pRB role. However, since pRB is a pleiotropic protein with both anti- and pro-tumorigenic
functions, we strongly believe that further investigation of a pRB function that is both rapid and
solely tumor-suppressive is very important and may inform novel therapeutic approaches.
127
Materials and Methods
Cell Culture and Drug Treatment
RAT16 and IMR90 cells were grown in MEM with Earle's Salts and 10% FBS, Pen-Strep, LGlutamine, Sodium Pyruvate, and NEAA. For TNFa treatments, 50ng/ml of recombinant mouse
TNFa (Sigma) was used with 0.1pgM MG132 (Calbiochem) for 48 hours or 0.5 pg/ml CHX
(Sigma). TET System approved FBS (Clontech) and I pg/ml doxycycline (Clontech) were used
for inducible cell lines.
FACS Apoptosis Analysis
Cell suspensions were stained with AnnexinV-FITC or APC (Becton Dickinson) and Propidium
Iodide (Sigma) or 7AAD (Becton Dickinson). Total apoptotic cells were assessed by gating for
AnnexinV positive using a FACScan or FACSCalibur System (Becton Dickinson). Similar
trends were observed for all experiments when only early apoptotic (AnnexinV+;PI/7AAD-)
cells were considered (data not shown). For cell cycle profiling, cell suspensions were processed
as previously described (Lanari et al., 2009) and analyzed by FACScan and FlowJo.
Plasmid and Stable Cell Line Generation
Rat16 tet-off wildtype pRB cells were generated as previously described (Hilgendorf et al.,
2013). pRB mutants were generated by site-directed mutagenesis (Agilent) of human pRB using
the following primers:
RB2A - gaatcatggaatcagctgcatggctctcagettcacctttatttg, caaataaaggtgaagctgagagccatgcagctgattccatgattc
RBS567L - gaatcatggaatcgctagcatggctctcagatttacctttatttg, caaataaaggtaaatctgagagccatgctagcgattccatgattc
RBS567E - gaatcatggaatcgctagcatggctctcagatgaacctttatttg, caaataaaggttcatctgagagccatgctagcgattccatgattc
128
Competitive Fluorescence Polarization Assay and BH3 profiling
Competitive FPA and mitochondrial depolarization assays were performed as previously
described (Brunelle and Letai, 2009; Letai et al., 2002). The following peptides were
synthesized with N-terminus acetylated, the C-terminus amidated, and HPLC purified (KI
Swanson Biotechnology Center, Biopolymers & Proteomics Facility):
Peptide #1: mntiqqlmmilnsasdqpse
Peptide #2: nctvnpkesilkrvkdigyi
Peptide #3: atysrstsqnldsgtdlsfp
Peptide #4: ercehrimeslawlsdsplf
Immunoprecipitation and Western Blotting
Proteins were extracted using an NP40 based buffer (50mM HEPES pH7.9, 10% glycerol,
150mM NaCl, 1%NP40, ImM NaF, 10mM B-Glycerophosphate, protease inhibitors) and
quantified using BCA Protein Assay reagent (Pierce). The following antibodies were used: Bl2
(Cell Signaling), normal rabbit IgG (Santa Cruz), RB (hybridoma supernatant XZ91, crosslinked
to Protein A Agarose).
Samples were loaded in SDS Lysis Buffer (8% SDS, 250mM TrisHCl pH 6.6, 40 % glycerol, 5%
2-Mercaptoethanol, bromophenol blue), separated by SDS-PAGE, transferred to a nitrocellulose
membrane, and blocked in 5% nonfat milk. The following antibodies were used in 2.5% nonfat
milk: RB for human pRB (Cell Signaling, 9309), procaspase 7 (Cell Signaling, 9492), cleaved
caspase 7 (Cell Signaling, 9491), procaspase 3 (Cell Signaling, 9662), cleaved caspase 3 (Cell
Signaling, 9661), actin (Santa Cruz, SC1616 HRP), Lamin A/C (Cell Signaling, 2032), ATPB
(Abcam, ab5432), SirT3 (Cell Signaling, 5490), cytochrome c (Becton Dickinson, 556433), Bcl2
129
(Cell Signaling, 2870), Flag (Sigma, Fl 804). Secondary HRP-conjugated antibodies (Santa
Cruz) were used at 1:5000 in 1% nonfat milk.
Cytochrome c release and liposome permeabilization assay
Mitochondrial isolation and in vitro cytochrome c and liposome release assays were performed
as previously described (Hilgendorf et al., 2013).
Acknowledgments
We thank E. Knudsen for providing the RAT16 wildtype pRB and PSM-RB inducible cell lines
and members of the Lees laboratory for input during the study and manuscript preparation. This
work was supported by an NCI/NIH grant to J.A.L. who is a Ludwig Scholar at MIT. K.I.H. was
supported by an NSF pre-doctoral fellowship and D.H. Koch Graduate Fellowship.
130
References
Balog, E.R., Burke, J.R., Hura, G.L., and Rubin, S.M. (2011). Crystal structure of the unliganded
retinoblastoma protein pocket domain. Proteins 79, 2010-2014.
Brunelle, J., and Letai, A. (2009). Control of mitochondrial apoptosis by the Bcl-2 family.
Journal of cell science 122, 437-478.
Burke, J.R., Hura, G.L., and Rubin, S.M. (2012). Structures of inactive retinoblastoma protein
reveal multiple mechanisms for cell cycle control. Genes Dev 26, 1156-1166.
Burkhart, D.L., and Sage, J. (2008). Cellular mechanisms of tumour suppression by the
retinoblastoma gene. Nat Rev Cancer 8, 671-682.
Carnevale, J., Palander, 0., Seifried, L.A., and Dick, F.A. (2012). DNA damage signals through
differentially modified E2F1 molecules to induce apoptosis. Mol Cell Biol 32, 900-912.
Chan, H.M., Krstic-Demonacos, M., Smith, L., Demonacos, C., and La Thangue, N.B. (2001).
Acetylation control of the retinoblastoma tumour-suppressor protein. Nat Cell Biol 3, 667-674.
Chew, Y.P., Ellis, M., Wilkie, S., and Mittnacht, S. (1998). pRB phosphorylation mutants reveal
role of pRB in regulating S phase completion by a mechanism independent of E2F. Oncogene
17, 2177-2186.
Chipuk, J., Moldoveanu, T., Llambi, F., Parsons, M., and Green, D. (2010). The BCL-2 family
reunion. Molecular cell 37, 299-609.
Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D., Schuler, M., and
Green, D.R. (2004). Direct activation of Bax by p53 mediates mitochondrial membrane
penneabilization and apoptosis. Science 303, 1010-1014.
Chipuk, J.E., Maurer, U., Green, D.R., and Schuler, M. (2003). Pharmacologic activation of p53
elicits Bax-dependent apoptosis in the absence of transcription. Cancer Cell 4, 371-38 1.
Delston, R.B., Matatall, K.A., Sun, Y., Onken, M.D., and Harbour, J.W. (2011). p3 8
phosphorylates Rb on Ser567 by a novel, cell cycle-independent mechanism that triggers RbHldm2 interaction and apoptosis. Oncogene 30, 588-599.
131
Dumont, P., Leu, J.I., Della Pietra, A.C., 3rd, George, D.L., and Murphy, M. (2003). The codon
72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33, 357365.
Ghibelli, L., and Diederich, M. (2011). Multistep and multitask Bax activation. Mitochondrion
10, 604-613.
Gine, E., Crespo, M., Muntanola, A., Calpe, E., Baptista, M.J., Villamor, N., Montserrat, E., and
Bosch, F. (2008). Induction of histone H1.2 cytosolic release in chronic lymphocytic leukemia
cells after genotoxic and non-genotoxic treatment. Haematologica 93, 75-82.
Gordon, G., and Du, W. (2011). Conserved RB functions in development and tumor suppression.
Protein & cell 2, 864-942.
Hilgendorf, K.I., Leshchiner, E.S., Nedelcu, S., Maynard, M.A., Calo, E., Ianari, A., Walensky,
L.D., and Lees, J.A. (2013). The retinoblastoma protein induces apoptosis directly at the
mitochondria. Genes Dev 27, 1003-1015.
lanari, A., Natale, T., Calo, E., Ferretti, E., Alesse, E., Screpanti, I., Haigis, K., Gulino, A., and
Lees, J.A. (2009). Proapoptotic ftmction of the retinoblastoma tumor suppressor protein. Cancer
Cell 15, 184-194.
Inoue, Y., Kitagawa, M., and Taya, Y. (2007). Phosphorylation of pRB at Ser612 by Chk1/2
leads to a complex between pRB and E2F-1 after DNA damage. EMBO J 26, 2083-2093.
Kerr, L.E., Birse-Archbold, J.L., Short, D.M., McGregor, A.L., Heron, I., Macdonald, D.C.,
Thompson, J., Carlson, G.J., Kelly, J.S., McCulloch, J., et al. (2007). Nucleophosmin is a novel
Bax chaperone that regulates apoptotic cell death. Oncogene 26, 2554-2562.
Knudsen, E.S., Buckmaster, C., Chen, T.T., Feramisco, J.R., and Wang, J.Y. (1998). Inhibition
of DNA synthesis by RB: effects on GUS transition and S-phase progression. Genes Dev 12,
2278-2292.
Knudsen, E.S., and Wang, J.Y. (1997). Dual mechanisms for the inhibition of E2F binding to RB
by cyclin-dependent kinase-mediated RB phosphorylation. Mol Cell Biol 17, 5771-5783.
Konishi, A., Shimizu, S., Hirota, J., Takao, T., Fan, Y., Matsuoka, Y., Zhang, L., Yoneda, Y.,
Fujii, Y., Skoultchi, A.I., et al. (2003). Involvement of histone H1I.2 in apoptosis induced by
DNA double-strand breaks. Cell 114, 673-688.
132
Korah, J., Falah, N., Lacerte, A., and Lebrun, J.J. (2012). A transcriptionally active pRb-E2F1P/CAF signaling pathway is central to TGFbeta-mediated apoptosis. Cell Death Dis 3, e407.
Ledl, A., Schmidt, D., and Muller, S. (2005). Viral oncoproteins EtA and E7 and cellular LxCxE
proteins repress SUMO modification of the retinoblastoma tumor suppressor. Oncogene 24,
3810-3818.
Letai, A., Bassik, M.C., Walensky, L.D., Sorcinelli, M.D., Weiler, S., and Korsmeyer, S.J.
(2002). Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serving as
prototype cancer therapeutics. Cancer Cell 2, 183-192.
Li, H., Kolluri, S.K., Gu, J., Dawson, M.I., Cao, X., Hobbs, P.D., Lin, B., Chen, G., Lu, J., Lin,
F., et al. (2000). Cytochrome c release and apoptosis induced by mitochondrial targeting of
nuclear orphan receptor TR3. Science 289, 1159-1164.
