Weed Science 2008 56:637–646
Importance of the P106S Target-Site Mutation in Conferring Resistance to
Glyphosate in a Goosegrass (Eleusine indica) Population from the Philippines
Shiv S. Kaundun, Ian A. Zelaya, Richard P. Dale, Amy J. Lycett, Patrice Carter, Kate R. Sharples, and Eddie McIndoe*
Few studies on herbicide resistance report data to establish unambiguously the correlation between genotype and
phenotype. Here we report on the importance of the EPSPS prolyl106 point mutation to serine (P106S) in conferring
resistance to glyphosate in a goosegrass population from Davao, Mindanao Island, the Philippines (Davao). Initial rateresponse studies showed clear survivors within the Davao population at glyphosate rates that completely controlled the
standard sensitive goosegrass population (STD1). Assessment of potential resistance mechanisms identified the presence of
P106S mutant individuals in the Davao population. Polymerase chain reaction (PCR) amplification of specific alleles
(PASA) analysis established that the mixed-resistant Davao population was comprised of 39.1% homozygous proline wildtype (PP106), 3.3% heterozygous serine mutant (PS106), and 57.6% homozygous serine mutant (SS106) genotypes.
Further rate-response studies on plants with a predetermined genotype estimated the Davao SS106 individuals to be
approximately 2-fold more resistant to glyphosate compared to Davao PP106 individuals. Extensive analysis at different
goosegrass growth stages and glyphosate rates established strong correlation (P , 0.001) between presence of P106S in
EPSPS and the resistant phenotype. Importantly, no differences in the pattern of absorbed or translocated 14C–glyphosate
were observed between PP106 and SS106 Davao genotypes or Davao and STD1 individuals, suggesting that glyphosate
resistance in the Davao population was attributable to an altered target site mechanism. This study demonstrates that
whilst P106S in EPSPS confers a moderate resistance level to glyphosate, the mechanism is sufficient to endow glyphosate
failure at the recommended field rates.
Nomenclature: Glyphosate; goosegrass, Eleusine indica (L.) Gaertn. ELEIN.
Key words: 3-phosphoshikimate 1-carboxyvinyltransferase, DNA polymorphism, EC 2.5.1.19, EPSPS, herbicide
resistance, amino acid conservation, resistance mechanism.
Glyphosate is the most important postemergence, nonselective, systemic herbicide controlling a broad spectrum of
180 annual and perennial weed species (Jaworski 1972). The
herbicide is characterized by low mammalian toxicity and
rapid soil degradation (Franz et al. 1997). In plants and
microorganisms, glyphosate inhibits the synthesis of the
essential aromatic amino acids L-phenylalanine, L-tyrosine,
and L-tryptophan and a plethora of secondary metabolites
that originate from the shikimic acid pathway (Holländer
and Amrhein 1980; Steinrücken and Amrhein 1980).
The mechanism of action is the competitive inhibition
of phosphoenolpyruvate (PEP) in the binary shikimate3-phosphate?3-phosphoshikimate 1-carboxyvinyltransferase
(EPSPS; EC 2.5.1.19) complex (Kishore and Shah 1988).
Glyphosate binding to this binary complex promotes a
macrostructural transition of the two globular domains that
define the enzyme’s tertiary structure, to a more stable closed
conformation (Anderson et al. 1988; Krekel et al. 1999).
Michaelis–Menten constant (Km) estimates for PEP are
typically 100 times greater than the dissociation constant
(Ki) estimates for glyphosate, suggesting that at equimolar
concentrations, glyphosate is a potent competitive inhibitor of
EPSPS (Smart et al. 1985). In plants, glyphosate’s mode of
action includes (1) depletion of the essential biomolecules
synthesized from the shikimic acid pathway, (2) reduction of
energy in the form of adenosine 59-triphosphate, and (3)
diversion of carbon in the form of PEP and D-erythrose 4phosphate to accumulate superfluous shikimic acid and other
alicyclic hydroxy acid intermediates from the shikimic acid
pathway.
DOI: 10.1614/WS-07-148.1
* Syngenta Ltd., Jealott’s Hill International Research Centre, Bracknell,
Berkshire RG42 6EY, United Kingdom. Shiv S. Kaundun and Ian A. Zelaya
contributed equally to this research. Corresponding author’s E-mail: deepak.
kaundun@syngenta.com
Since its introduction in 1972, glyphosate has provided an
excellent alternative for postemergence, nonselective weed
control. Glyphosate use has increased dramatically in the past
decade because of (1) the significant decrease in worldwide
prices and (2) the development of glyphosate-resistant crops,
which permit the selective, in-crop use of glyphosate, thus
providing farmers with a simple, economical, and effective
tool to manage diverse weeds (Nail et al. 2007; Owen and
Zelaya 2005). Unprecedented adoption rate of the glyphosateresistant technology in cotton (Gossypium hirsutum L.) and
soybean [Glycine max (L.) Merr.] production systems has
resulted in planting of . 80% of the area devoted to these
crops in some North and South American agroecosystems
(Owen and Zelaya 2005).
Since early assessments, glyphosate weed resistance was
purported to evolve at lower frequencies compared to other
herbicide chemistries, citing the herbicide’s unique mode of
action and limited metabolism in plants (Bradshaw et al. 1997;
Jasieniuk 1985). No confirmed cases of evolved resistance were
reported in the first two decades since glyphosate was
introduced to markets. During that time, glyphosate was used
primarily for nonselective (burndown) weed control. However,
since 1996, the ubiquitous glyphosate use worldwide and
accompanying high selection pressure has resulted in evolved
resistance in eight dicotyledonous and five monocotyledonous
species in diverse agroecosystems of the world (Heap 2008).
Within these confirmed cases, nine species have evolved in
glyphosate-resistant crop systems whilst the rest occurred in
areas where glyphosate was used for nonselective weed control
(Duke and Powles 2008; Powles 2008).
The current thesis surrounding mechanisms of evolved
glyphosate resistance include (1) impaired or reduced
glyphosate cellular transport to physiologically active meristematic tissues and (2) an insensitive altered EPSPS. A third
minor mechanism, EPSPS overexpression, has been cited;
however, alone the mechanism does not appear to account for
Kaundun et al.: P106S EPSPS point mutation
N
637
the levels of glyphosate resistance reported in the species in
question (Baerson et al. 2002a; Dinelli et al. 2006). The
impaired glyphosate translocation mechanism generally
confers high resistance levels, on the order of 8- to 12-fold,
compared to standard sensitive populations. This mechanism
has thus far been