Lin, B., Kolluri, S.K., Lin, F., Liu, W., Han, Y.H., Cao, X., Dawson, M.I., Reed, J.C., and
Zhang, X.K. (2004). Conversion of Bcl-2 from protector to killer by interaction with nuclear
orphan receptor Nur77/TR3. Cell 116, 527-540.
Lindsten, T., Ross, A.J., King, A., Zong, W.X., Rathmell, J.C., Shiels, H.A., Ulrich, E.,
Waymire, K.G., Mahar, P., Frauwirth, K., et al. (2000). The combined functions of proapoptotic
Bcl-2 family members bak and bax are essential for normal development of multiple tissues. Mol
Cell 6, 1389-1399.
Lomonosova, E., and Chinnadurai, G. (2008). BH3-only proteins in apoptosis and beyond: an
overview. Oncogene 27 Suppl 1, S2-19.
Markham, D., Munro, S., Soloway, J., O'Connor, D.P., and La Thangue, N.B. (2006). DNAdamage-responsive acetylation of pRb regulates binding to E2F-1. EMBO Rep 7, 192-198.
Masselli, A., and Wang, J.Y. (2006). Phosphorylation site mutated RB exerts contrasting effects
on apoptotic response to different stimuli. Oncogene 25, 1290-1298.
Mihara, M., Erster, S., Zaika, A., Petrenko, 0., Chittenden, T., Pancoska, P., and Moll, U.M.
(2003). p53 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.
Okamura, H., Yoshida, K., Amorim, B.R., and Haneji, T. (2008). Histone H1.2 is translocated to
mitochondria and associates with Bak in bleomycin-induced apoptotic cells. J Cell Biochem 103,
1488-1496.
133
Rubin, S.M. (2012). Deciphering the retinoblastoma protein phosphorylation code. Trends
Biochem Sci 38, 12-19.
Sever-Chroneos, Z., Angus, S.P., Fribourg, A.F., Wan, H., Todorov, I., Knudsen, K.E., and
Knudsen, E.S. (2001). Retinoblastoma tumor suppressor protein signals through inhibition of
cyclin-dependent kinase 2 activity to disrupt PCNA function in S phase. Mol Cell Biol 21, 40324045.
van den Heuvel, S., and Dyson, N.J. (2008). Conserved functions of the pRB and E2F families.
Nat Rev Mol Cell Biol 9, 713-724.
Walensky, L.D., Pitter, K., Morash, J., Oh, K.J., Barbuto, S., Fisher, J., Smith, E., Verdine, G.L.,
and Korsmeyer, S.J. (2006). A stapled BID BH3 helix directly binds and activates BAX. Mol
Cell 24, 199-2 10.
Wei, M.C., Zong, W.X., Cheng, E.H., Lindsten, T., Panoutsakopoulou, V., Ross, A.J., Roth,
K.A., MacGregor, G.R., Thompson, C.B., and Korsmeyer, S.J. (2001). Proapoptotic BAX and
BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292, 727-730.
Wyllie, A. (2010). "Where, 0 death, is thy sting?" A brief review of apoptosis biology.
Molecular neurobiology 42, 4-13.
Yandell, D.W., Campbell, T.A., Dayton, S.H., Petersen, R., Walton, D., Little, J.B., McConkieRosell, A., Buckley, E.G., and Dryja, T.P. (1989). Oncogenic point mutations in the human
retinoblastoma gene: their application to genetic counseling. N Engl J Med 321, 1689-1695.
Youle, R.J., and Strasser, A. (2008). The BCL-2 protein family: opposing activities that mediate
cell death. Nat Rev Mol Cell Biol 9, 47-59.
134
ChapterFour
Discussion
135
Initial studies of the retinoblastoma protein tumor suppressor focused on elucidating its
role in regulating entry into the cell cycle. Subsequently, it became apparent that pRB also
functions in many other cellular processes including senescence, differentiation, and apoptosis.
These early studies showed that loss of pRB resulted in increased levels of apoptosis, which led
to the characterization of pRB as an anti-apoptotic protein (Almasan et al., 1995; Bosco et al.,
2004; Jacks et al., 1992; Knudsen et al., 2000). It was subsequently shown that pRB can also act
in a pro-apoptotic manner by functioning as a transcriptional co-activator of pro-apoptotic genes
in response to apoptotic stimuli such as DNA damage (Carnevale et al., 2012; lanari et al., 2009;
Korah et al., 2012). The work described in this thesis derived from our efforts to characterize
and expand our understanding of this pro-apoptotic role of pRB (Appendix A). Initially, we
wanted to know if pRB's transcriptional, pro-apoptotic function also extended to apoptotic
stimuli other than genotoxic stress, including death ligand binding. Thus, we investigated the
role of pRB in TNFa-induced apoptosis. Our analysis not only revealed that pRB can promote
TNFa-induced apoptosis, but also uncovered a novel, non-nuclear and non-transcriptional
function of pRB (Chapter 2). Specifically, we showed that pRB can directly bind to and activate
BAX at the mitochondria, resulting in mitochondrial outer membrane permeabilization and
induction of apoptosis. Moreover, by specifically targeting pRB to the mitochondria, we
generated a separation of function mutant that is deficient for nuclear pRB functions, but capable
of promoting transcription-independent apoptosis. Remarkably, this pRB mutant promotes
apoptosis in vivo and is tumor suppressive. Thus, mitochondrial pRB function can contribute to
pRB's overall role as a tumor suppressor.
Given the novelty and potential importance of this pRB activity, we are very interested in
further understanding how mitochondrial pRB is regulated and the specific context and extent to
136
which mitochondrial pRB contributes to tumor suppression. Importantly, we have initiated this
analysis. Thus, we have shown that mitochondrial pRB localization and activity is regulated in a
manner that is distinct from that of pRB's anti-proliferative function, since phosphorylated pRB
can localize to mitochondria and promote apoptosis (Chapter 2) and a phosphorylation-site
mutant pRB is capable of doing the same (Chapter 3). This is significant, because the
retinoblastoma protein gene is mutated in about one-third of human tumors, but pRB is
constitutively phosphorylated and thus inactive for its cell cycle function in most, if not all,
remaining human tumors. Thus, mitochondrial pRB function appears to be unaffected in the
majority of human tumors and can potentially be exploited for therapeutic purposes. We have
also mapped this pRB function to the small pocket domain, known to be important for pRB's
tumor suppressive function (Chapter 2). We anticipate that the BAX interaction site is therefore
localized in this part of the protein. However, our explorative analyses of putative BH3 domains
have not yielded any positive results, suggesting that pRB is a non-Bcl2 activator of BAX
(Chapter 3).
Thus, we have uncovered a novel role of pRB in promoting apoptosis, but are only just
beginning to understand how this mitochondrial pRB function fits into the overall picture of pRB
tumor suppression and apoptosis. Our findings have lead to many more intriguing questions,
including how the localization of pRB to mitochondria is regulated, how the activity of
mitochondrial pRB is regulated, and what the extent is to which mitochondrial pRB contributes
toward tumor suppression. I will outline potential experimental approaches below and would
like to point out that several of these experiments will address multiple questions and that the
results obtained will inform future approaches. First however, I will start by discussing the
remarkable parallels between the tumor suppressor proteins pRB and p53. Importantly, our
137
findings and a comparison to mitochondrial p53 function may inform possible future directions
for both fields of study. Moreover, the existence of this non-canonical mechanism of action for
both of these major tumor suppressor proteins supports the notion that direct induction of
apoptosis is an important tumor suppressive mechanism.
Part I:
Parallels between pRB and p53
p53 is a key tumor suppressor and considered to be the "guardian of the genome" (Lane,
1992). It is mutated in the majority of human tumors and functions to protect the cell from
insults by inducing cell cycle arrest or promoting apoptosis. Thus, p53 and pRB both play an
integral role in deciding the cellular fate of the cell, though the mechanism underlying the
decision to arrest versus undergo apoptosis is still poorly understood. The two tumor
suppressors also differ in that pRB is a transcriptional co-factor, while p53 contains a DNAbinding motif. Moreover, while both pRB and p53 are regulated by post-translational
modifications, pRB is stable in normal, untreated cells and p53 is only stabilized in response to
cellular stresses.
It was shown many years ago that in addition to transcriptionally activating pro-apoptotic
genes (e.g. PUMA) in response to DNA damage (Yu and Zhang, 2003), p5 3 can also promote
apoptosis in the absence of translation (Caelles et al., 1994; Haupt et al., 1995). Furthermore, a
fraction of p53 translocates to mitochondria in response to cellular stress (Marchenko et al.,
2000; Sansome et al., 2001). Finally, a series of papers showed that p53 can act directly at the
mitochondria to induce MOMP (Chipuk et al., 2004; Dumont et al., 2003; Mihara et al., 2003).
However, the exact mechanism of mitochondrial p53 action is still unclear and findings are
138
partly contradictory. For instance, both the DNA-binding domain and the proline-rich domain
were shown to be important for mitochondrial p53 function, and the data is contradictory as to
whether these domains affect mitochondrial localization or interaction with Bcl2 family
members (Chipuk et al., 2004; Dumont et al., 2003; Leu et al., 2004b; Marchenko et al., 2000;
Mihara et al., 2003; Petros et al., 2004; Sot et al., 2007; Tomita et al., 2006). Furthermore, p53
can sometimes act in a BAX-dependent and other times in a BAK-dependent manner, both in
vitro and in vivo (Chipuk et al., 2004; Leu et al., 2004a; Milhara et al., 2003). Finally, p53 has
been shown to interact directly with BAX, BAK, Bcl2, BcIXL, and BAD and it is unclear which
of these interactions has the greatest physiological importance (Chipuk et al., 2004; Jiang et al.,
2006; Leu et al., 2004a; Mihara et al., 2003). It is also not known what regulates p53
localization to mitochondria and interaction with Bcl2 family proteins, though some studies have
implicated mono-ubiquitination, acetylation, and phosphorylation as being important (Geyer et
al., 2000; Kawaguchi et al., 2006; Park et al., 2005; Sykes et al., 2009). Thus, there are still
many remaining questions regarding the mechanism of action of mitochondrial p53.
Regardless, the parallels between p53 and pRB, both in terms of nuclear roles and
mitochondrial function are remarkable. Moreover, generation of separation of function mutants
of p53 and pRB that only promote transcription-independent apoptosis has revealed that direct
induction of apoptosis is an efficient mechanism of tumor suppression (Erster et al., 2004;
Hilgendorf et al., 2013; Palacios et al., 2008; Palacios and Moll, 2006; Talos et al., 2005).
Finally, small molecule screens have identified compounds that either inhibit or potentiate
mitochondrial p53 function. For instance, a small molecule screen to identify compounds that
specifically inhibit p53-mediated apoptosis, but not arrest, identified the small molecule
pifithrin-R (Hilgendorf et al., 2013; Strom et al., 2006). Further analysis revealed that pifithrin-p
139
does not affect p53's transactivation function, but instead inhibits p53-mediated apoptosis by
specifically affecting mitochondrial association of p53 and reducing p53 binding to Bcl2 and
BclXL (Strom et al., 2006). Remarkably, there was no effect on cytoplasmic p53 protein levels
(Strom et al., 2006). Another small molecule screen identified CP-31398 as an activator of p53
activity (Foster et al., 1999). Subsequent analysis revealed that this compound blocked UVBinduced skin carcinoma both by increasing p53 transactivation function as well as by increasing
p53 mitochondrial localization and function (Tang et al., 2007). Thus, mitochondrial pRB and
p53 function may be exploited for cancer therapeutics.
Taken together, mitochondrial pRB function is reminiscent of that of mitochondrial p53
function. The mechanism of action of both of these functions, including the domains involved
and regulation of localization and activity, remains to be fully elucidated. However most
importantly, this mitochondrial function has been shown to be tumor suppressive in vivo, and
further characterization of these two functions may therefore inform novel therapeutic
approaches.
Part II:
A:
Characterization of mitochondrial pRB function
How is mitochondrial localization of pRB regulated?
We have shown that a fraction of pRB localizes to mitochondria both in the absence and
presence of treatment with an apoptotic stimulus. We do not yet know if this mitochondrial pRB
in normal, untreated cells differs from nuclear pRB in terms of post-translational modifications.
Moreover, we do not know if localization of pRB to mitochondria is an active process and
therefore regulated by post-translational modifications or rather a consequence of interaction
140
with mitochondrial proteins. Importantly, addressing these questions would not only expand our
understanding of pRB biology, but may also uncover novel mechanisms of pRB functional
inactivation in tumors.
It would be interesting to investigate whether any posttranslational modifications are
enriched in the mitochondrial pRB population and may therefore function in targeting pRB to
mitochondria. This question can be addressed by immunoprecipitating pRB from mitochondrial
fractions and analyzing it by mass spectrometry. I anticipate that mouse liver mitochondria
would be a good source of pRB for this analysis, since we can isolate milligram amounts of
mitochondria from just one adult mouse liver. While this approach may help identify
modifications present on mitochondrial pRB, any importance in regulating localization (or
perhaps activity) would need to be evaluated using both in vivo and in vitro assays.
pRB localization to mitochondria may also be mediated by interaction with mitochondrial
proteins. This question can be addressed using two parallel approaches. We have already shown
that pRB can interact with BAX (Chapter 2) and Bcl2 (Chapter 3) upon treatment with an
apoptotic stimulus. However, we do not know if pRB also binds Bl2 family proteins in the
absence of treatment and whether these interactions tether pRB to the mitochondria. We can
address this hypothesis by analyzing the amount of mitochondrial pRB protein in cells that are
deficient for various Bcl2 family members. We note, however, that there may be several
mitochondrial pRB interactors and that they may compensate for each other. Therefore, we can
also screen for mitochondrial pRB interactors by mass spectrometry. We would subsequently
validate their importance in regulating mitochondrial pRB localization in vivo.
Finally, mitochondrial pRB localization could be regulated at the level of nuclear export.
While pRB is primarily nuclear, it has long been known that a fraction of pRB localizes to the
141
cytoplasm and that the phosphorylation status of pRB correlates with nucleo-cytoplasmic
localization. However, while this existence of cytoplasmic pRB was previously thought to be a
consequence of loss of nuclear tethering of hyperphosphorylated pRB (Mittnacht and Weinberg,
1991; Templeton, 1992), a series of recent papers have shown that nuclear export of pRB is
actively regulated and that hyperphosphorylated pRB directly interacts with Exportin 1 (Fulcher
et al., 2010; Jiao et al., 2006; Jiao et al., 2008; Roth et al., 2009). It is, however, unclear whether
the amount of cytoplasmic pRB correlates with the amount of mitochondrial pRB. Specifically,
it would be interesting to investigate how the relative amounts of nuclear, cytoplasmic, and
mitochondrial pRB change as the cell proceeds through the cell cycle as well as in response to
tumorigenic events that result in constitutive hyperphosphorylation of pRB. Alternatively, we
can also investigate the mitochondrial activity of constitutively hyperphosphorylated pRB. We
have already shown that hyperphosphorylated pRB can promote transcription-independent
apoptosis (Chapter 2). Further investigation is necessary to determine if, perhaps as a result of
increased mitochondrial localization, phospho-pRB promotes more apoptosis when compared to
equal cellular amounts of non-phosphorylated pRB.
B:
How is mitochondrial pRB activity regulated?
Another important question that emerges from our studies is how mitochondrial pRB
activity is regulated, in particular given that pRB is always localized to mitochondria and the
amount of pRB is unchanged with apoptotic treatment. In other words, if pRB binding to BAX
(and Bcl2) directly causes MOMP, then how is this interaction regulated so that pRB only binds
BAX (and Bcl2) upon treatment. As discussed above (Chapter 3), we do not yet know if
formation of these complexes is simply a function of Bcl2 family protein availability upon
142
treatment, or whether there is an active process of regulation and mitochondrial pRB is posttranslationally modified upon treatment.
Given that nuclear pRB function is regulated by post-translational modifications, the
latter hypothesis warrants further investigation. We have already shown that mitochondrial pRB
activity is not regulated by any of at least 7 CDK-phosphorylation sites. However, it has
previously been shown that pRB is both phosphorylated and acetylated in response to genotoxic
stress (Chan et al., 2001; Inoue et al., 2007; Markham et al., 2006). We are interested in testing
whether mutation of these residues (non-modifiable and mimetic) affects mitochondrial pRB
function both in vitro and in vivo. As a parallel approach, we can also screen for changes in pRB
post-translational modifications in response to treatment by mass spectrometry.
Regardless of the importance of post-translational modifications in regulating
mitochondrial pRB activity, it is essential to better understand the nature of the pRB:BAX
interaction. We have shown using both genetic and biochemical approaches (Chapter 2) that
mitochondrial pRB function is dependent on BAX. I anticipate that the BAX interaction site is
localized in the Small Pocket of pRB, since it is sufficient for mitochondrial function. Moreover,
since pRB is specifically dependent on BAX, not BAK, the pRB binding site on BAX is either
masked in BAK or unique to BAX. Intriguingly, an activation site that is unique to BAX was
recently identified at the N-tenninal side of the protein and therefore distinct from the C-terminal
canonical BH3-binding site (Gavathiotis et al., 2010; Gavathiotis et al., 2008). Moreover, this
site was shown to be important for a BIM BH3 domain peptide to trigger BAX to adopt its active
conformation (Gavathiotis et al., 2010; Gavathiotis et al., 2008).
We have been unable to identify specific sequences on pRB, including BH3 consensus
sequences, that mediate this pRB:BAX interaction (Chapter 3). We can potentially identify the
143
pRB:BAX binding domains using two approaches. Specifically, we can take advantage of the
fact that pRB shares a high degree of homology with the pocket proteins p107 and p130 in the A
and B folds of the pocket domain. We do not yet know if pRB is the only pocket protein capable
of promoting apoptosis directly at the mitochondria. However, our preliminary study using
shRNAs against individual pocket proteins in human primary fibroblasts suggests that this
mitochondrial function is unique to pRB (Appendix A). Further analysis, including
overexpression, mitochondrial targeting, and in vitro analysis, will help us confirm whether this
mitochondrial function is specific to pRB. We can subsequently conduct domain-swapping
experiments and generate chimeric proteins to determine the region of pRB necessary for
mitochondrial function and/or sufficient to impart this function to other pocket proteins. As a
parallel approach, we can also identify the pRB:BAX interaction domain by cross-linking the
complex and performing mass spectrometry. This approach would potentially identify the
interaction domains in both pRB and BAX. This interaction would subsequently have to be
validated by mutational analysis.
I would like to note that both approaches would generate a non-BAX binding mutant of
pRB and that this pRB mutant would be very valuable in assessing the extent to which
mitochondrial pRB contributes to induction of apoptosis and the specific contexts in which this
mitochondrial function is most important for tumor suppression. Thus, our investigation of how
mitochondrial pRB activity is regulated would also contribute to our understanding of the
physiological importance of mitochondrial pRB function. I will discuss the approaches used to
address this question in more detail below.
Finally, characterization of the pRB:BAX interaction domain would not only increase our
understanding of mitochondrial pRB function, but it may also contribute to other field of studies.
144
For instance, it may allow us to identify a novel interaction domain used by non-Bcl2 family
protein capable of promoting apoptosis both via a nuclear mechanism and directly at the
mitochondria. It would be very interesting to compare and contrast this domain to Bcl2
homology domains.
C:
Conclusion
We have previously shown that pRB is localized to mitochondria and can bind to and
activate BAX directly upon treatment with apoptotic stimuli. However, we do not know how
mitochondrial pRB localization and function is regulated to induce MOMP only upon treatment
with an apoptotic stimulus. Importantly, we have initiated a number of experiments to address
these follow-up questions. These studies will not only further our understanding of pRB biology,
but also generate tools to investigate the relative importance of this mitochondrial pRB function
compared to other pRB functions in a physiological context. I will elaborate on this below.
Part III:
Contribution of mitochondrial pRB function to tumor
suppression
We have identified a novel, non-nuclear and non-canonical role of pRB. We next need to
determine if this activity has physiological importance. Importantly, we already know that
mitochondrial pRB can function in physiological settings. In particular, we have shown that
pRB promotes TNFa-induced apoptosis not only using overexpression studies, but also by
knockdown studies in two different cell lines, including a primary human fibroblast cell line
(Chapter 2). Furthermore, our localization studies showed mitochondrial association of the
145
endogenous pRB protein both in cell lines and in normal mouse tissue (Chapter 2). Finally, we
have shown in vivo (using endogenous proteins) that pRB can interact with BAX and Bcl2
(Chapter 2, 3). Further investigation will identify the specific contexts in which mitochondrial
pRB function is most important and I will discuss potential approaches below.
A:
Contribution of mitochondrial pRB function to development and tumor suppression
pRB is a pleiotropic protein that functions in both development and tumor suppression by
impinging on several cellular processes. However, the relative contribution of these many
cellular functions to pRB's overall role in development and tumor suppression is still unclear.
This is partly due to the fact that most pRB functions map to the Small Pocket domain and it is
therefore difficult to generate pRB mutants either deficient for only one function or capable of
performing only one function.
A number of pRB knock-in mouse models have been generated. In particular, a pRB
mutant (R654W) has been generated to model a naturally occurring human tumor mutation
(R661W) known to cause partially penetrant retinoblastoma. Expression of this R654W mutant
in mice has profound effects on both development (Sun et al., 2006) and tumor suppression (Sun
et al., 2011). Since this mouse model recapitulates a naturally-occurring mutation, this is not
unexpected. However, while this pRB mutant is impaired for E2F binding, it is unclear what
other pRB functions are affected, complicating the analysis of the relative contributions of pRB
functions to development and tumor suppression. Similarly, another knock-in mouse has also
been generated in which the caspase cleavage site on pRB was mutated (Chau et al., 2002). This
non-cleavable pRB knock-in mouse model has a subtle phenotype, showing a decreased
apoptotic response to endotoxic stress in the intestine, but no effect in other tissues, in response
to other stresses, and no general developmental or tumor suppression defects (Chau et al., 2002).
146
Since it is unclear what pRB functions are affected by caspase cleavage, this study also does not
further our understanding of the relative contribution of pRB functions to development and
tumor suppression. Finally, an LxCxE binding cleft deficient pRB mutant mouse has been
generated (Francis et al., 2009; Talluri et al., 2010). Again, this mutation affects many pRB
functions, since the LxCxE binding cleft mediates interaction with many proteins, including
chromatin-remodeling factors such as HDAC 1. This knock-in mouse model has no defect on
tumor suppression and is viable, with only a defect in mammary gland development (Francis et
al., 2009; Talluri et al., 2010). Thus, a number of knock-in mouse models have been generated,
but we do not yet know the specific contexts in which (and extent to which) any pRB function
contributes to normal development and tumor suppression. This is due to the fact that it is very
difficult to generate separation-of-function mutants of pRB.
In contrast, the fact that mitochondrial pRB function localizes to a different cellular
compartment than the canonical pRB functions has allowed us to generate a pRB mutant that can
only induce transcription-independent apoptosis. This was done by specifically targeting pRB to
the mitochondria (Hilgendorf et al., 2013). Importantly, expression of this mutant in xenografted
tumors resulted in significant tumor suppression, showing that mitochondrial pRB can contribute
to tumor suppression. Moreover, analysis of the pRB:BAX complex may allow us to generate a
pRB mutant that specifically lacks mitochondrial pRB function (Amito-pRB). It would be
interesting to generate knock-in mouse models of these two pRB mutants and analyze the effect
of mutant pRB expression during development and in tumorigenesis. There are of course
numerous caveats to this approach. In particular, I anticipate that a mito-tagged pRB mouse, like
the Rb-null mouse, would be embryonic lethal since it would lack pRB's anti-proliferative
function. Conditional expression may therefore be necessary for this analysis. However, we do
147
not know which tissues and settings, if any, are most affected by mitochondrial pRB function,
making this a very time-consuming approach. Finally, both the non-cleavable and LxCxE
binding cleft deficient pRB mutant mouse showed no tumor-suppressive defect, suggesting that
pRB is indeed a pleiotropic protein with an arsenal of tumor suppressive capabilities, and that
loss of one function does not result in loss of overall tumor suppression. Thus, I anticipate that
analysis of the Amito-pRB mutant mouse will show no defect in tumor suppression. Since this
does not mean that mitochondrial pRB cannot contribute to tumor suppression, merely that this is
not the only tumor-suppressive pRB function, this approach may not be very informative.
Alternatively, we hypothesize that if mitochondrial pRB function contributes to tumor
suppression, this function must be affected in some human tumors harboring point mutations in
the RB-1 gene. Thus, it would be very interesting to analyze how naturally-occurring mutations
of pRB affect mitochondrial pRB function. This can be done using two parallel approaches. It is
possible to analyze patient tumor samples and determine if mitochondrial localization is affected
and the amount of mitochondrial pRB relative to nuclear pRB is therefore altered. We note that
this analysis would not be trivial, since there are technical difficulties to pRB
immunohistochemisty and the relatively larger amount of nuclear pRB may make quantification
of mitochondrial pRB protein levels difficult. Furthermore, localization to mitochondria is not
the only way to affect mitochondrial pR B function, so that not all point mutations will likely
impinge on mitochondrial pRB activity via this mechanism. Nevertheless, in addition to
confinning that mitochondrial pRB function is affected by some point mutations and thus
contributes to tumor suppression in vivo, this analysis could also help us understand the
mechanism of mitochondrial pRB localization. Alternatively, we can generate pRB mutants that
recapitulate tumor-derived pRB mutations and assay for mitochondrial pRB function in vitro and
148
in vivo. This approach can be informed by the results we obtain from our analyses of what
regulates mitochondrial pRB localization as well as identification of the pRB:BAX interaction
domain. We note that our mutant pRB analysis so far (Chapter 2, 3) has required us to generate
stable pools of cells with inducible expression, since constitutive pRB expression proved to be
highly toxic. This approach would not be amendable to testing many tumor-derived mutations.
However, we have already initiated the generation of Bak;Bax-deficient MEFs inducible for
BAX or BAK and anticipate that transient expression of pRB may be possible in these cells,
allowing us to more rapidly screen pRB mutants.
B:
Therapeutic Potential
The RB-i gene is mutated in about one-third of human tumors and our above analysis
may determine if mitochondrial pRB function is affected by these mutations and tumor
suppressive in a physiological context. Regardless, pRB is wild-type, though constitutively
CDK-phosphorylated, in the majority of human tumors. We have already shown that this CDKphosphorylated pRB can promote transcription-independent apoptosis. Thus, characterization of
mitochondrial pRB function may inform novel therapeutic approaches to exploit mitochondrial
phospho-pRB already present and active in human tumors to promote apoptosis. This approach
is purely speculative at this point, but we note that small molecule screens have identified drugs
that can impair or potentiate mitochondrial p53 function (Strom et al., 2006; Tang et al., 2007).
A similar approach may be taken to identify modulators of mitochondrial pRB. Since
mitochondrial pRB (and p53), unlike nuclear pRB (and p53), is purely anti-tumorigenic, we
believe that this approach merits consideration.
C:
Conclusion
149
Our analysis has identified a novel, tumor suppressive mechanism of pRB. Further
characterization is necessary to confirm that mitochondrial pRB function is affected in human
tumors harboring RB-I mutations and to identify to what extent and in what context
mitochondrial pRB contributes to pRB's overall developmental and tumor suppressive function.
However, pRB is only mutated in one-third of human tumors, but constitutively phosphorylated
in most if not all remaining ones. It may be possible to exploit this mitochondrial pRB for
cancer therapeutics.
150
References
Almasan, A., Yin, Y., Kelly, R.E., Lee, E.Y., Bradley, A., Li, W., Bertino, J.R., and Wahl, G.M.
(1995). Deficiency of retinoblastoma protein leads to inappropriate S-phase entry, activation of
E2F-responsive genes, and apoptosis. Proc Natl Acad Sci U S A 92, 5436-5440.
Bosco, E.E., Mayhew, C.N., Hennigan, R.F., Sage, J., Jacks, T., and Knudsen, E.S. (2004). RB
signaling prevents replication-dependent DNA double-strand breaks following genotoxic insult.
Nucleic Acids Res 32, 25-34.
Caelles, C., Helmberg, A., and Karin, M. (1994). p53-dependent apoptosis in the absence of
transcriptional activation of p53-target genes. Nature 370, 220-223.
Carnevale, J., Palander, 0., Seifried, L.A., and Dick, F.A. (2012). DNA damage signals through
differentially modified E2FI molecules to induce apoptosis. Mol Cell Biol 32, 900-912.
Chan, H.M., Krstic-Demonacos, M., Smith, L., Demonacos, C., and La Thangue, N.B. (2001).
Acetylation control of the retinoblastoma tumour-suppressor protein. Nat Cell Biol 3, 667-674.
Chau, B.N., Borges, H.L., Chen, T.T., Masselli, A., Hunton, I.C., and Wang, J.Y. (2002). Signaldependent protection from apoptosis in mice expressing caspase-resistant Rb. Nat Cell Biol 4,
757-765.
Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D., Schuler, M., and
Green, D.R. (2004). Direct activation of Bax by p53 mediates mitochondrial membrane
permeabilization and apoptosis. Science 303, 1010-1014.
Dumont, P., Leu, J.I., Della Pietra, A.C., 3rd, George, D.L., and Murphy, M. (2003). The codon
72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33, 357365.
Erster, S., Mihara, M., Kim, R.H., Petrenko, 0., and Moll, U.M. (2004). In vivo mitochondrial
p53 translocation triggers a rapid first wave of cell death in response to DNA damage that can
precede p53 target gene activation. Mol Cell Biol 24, 6728-6741.
Foster, B.A., Coffey, H.A., Morin, M.J., and Rastinejad, F. (1999). Pharmacological rescue of
mutant p53 conformation and function. Science 286, 2507-2510.
151
Francis, S.M., Bergsied, J., Isaac, C.E., Coschi, C.H., Martens, A.L., Hojilla, C.V., Chakrabarti,
S., Dimattia, G.E., Khoka, R., Wang, J.Y., et al. (2009). A functional connection between pRB
and transforming growth factor beta in growth inhibition and mammary gland development. Mol
Cell Biol 29, 4455-4466.
Fulcher, A., Dias, M., and Jans, D. (2010). Binding of p1 10 retinoblastoma protein inhibits
nuclear import of simian virus SV40 large tumor antigen. The Journal of biological chemistry
285, 17744-17797.
Gavathiotis, E., Reyna, D.E., Davis, M.L., Bird, G.H., and Walensky, L.D. (2010). BH3triggered structural reorganization drives the activation of proapoptotic BAX. Mol Cell 40, 481492.
Gavathiotis, E., Suzuki, M., Davis, M.L., Pitter, K., Bird, G.H., Katz, S.G., Tu, H.C., Kim, H.,
Cheng, E.H., Tjandra, N., el aL. (2008). BAX activation is initiated at a novel interaction site.
Nature 455, 1076-1081.
Geyer, R.K., Yu, Z.K., and Maki, C.G. (2000). The MDM2 RING-finger domain is required to
promote p53 nuclear export. Nat Cell Biol 2, 569-573.
Haupt, Y., Rowan, S., Shaulian, E., Vousden, K.H., and Oren, M. (1995). Induction of apoptosis
in HeLa cells by trans-activation-deficient p53. Genes Dev 9, 2170-2183.
Hilgendorf, K.I., Leshchiner, E.S., Nedelcu, S., Maynard, M.A., Calo, E., lanari, A., Walensky,
L.D., and Lees, J.A. (2013). The retinoblastoma protein induces apoptosis directly at the
mitochondria. Genes Dev 27, 1003-1015.
Lanari, A., Natale, T., Calo, E., Ferretti, E., Alesse, E., Screpanti, I., Haigis, K., Gulino, A., and
Lees, J.A. (2009). Proapoptotic function of the retinoblastoma tumor suppressor protein. Cancer
Cell 15, 184-194.
Inoue, Y., Kitagawa, M., and Taya, Y. (2007). Phosphorylation of pRB at Ser612 by Chkl/2
leads to a complex between pRB and E2F-I after DNA damage. EMBO J 26, 2083-2093.
Jacks, T., Fazeli, A., Schmitt, E.M., Bronson, R.T., Goodell, M.A., and Weinberg, R.A. (1992).
Effects of an Rb mutation in the mouse. Nature 359, 295-300.
152
Jiang, P., Du, W., Heese, K., and Wu, M. (2006). The Bad guy cooperates with good cop p53:
Bad is transcriptionally up-regulated by p53 and forms a Bad/p53 complex at the mitochondria to
induce apoptosis. Mol Cell Biol 26, 9071-9082.
Jiao, W., Datta, J., Lin, H.-M., Dundr, M., and Rane, S. (2006). Nucleocytoplasmic shuttling of
the retinoblastoma tumor suppressor protein via Cdk phosphorylation-dependent nuclear export.
The Journal of biological chemistry 281, 38098-38206.
Jiao, W., Lin, H.M., Datta, J., Braunschweig, T., Chung, J.Y., Hewitt, S., and Rane, S. (2008).
Aberrant nucleocytoplasmic localization of the retinoblastoma tumor suppressor protein in
human cancer correlates with moderate/poor tumor differentiation. Oncogene 27, 3156-3220.
Kawaguchi, Y., Ito, A., Appella, E., and Yao, T.P. (2006). Charge modification at multiple Cterminal lysine residues regulates p53 oligomerization and its nucleus-cytoplasm trafficking. J
Biol Chem 281, 1394-1400.
Knudsen, K.E., Booth, D., Naderi, S., Sever-Chroneos, Z., Fribourg, A.F., Hunton, I.C.,
Feramisco, J.R., Wang, J.Y., and Knudsen, E.S. (2000). RB-dependent S-phase response to DNA
damage. Mol Cell Biol 20, 7751-7763.
Korah, J., Falah, N., Lacerte, A., and Lebrun, J.J. (2012). A transcriptionally active pRb-E2F1P/CAF signaling pathway is central to TGFbeta-mediated apoptosis. Cell Death Dis 3, e407.
Lane, D.P. (1992). Cancer. p53, guardian of the genome. Nature 358, 15-16.
Leu, J., Dumont, P., Hafey, M., Murphy, M., and George, D. (2004a). Mitochondrial p53
activates Bak and causes disruption of a Bak-Mel I complex. Nature cell biology 6, 443-493.
Leu, J.I., Dumont, P., Hafey, M., Murphy, M.E., and George, D.L. (2004b). Mitochondrial p53
activates Bak and causes disruption of a Bak-Mcll complex. Nat Cell Biol 6, 443-450.
Marchenko, N., Zaika, A., and Moll, U. (2000). Death signal-induced localization of p53 protein
to mitochondria. A potential role in apoptotic signaling. The Journal of biological chemistry 275,
16202-16214.
Markham, D., Munro, S., Soloway, J., O'Connor, D.P., and La Thangue, N.B. (2006). DNAdamage-responsive acetylation of pRb regulates binding to E2F-1. EMBO Rep 7, 192-198.
153
Mihara, M., Erster, S., Zaika, A., Petrenko, 0., Chittenden, T., Pancoska, P., and Moll, U.M.
(2003). p5 3 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.
Mittnacht, S., and Weinberg, R.A. (1991). GI/S phosphorylation of the retinoblastoma protein is
associated with an altered affinity for the nuclear compartment. Cell 65, 381-393.
Palacios, G., Crawford, H.C., Vaseva, A., and Moll, U.M. (2008). Mitochondrially targeted wildtype p53 induces apoptosis in a solid human tumor xenograft model. Cell Cycle 7, 2584-2590.
Palacios, G., and Moll, U.M. (2006). Mitochondrially targeted wild-type p53 suppresses growth
of mutant p53 lymphomas in vivo. Oncogene 25, 6133-6139.
Park, B.S., Song, Y.S., Yee, S.B., Lee, B.G., Seo, S.Y., Park, Y.C., Kim, J.M., Kim, H.M., and
Yoo, Y.H. (2005). Phospho-ser 15-p53 translocates into mitochondria and interacts with Bcl-2
and Bcl-xL in eugenol-induced apoptosis. Apoptosis 10, 193-200.
Petros, A.M., Gunasekera, A., Xu, N., Olejniczak, E.T., and Fesik, S.W. (2004). Defining the
p53 DNA-binding domain/Bcl-x(L)-binding interface using NMR. FEBS Lett 559, 171-174.
Roth, D., Harper, I., Pouton, C., and Jans, D. (2009). Modulation of nucleocytoplasmic
trafficking by retention in cytoplasm or nucleus. Journal of cellular biochemistry 107, 11601167.
Sansome, C., Zaika, A., Marchenko, N.D., and Moll, U.M. (2001). Hypoxia death stimulus
induces translocation of p53 protein to mitochondria. Detection by immunofluorescence on
whole cells. FEBS Lett 488, 110-115.
Sot, B., Freund, S.M., and Fersht, A.R. (2007). Comparative biophysical characterization of p53
with the pro-apoptotic BAK and the anti-apoptotic BCL-xL. J Biol Chem 282, 29193-29200.
Strom, E., Sathe, S., Komarov, P.G., Chernova, O.B., Pavlovska, I., Shyshynova, I., Bosykh,
D.A., Burdelya, L.G., Macklis, R.M., Skaliter, R., et al. (2006). Small-molecule inhibitor of p53
binding to mitochondria protects mice from gamma radiation. Nat Chem Biol 2, 474-479.
Sun, H., Chang, Y., Schweers, B., Dyer, M.A., Zhang, X., Hayward, S.W., and Goodrich, D.W.
(2006). An E2F binding-deficient Rbl protein partially rescues developmental defects associated
with Rbl nullizygosity. Mol Cell Biol 26, 1527-1537.
154
Sun, H., Wang, Y., Chinnam, M., Zhang, X., Hayward, S.W., Foster, B.A., Nikitin, A.Y., Wills,
M., and Goodrich, D.W. (2011). E2f binding-deficient Rbl protein suppresses prostate tumor
progression in vivo. Proc Natl Acad Sci U S A 108, 704-709.
Sykes, S.M., Stanek, T.J., Frank, A., Murphy, M.E., and McMahon, S.B. (2009). Acetylation of
the DNA binding domain regulates transcription-independent apoptosis by p53. J Biol Chem
284, 20197-20205.
Talluri, S., Isaac, C.E., Ahmad, M., Henley, S.A., Francis, S.M., Martens, A.L., Bremner, R., and
Dick, F.A. (2010). A G 1 checkpoint mediated by the retinoblastoma protein that is dispensable in
terminal differentiation but essential for senescence. Mol Cell Biol 30, 948-960.
Talos, F., Petrenko, 0., Mena, P., and Moll, U.M. (2005). Mitochondrially targeted p53 has
tumor suppressor activities in vivo. Cancer Res 65, 9971-9981.
Tang, X., Zhu, Y., Han, L., Kim, A.L., Kopelovich, L., Bickers, D.R., and Athar, M. (2007). CP31398 restores mutant p53 tumor suppressor function and inhibits UVB-induced skin
carcinogenesis in mice. J Clin Invest 117, 3753-3764.
Templeton, D.J. (1992). Nuclear binding of purified retinoblastoma gene product is determined
by cell cycle-regulated phosphorylation. Mol Cell Biol 12, 435-443.
Tomita, Y., Marchenko, N., Erster, S., Nemajerova, A., Dehner, A., Klein, C., Pan, H., Kessler,
H., Pancoska, P., and Moll, U.M. (2006). WT p53, but not tumor-derived mutants, bind to Bcl2
via the DNA binding domain and induce mitochondrial permeabilization. J Biol Chem 281,
8600-8606.
Yu, J., and Zhang, L. (2003). No PUMA, no death: implications for p53-dependent apoptosis.
Cancer Cell 4, 248-249.
155
Appendix A
The Role of the Pocket Protein Family and the E2F
Transcription Factor Family in Apoptosis
Keren I Hilgendorf, Alessandra Ianari, Jacqueline A Lees
K.I.H. contributed to all figures and text.
156
Abstract
The family of pocket proteins and the family of E2F transcription factors regulate entry into the
cell cycle. In addition, several family members have been implicated in induction of apoptosis.
Specifically, E2F1 and E2F3 are known to promote apoptosis and pRB can induce apoptosis
both by forming a transcriptionally-active complex with E2FI on promoters of apoptotic genes,
and by directly binding BAX and inducing mitochondrial outer membrane permeabilization.
The role of other family members in these pro-apoptotic mechanisms of action has not been
established. Here wc have initiated our investigation of the role of E2Fl-4 and the pocket
proteins pRB, p107, and p130 in apoptosis induction. We show that pRB specifically interacts
with E2FI upon treatment with a genotoxic agent and that only knockdown of pRB, not p107
and p130, impairs TNFa/cycloheximide-induced apoptosis. Thus, we propose that the ability to
promote apoptosis is specific to pRB and E2F 1.
157
Introduction
The pocket protein family, composed of pRB, p107, and p130, derives its name from the
presence of a highly conserved pocket domain (Mulligan and Jacks, 1998). Pocket proteins are
key regulators of the cell cycle and function via interaction with and inhibition of the E2F family
of transcription factors. Upon mitogenic signaling, cyclin-CDK complexes phosphorylate the
pocket proteins, resulting in release of E2Fs and transcriptional activation of genes important for
S phase entry (van den Heuvel and Dyson, 2008). This phosphorylation event demarks the
Restriction Point, the point of the cell cycle after which the cell is committed to enter the cell
cycle (Trimarchi and Lees, 2002). While pRB is constitutively expressed, p130 is most highly
expressed in GO and in quiescent cells and p107 is most highly expressed in GI/S (Baldi et al.,
1995; Beijersbergen et al., 1994; Chen et al., 1989). Pocket protein functions are at least partly
overlapping, in particular with regard to cell cycle regulation. However, only RB-] is commonly
found mutated in human tumors, suggesting that pRB also has some unique functions.
The E2F family functions in the regulation of proliferation and can be subdivided into
three functional groups based on their affinity for specific pocket proteins, ability to activate
transcription, and temporal association with cell cycle progression promoters. Activating E2Fs
(E2F1, 2, and 3) are bound to and inhibited by pRB under physiological conditions and occupy
cell cycle progression gene promoters during GI/S (Lees et al., 1993). Overexpression of any
activating E2Fs is sufficient to induce quiescent cells to re-enter the cell cycle and mouse
embryonic fibroblasts deficient for all three activating E2Fs are blocked in their ability to
proliferate (Johnson et al., 1993; Lukas et al., 1996; Qin et al., 1994; Wu et al., 2001). In
contrast, repressive E2Fs (E2F4, 5) cannot drive quiescent cells to re-enter the cell cycle and
mouse embryonic fibroblasts deficient for repressive E2Fs proliferate, but fail to cell cycle arrest
158
in response top]61JNK4A (Humbert et al., 2000; Lindeman et al., 1998; Lukas et al., 1996; Mann
and Jones, 1996). Moreover, repressive E2Fs occupy cell cycle progression gene promoters
during the GO/GI phase of the cell cycle, with E2F5 interacting with p130, and E2F4 binding to
all three pocket proteins (Hijmans et al., 1995; Moberg et al., 1996). Thus, repressive E2Fs are
thought to function in transcriptional repression of cell cycle progression genes via interaction
with pocket proteins, while activating E2Fs function in activation of cell cycle progression
genes. A third group functions independently of pocket proteins and generally in a repressive
manner (Trimarchi and Lees, 2002).
Both activating and repressive E2Fs have an obligate heterodimerization partner, DP, and
are structurally similar in that they contain a DNA binding domain, a DP dimerization domain,
and a transactivation domain. The pocket protein binding site is localized within the
transactivation domain and pocket proteins inhibit E2Fs by physically blocking the
transactivation domain and by recruiting transcriptional co-repressors. While activating E2Fs
contain a nuclear localization signal, repressive E2Fs do not, are predominantly cytoplasmic and
require pocket protein binding for nuclear localization (Muller et al., 1997; Verona et al., 1997).
In addition to regulating cell cycle entry, some E2Fs also function in other cellular
processes including apoptosis. Thus, loss of either E2F I or E2F3 suppresses the apoptotic
phenotype of the Rb-null embryo (Tsai et al., 1998; Ziebold et al., 2001). Moreover, ectopic
expression of E2FI promotes apoptosis both in cultured cells and transgenic mice (Stanelle and
Putzer, 2006). This occurs in both a p53-dependent and -independent manner, by transactivation
of p14
and consequently stabilization of p53 (Bates et al., 1998), as well as transcription of
pro-apoptotic proteins including Apaf-1, caspase 7, and p73 (Ginsberg, 2002; Moroni et al.,
2001; Muller et al., 2001). E2F3 has also been shown to promote apoptosis in some settings,
159
though this may be a consequence of its ability to transactivate E2F 1 (Lazzerini Denchi and
Helin, 2005; Ziebold et al., 2001).
We and others have previously shown that in response to various apoptotic stimuli
including DNA damage, pRB and E2F1 form a transcriptionally-active complex on promoters of
pro-apoptotic genes such as p73 and caspase 7 (lanari et al., 2009; Korah et al., 2012). Thus,
both free E2F1 and pRB-bound E2F1 can promote apoptosis (Carnevale et al., 2012). The role
of other pocket proteins and other E2F family members has not been investigated to date.
In addition to functioning as a transcriptional co-activator of E2F1, we have also recently
shown that pRB can promote apoptosis directly at the mitochondria and in a transcriptionindependent manner by directly binding to and activating BAX (Hilgendorf et al., 2013). In vitro
binding assays show that this pro-apoptotic function of pRB does not require E2F transcription
factors, though we do not know if E2F transcription factors potentiate or regulate mitochondrial
pRB function. Moreover, we do not know if this mitochondrial function is unique to pRB or
instead is conserved to other pocket proteins. Since RB-1 is the only pocket protein gene
commonly mutated in human tumors and pocket proteins have overlapping functions in cell
cycle regulation, we are intrigued by the possibility that this mitochondrial function is specific to
pRB.
We have initiated experiments to address some of the questions outlined above. Here we
show that DNA damage stabilizes specifically the pRB:E2FI complex as well as p107:activating
E2F complexes. We do not yet know the function of these p107 complexes, but propose that
pRB's transcriptional, pro-apoptotic function is mediated specifically by E2F 1. Moreover, we
present data arguing that only pRB can promote transcription-independent apoptosis. Further
analysis is necessary to further confirn and extend these data.
160
Results
In response to genotoxic stress, pRB interacts specifically with E2F, not E2F2, E2F3, and
E2F4.
We have previously shown that genotoxic stress results is stabilization of a pRB:E2Fl
complex in a human glioblastoma cell line, T98G (lanari et al., 2009). We next wanted to
investigate the effect of DNA damage on other pRB:E2F family protein complexes. We note
that it was previously shown that both E2F1 and E2F3 can promote apoptosis, though E2F1 's
pro-apoptotic function is more established (Polager and Ginsberg, 2008). We treated T98G cells
with the genotoxic agent doxorubicin for 24 hours and assayed for association of pRB with E2F
family members by immunoprecipitation of endogenous pRB. As expected, doxorubicin
treatment resulted in increased association between pRB and E2F 1 (Fig. IA). Remarkably, we
observed a decreased association between pRB and E2F2, E2F3, and E2F4 (Fig. IA). Thus,
pRB specifically associates with E2F1 upon treatment, suggesting that pRB's pro-apoptotic
function is mediated via association with E2F1 and not the other E2F transcription factors.
Importantly, we also wanted to confirm this observation by reciprocal innunoprecipitation.
Thus, we treated T98G cells with doxorubicin for 24 hours and immunoprecipitated endogenous
E2F, E2F2, E2F3, or E2F4. Two independent experiments are shown (Fig. 1B). Consistent
with our previous observation, we observe an increased association between pRB and E2F1, but
not the other E2F transcription factors. We note that for all E2F immunoprecipitations, we
pulled-down more protein in the treated condition. Thus, we cannot exclude that the increased
association between pRB and E2F I is a consequence of increased pull-down. However, this
cannot -explain the pRB pull-down data and increased cellular E2Fl protein levels would also
allow for more pRB binding upon treatment in vivo. Regardless, the fact that we see less pRB
161
A
IP: LG3 pRB
2
inpu
-_+ .Do (24h)
-1
-2
B
IP: kG3 F1
F2
F3
F4
input
- + Dxo (24h)
IP: F1
-
F2
F3
+ - + -
F4
+ - +
-
+ Doxo (24h)
Figure 1. DNA damage specifically stabilizes a pRB:E2Fl complex. (A) Western blot
showing pRB immunoprecipitation and association with E2F1-4 in the presence and absence
of DNA damage. Only the pRB:E2F1 complex is stabilized upon genotoxic stress. (B) Two
western blots showing E2F1-4 immunoprecipitates and association with pRB in the presence
and absence of DNA damage. Genotoxic stress specifically stabilizes the pRB:E2F 1 complex.
162
binding to E2F2, E2F3, and E2F4 upon treatment is more significant when considering that there
is more E2F protein available for binding. The functional consequence and mechanism
underlying this differential association between pRB and E2F1 versus the other E2F proteins
investigated here remain to be determined. We anticipate that this reflects pRB's ability to
specifically activate E2F 1-mediated apoptosis while relieving inhibition of cell cycle progression
genes.
In response to genotoxic stress, p107 interacts with E2F, E2F2, and E2F3.
We also wanted to investigate whether other pocket proteins bind E2F transcription
factors upon treatment with a genotoxic agent. Thus, we treated T98G cells with doxorubicin for
24 hours, immunoprecipitated endogenous E2F1, E2F2, E2F3, or E2F4, and assayed for p107
association by western blotting. Remarkably, doxorubicin treatment stabilized p107:E2F1,
E2F2, and E2F3 complexes, and destabilized p107:E2F4 complexes (Fig. 2A). Once again, this
correlates with increased E2F protein immunoprecipitation upon treatment. Thus, doxorubicin
treatment specifically results in formation of a pRB:E2FI complex as well as various
p107:activator E2F complexes. We do not yet know the function of these p107 complexes.
We have previously shown that in addition to transcriptionally co-activating proapoptotic E2F1 target genes like p73 and caspase 7 (lanari et al., 2009), pRB can also directly
induce mitochondrial outer membrane permeabilization at the mitochondria by directly binding
BAX and activating it in response to various apoptotic stimuli (Hilgendorf et al., 2013). We
therefore wanted to investigate the cellular localization of the various pocket protein:E2F family
protein complexes. We fractionated T98G cells left untreated or treated with doxorubicin for 24
hours into nuclear and cytoplasmic fractions and assayed for complex formation by
immunoprecipitating E2F1, E2F3, and E2F4. In response to DNA damage, the pRB:E2F1
163
A
IP: 1L3 FI
F2
F3
F4
IP: GF1 F2
-
+ Doxo (24h)
--
F3
F4 input
+ - + - + - + - +
Doxo (24h)
p107
p107 (low)
E2FI
p107 (high)
EF2
E2F3
E2F4
B
Total lysate
IP:
F3
_F1_
-
-
+
-
+
F4
-
+
nucefr ql
+
- +
Nuclear Fraction
IP: %G F1
_knpA_
F3
4
-
-
S.-,,,
F4
-
4
-
4
-
.16
Doxo (24h)
pRB
pRB
p107
p107
E2F1
E2F1
E2F3
E2F3
E2F4
E2F4
Cytoplasmic Fraction
F1
3 F4
IP: O
Dxo (24h)
--
+
-
+
-
+
Doxo (24h)
pRB
LaminA/C
p107
tubulin
E2F1
E2F3
E2F4
Figure 2. DNA damage stabilizes p107:activating E2F complexes both in the nucleus and
in the cytoplasm. (A) Two western blots showing E2F 1-4 immunoprecipitates and
association with p107 in the presence and absence of DNA damage. All p107:activating E2F
complexes are stabilized in response to genotoxic stress. (B) T98G cells left untreated or
treated with doxorubicin were fractionated into nuclear and cytoplasmic firaction and E2F1-4
were immunoprecipitated. The stabilized pRB:E2F1 complex is primarily nuclear, while the
p107:activating E2F complexes are both nuclear and cytoplasmic
164
complex formed is mostly nuclear, though some is cytoplasmic (Fig. 2B). The pRB:E2F3 and
E2F4 complexes are primarily nuclear. In contrast, the p107:E2F complexes stabilized upon
DNA damage are localized to both the nucleus and cytoplasm (Fig. 2B). Again, the function of
any nuclear or cytoplasmic p107 complex remains to be determined.
Numerous pocket protein:E2F complexes are formed upon genotoxic treatment. While
we know that pRB:E2F1 functions in promoting apoptosis, we do not know the role of
p107:activator E2F complexes. However, since some of these complexes are nuclear, we
anticipate that they may function in transcriptional co-activation. It is unclear whether this is to
promote cell cycle arrest or apoptosis.
Only pRB, not p107 and p1 3 0 , promotes TNFa-induced apoptosis.
We have previously shown that pRB promotes TNFa-induced apoptosis at least in part
via a novel non-nuclear and non-transcriptional mechanism (Hilgendorf et al., 2013) Since
p1 07:E2F complexes form in response to treatment with a DNA damaging agent and at least
some of these complexes are cytoplasmic, we wanted to investigate whether any of the other
pocket proteins can function in the cytoplasm to promote apoptosis. T[NFa synergizes with the
translation inhibitor cycloheximide (CHX) to promote apoptosis, allowing us to use TNFa/CIX
treatment to rapidly identify proteins with functions that do not require changes in gene
expression. Thus, we generated variants of human primary fibroblasts (IMR90 cells) with stable
knockdown of pRB, p107, p130, or a control hairpin and treated these IMR90 variants with
TNFa used in conjunction with CHX or the proteasome inhibitor MG-132. Use of either factor
in concert with TNFct prevents TNFa-induced activation of NF-KB and induction of a proinflammatory, anti-apoptotic response. Consistent with prior observations, knockdown of pRB
resulted in an impaired apoptotic response to TNFa used in conjunction with either
165
45 40 CI) 35 -
o30
-W
CL
025 -
N
untreated
20 -
E TNFa+CHX
15 -
* TNF+MG132
10 50 v-
II
shLuc
iii
shRB
II
shp107
shp130
Figure 3. Only pRB promotes TNFa-induced apoptosis, including in the presence of
CHX. IMR90 cells stably expressing shRNA against Luc, pRB, p107, and p130 were left
untreated or treated with TNFa and CHX or MG 132. Knockdown of pRB impaired TNFainduced apoptosis, even in the presence of CHX. Knockdown of p107 did not have this
effect.
166
MG132 or CHX (Fig. 3). In contrast, cells with a stable p107 knockdown displayed similar
levels of apoptosis in response to TNFa treatment as cells with control hairpin (Fig. 3). This
argues that p107 does not function in TNFa-induced apoptosis and cannot promote apoptosis in a
transcription-independent manner. It was difficult to discern the role of p130 in TNFc-induced
apoptosis since levels of apoptosis were increased even in the absence of treatment (Fig. 3).
Thus, p130 appears to act in an anti-apoptotic manner in the absence of treatment and its role in
TNFa- induced apoptosis remain to be determined. Taken together, our preliminary analysis of
other pocket proteins in TNFa-induced apoptosis, including in the presence of cycloheximide,
suggests that only pRB functions to promote apoptosis, including directly at the mitochondria.
Further investigation, including in other cell lines and with overexpression, is necessary to
confirm this.
167
Discussion
We and others have previously shown that in addition to its anti-apoptotic function, pRB
can also transcriptionally co-activate expression of pro-apoptotic genes (Carnevale et al., 2012;
Ianari et al., 2009; Korah et al., 2012). Specifically, apoptotic stimuli result in stabilization of a
RB:E2F1 complex. We show here that formation of this pRB complex in response to treatment
is unique to E2F1 and not E2F2, E2F3, and E2F4. Moreover, this complex localizes primarily to
the nucleus. This suggests that only E2FI mediates pRB-induced, transcription-dependent
apoptosis. We also show that DNA damage induces the formation of complexes containing p107
and any of the activating E2Fs. In contrast to the pRB:E2F1 complex, a significant fraction of
p107:activating E2Fs complexes are localized to the cytoplasm. We do not know the function of
these p107 complexes, in the nucleus or cytoplasm. However, preliminary investigation of the
role of pRB, p107, and p130 shows that only pRB acts in a pro-apoptotic manner both in
untreated cells and TNFa-treated cells. We therefore hypothesize that the p107 containing E2F
complexes are not pro-apoptotic and instead propose that pRB and E2F 1 are unique amongst
their family proteins in being able to forn a pro-apoptotic, transcriptionally active complex.
Moreover, our TNFa experiments were also conducted in the presence of cycloheximide,
suggesting that pRB's ability to activate apoptosis directly at the mitochondria by activating
BAX is not conserved to other pocket proteins. Taken together, our data argues that only pRB
and E2FI can promote apoptosis in response to various apoptotic stimuli and via both
transcriptional and, in the case of pRB, non-transcriptional mechanisms.
We do not yet know the nature of the pRB:E2Fl complex including how the interaction
sites and regulation of formation differ from that of the canonical, anti-proliferative pRB:E2FI
complex. We note that there is a second E2F 1 specific binding site on pRB distinct from the one
168
used by all other E2Fs as well as a second pRB binding site on E2F1. It remains to be seen if
this specific binding site mediates the pro-apoptotic response. Alternatively, the pro-apoptotic
pRB:E2F1 complex does not differ from the anti-proliferative one and induction of apoptosis is
regulated by binding to pro-apoptotic gene promoters via an as of yet unknown mechanism.
Since pRB blocks the E2F1 transactivation domain in this scenario, promoters would need to be
occupied by both free E2F 1 and pRB-bound E2F 1, with the latter functioning in recruiting
transcriptional co-factors like P/CAF. Intriguingly, a recent paper showed that both free E2FI
and pRB-bound E2F 1 are required for maximal induction of apoptosis in response to DNA
damage (Carnevale et al., 2012). Thus, we have shown here that pRB's transcriptional, proapoptotic function is mediated specifically by E2F1, but we do not yet understand the nature of
this complex.
We are also intrigued by our observation that p107 forms a complex with all three
activating E2Fs upon treatment with doxorubicin. However, our data argue that only pRB, and
not p107, can promote apoptosis, at least in response to TNFa. We note that our analysis of
p107 function is preliminary and that these data need to be extended to other apoptotic stimuli,
including DNA damage. However, we hypothesize that the p107:E2F complexes formed in
response to apoptotic stimuli are located on promoters of cell cycle progression genes and
function to induce cell cycle arrest. Further investigation is needed to test this hypothesis. We
note that this does not explain our observation that a significant amount of these p107 containing
complexes were also found in the cytoplasm.
Finally, we have shown here that knockdown of pRB and not the other pocket proteins
sensitizes to TNFa-induced apoptosis in the presence of an inhibitor of translation. We have
previously shown that pRB can activate BAX directly and induce mitochondrial outer membrane
169
permeabilization (Hilgendorf et al., 2013). The data presented here extend these observations by
suggesting that this mitochondrial function is specific to pRB. We note that pRB is affected in
human tumors by either direct mutation of the RB-1 gene or by constitutive CDKphosphorylation as a result of alterations in the upstream regulatory pathways. The latter
mechanism also affects the other pocket proteins. Pocket proteins show redundancy in their
cellular functions. However, our data suggest that pRB differs from p107 and p130 in its ability
to promote apoptosis, both transcriptionally and non-transcriptionally. Moreover, pRB's proapoptotic function via either mechanism is not inactivated by CDK-phosphorylation (Hilgendorf
et al., 2013; lanari et al., 2009). Thus, we propose that in settings were pRB's tumor suppressive
function is mediated to a significant extent by its ability to promote apoptosis, tumors will select
for direct inactivation via mutation in the RB-I gene. In other tumors, constitutive
phosphorylation of pocket proteins is sufficient to inhibit tumor suppression. Further
investigation is necessary to test this hypothesis.
170
Materials and Methods
Cell Culture and Drug Treatment
T98G cells were grown in DMEM with 10% FBS and Pen-Strep, IMR90 cells were grown in
MEM with Earle's Salts and 10% FBS, Pen-Strep, L-Glutamine, Sodium Pyruvate, and NEAA.
For doxorubicin treatment, 2pM Doxorubicin hydrochloride (Sigma) was used for 24 hours. For
TNFa treatments, 5Ong/ml of recombinant mouse TNFa (Sigma) was used with 0.1p M MG132
(Calbiochem) for 48 hours or 0.5ptg/ml CHX (Sigma) for 24 hours.
FACS Apoptosis Analysis
Cell suspensions were stained with AnnexinV-FITC or APC (Becton Dickinson) and Propidium
Iodide (Sigma) or 7AAD (Becton Dickinson). Total apoptotic cells were assessed by gating for
AnnexinV positive using a FACScan or FACSCalibur System (Becton Dickinson). Similar
trends were observed for all experiments when only early apoptotic (AnnexinV+;PI/7AAD-)
cells were considered (data not shown). For cell cycle profiling, cell suspensions were processed
as previously described (Ianari et al., 2009) and analyzed by FACScan and FlowJo.
Immunoprecipitation and Western Blotting
Proteins were extracted using an NP40 based buffer (50mM HEPES pH7.9, 10% glycerol,
150mM NaCl, 1%NP40, 1mM NaF, 10mM B-Glycerophosphate, protease inhibitors) or RIPA
buffer (50 mM Tris-HCl pH 7.6, 1% NP40, 140 mM NaCl, 0.1% SDS, 0.5% Sodium
Deoxycholate, 5mM EDTA, 100mM NaF, 2mM NaPPi) and quantified using BCA Protein
Assay reagent (Pierce). The following antibodies were used: pRB (Cell Signaling, 9309), E2F1
(Santa Cruz, sc193), E2F2 (Santa Cruz, sc633x), E2F3 (Santa Cruz, sc878x), E2F4 (Santa Cruz,
sc866), normal rabbit IgG (Santa Cruz).
171
Samples were loaded in SDS Lysis Buffer (8% SDS, 250mM TrisHCl pH 6.6, 40 % glycerol, 5%
2-Mercaptoethanol, bromophenol blue), separated by SDS-PAGE, transferred to a nitrocellulose
membrane, and blocked in 5% nonfat milk. The following antibodies were used in 2.5% nonfat
milk: pRB (Cell Signaling, 9309), p107 (Santa Cruz, sc318), E2Fl (Santa Cruz, sc193), E2F2
(Santa Cruz, sc633x), E2F3 (Santa Cruz, sc878x), E2F4 (Santa Cruz, sc866), Lamin A/C (Cell
Signaling, 2032), tubulin (Sigma, T9026).
Secondary I-IRP-conjugated antibodies (Santa Cruz) were used at 1:5000 in 1% nonfat milk.
Cytoplasmic Fractionation
Cell pellets were resuspended in Buffer A (19mM Hepes pH 7.9, 10mM KCl, 1.5mM MgCl 2,
0.34M Sucrose, 10% Glycerol, 1mM DTT, protease inhibitors, 0.1% Triton X-100) and
incubated on ice for 8 minutes. Cytoplasmic fraction was obtained by pelleting twice at 1300g,
4'C, 5 minutes and clarified by high-speed centrifugation at 20000g, 4*C, 5 minutes. Nuclear
fraction was obtained from first 1300g pellet, washed with Bufffer A, and lysed in RIPA or
NP40 buffer.
172
Acknowledgments
We thank S. Lowe for human Rb shRNA. We also thank the members of the Lees laboratory, in
particular A.I., for input during the study. This work was supported by an NCI/NIH grant to
J.A.L. who is a Ludwig Scholar at MIT. K.I.H. was supported by an NSF pre-doctoral fellowship
and D.H. Koch Graduate Fellowship.
173
References
Baldi, A., De Luca, A., Claudio, P.P., Baldi, F., Giordano, G.G., Tommasino, M., Paggi, M.G.,
and Giordano, A. (1995). The RB2/p130 gene product is a nuclear protein whose
phosphorylation is cell cycle regulated. J Cell Biochem 59, 402-408.
Bates, S., Phillips, A.C., Clark, P.A., Stott, F., Peters, G., Ludwig, R.L., and Vousden, K.1.
(1998). p14ARF links the tumour suppressors RB and p53. Nature 395, 124-125.
Beijersbergen, R.L., Kerkhoven, R.M., Zhu, L., Carlee, L., Voorhoeve, P.M., and Bernards, R.
(1994). E2F-4, a new member of the E2F gene family, has oncogenic activity and associates with
p107 in vivo. Genes Dev 8, 2680-2690.
Carnevale, J., Palander, 0., Seifried, L.A., and Dick, F.A. (2012). DNA damage signals through
differentially modified E2F1 molecules to induce apoptosis. Mol Cell Biol 32, 900-912.
Chen, P.L., Scully, P., Shew, J.Y., Wang, J.Y., and Lee, W.H. (1989). Phosphorylation of the
retinoblastoma gene product is modulated during the cell cycle and cellular differentiation. Cell
58, 1193-1198.
Ginsberg, D. (2002). E2F1 pathways to apoptosis. FEBS Lett 529, 122-125.
Hijmans, E.M., Voorhoeve, P.M., Beijersbergen, R.L., van 't Veer, L.J., and Bernards, R. (1995).
E2F-5, a new E2F family member that interacts with p130 in vivo. Mol Cell Biol 15, 3082-3089.
Hilgendorf, K.I., Leshchiner, E.S., Nedelcu, S., Maynard, M.A., Calo, E., lanari, A., Walensky,
L.D., and Lees, J.A. (2013). The retinoblastoma protein induces apoptosis directly at the
mitochondria. Genes Dev 27, 1003-1015.
Humbert, P.O., Rogers., C., Ganiatsas, S., Landsberg, R.L., Trimarchi, J.M., Dandapani, S.,
Brugnara, C., Erdman, S., Schrenzel, M., Bronson, R.T., et al. (2000). E2F4 is essential for
normal erythrocyte maturation and neonatal viability. Mo Cell 6, 281-291.
lanari, A., Natale, T., Calo, E., Ferretti, E., Alesse, E., Screpanti, I., Haigis, K., Gulino, A., and
Lees, J.A. (2009). Proapoptotic function of the retinoblastoma tumor suppressor protein. Cancer
Cell 15, 184-194.
174
Johnson, D.G., Schwarz, J.K., Cress, W.D., and Nevins, J.R. (1993). Expression of transcription
factor E2F1 induces quiescent cells to enter S phase. Nature 365, 349-352.
Korah, J., Falah, N., Lacerte, A., and Lebrun, J.J. (2012). A transcriptionally active pRb-E2F1P/CAF signaling pathway is central to TGFbeta-mediated apoptosis. Cell Death Dis 3, e407.
Lazzerini Denchi, E., and Helin, K. (2005). E2F1 is crucial for E2F-dependent apoptosis. EMBO
Rep 6, 661-668.
Lees, J.A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., and Helin, K.
(1993). The retinoblastoma protein binds to a family of E2F transcription factors. Mol Cell Biol
13, 7813-7825.
Lindeman, G.J., Dagnino, L., Gaubatz, S., Xu, Y., Bronson, R.T., Warren, H.B., and Livingston,
D.M. (1998). A specific, nonproliferative role for E2F-5 in choroid plexus function revealed by
gene targeting. Genes Dev 12, 1092-1098.
Lukas, J., Petersen, B.O., Holm, K., Bartek, J., and Helin, K. (1996). Deregulated expression of
E2F family members induces S-phase entry and overcomes p1 61NK4A-mediated growth
suppression. Mol Cell Biol 16, 1047-1057.
Mann, D.J., and Jones, N.C. (1996). E2F-I but not E2F-4 can overcome p16-induced GI cellcycle arrest. Curr Biol 6, 474-483.
Moberg, K., Starz, M.A., and Lees, J.A. (1996). E2F-4 switches from p130 to p107 and pRB in
response to cell cycle reentry. Mol Cell Biol 16, 1436-1449.
Moroni, M.C., Hickman, E.S., Lazzerini Denchi, E., Caprara, G., Colli, E., Cecconi, F., Muller,
H., and Helin, K. (2001). Apaf-I is a transcriptional target for E2F and p53. Nat Cell Biol 3, 552558.
Muller, H., Bracken, A.P., Vernell, R., Moroni, M.C., Christians, F., Grassilli, E., Prosperini, E.,
Vigo, E., Oliner, J.D., and Helin, K. (2001). E2Fs regulate the expression of genes involved in
differentiation, development, proliferation, and apoptosis. Genes Dev 15, 267-285.
Muller, H., Moroni, M.C., Vigo, E., Petersen, B.O., Bartek, J., and Helin, K. (1997). Induction of
S-phase entry by E2F transcription factors depends on their nuclear localization. Mol Cell Biol
17, 5508-5520.
175
Mulligan, G., and Jacks, T. (1998). The retinoblastoma gene family: cousins with overlapping
interests. Trends Genet 14, 223-229.
Polager, S., and Ginsberg, D. (2008). E2F - at the crossroads of life and death. Trends Cell Biol
18, 528-535.
Qin, X.Q., Livingston, D.M., Kaelin, W.G., Jr., and Adams, P.D. (1994). Deregulated
transcription factor E2F- 1 expression leads to S-phase entry and p53-mediated apoptosis. Proc
Natl Acad Sci U S A 91, 10918-10922.
Stanelle, J., and Putzer, B.M. (2006). E2F1 -induced apoptosis: turning killers into therapeutics.
Trends Mol Med 12, 177-185.
Trimarchi, J.M., and Lees, J.A. (2002). Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol
3, 11-20.
Tsai, K.Y., Hu, Y., Macleod, K.F., Crowley, D., Yamasaki, L., and Jacks, T. (1998). Mutation of
E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient
mouse embryos. Mol Cell 2, 293-304.
van den Heuvel, S., and Dyson, N.J. (2008). Conserved functions of the pRB and E2F families.
Nat Rev Mol Cell Biol 9, 713-724.
Verona, R., Moberg, K., Estes, S., Starz, M., Vernon, J.P., and Lees, J.A. (1997). E2F activity is
regulated by cell cycle-dependent changes in subcellular localization. Mol Cell Biol 17, 72687282.
Wu, L., Timmers, C., Maiti, B., Saavedra, H.I., Sang, L., Chong, G.T., Nuckolls, F., Giangrande,
P., Wright, F.A., Field, S.J., et al. (2001). The E2F1-3 transcription factors are essential for
cellular proliferation. Nature 414, 457-462.
Ziebold, U., Reza, T., Caron, A., and Lees, J.A. (2001). E2F3 contributes both to the
inappropriate proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev 15,
386-391.
176
Biographical Note
Keren I Hilgendorf
Massachusetts Institute of Technology
77 Massachusetts Avenue, Building 76-441
Cambridge, MA 02139
kerenh@mit.edu
Education:
2007-2013:
2003-2007:
Massachusetts Institute of Technology
Cambridge, MA
PhD. Candidate, Department of Biology
University of Texas at Austin
Austin, TX
B.S. with highest honor (Biology)
Research Experience:
2007-2013:
Graduate Studies
Laboratory of Dr. Jacqueline Lees, MIT.
Thesis Title: The Role of the Retinoblastoma Protein in Mitochondrial
Apoptosis
2004-2007:
Undergraduate Research
Laboratory of Dr. Shelley Payne, UT Austin.
Thesis Title: Identification and characterization of a virulence-associated
gene in S. dysenteriae
Summer 2006:
Summer Research
Laboratory of Moshe Oren, Weizmann Institute of Science, Rehovot, IL.
Project Title: Characterization of Lats2 UBA domain.
Fellowships/Awards:
2012-2013:
2009-2012:
2007:
2007:
2006:
2005-2007:
2005-2006:
David HI. Koch Graduate Fellowship, MIT
NSF Graduate Fellowship, MIT
Dean's Honored Graduate, UT Austin
Hewlett-Packard Award for Best Oral Presentation, UT Austin
University Co-op Award for Excellence in Health/Social Science
Research, UT Austin
Unrestricted Endowed Presidential Scholar, UT Austin
Undergraduate Research Fellowship, UT Austin
177
Teaching Experience:
Fall 2012:
Graduate Teaching Fellow, Life Science IA, Harvard
Spring 2011:
Graduate Teaching Assistant, Project Lab (7.16), MIT
Fall 2008:
Graduate Teaching Assistant, Cell Biology (7.06), MIT
Spring 2007:
Undergraduate Teaching Assistant, General Chemistry II, UT Austin
Fall 2006:
Undergraduate Teaching Assistant, Research Methods, UT Austin
Presentations:
2012
Colrain Meeting
Title: pRB induces apoptosis at the mitochondria
2011
Cold Spring Harbor Laboratory Meeting of Cell Death
Title: Role of mitochondrial pRB in apoptosis
Publications:
Hilgendorf, K.I., Leshchiner, E.S., Nedelcu, S., Maynard, M.A., Calo, E., lanari, A.,
Walensky, L.D., and Lees, J.A. (2013). The retinoblastoma protein induces apoptosis
directly at the mitochondria. Genes & Development, 27(9), 1003-1015.
Comment
Comment
Comment
Comment
in: Genes & Development 27.9 (2013): 975-979.
in: Nature Reviews Molecular Cell Biology 14.6 (2013): 328-328.
in: Nature Reviews Cancer 13.6 (2013): 379-379.
in: Science Signaling 6.277 (2013): ec 118.
Maynard, M.A., Ferretti, R., Hilgendorf, K.I., Perret, C. Whyte, P., and Lees, J.A.
(2013). Bmil is required for tumorigenesis in a mouse model of intestinal cancer.
Oncogene, In Press
178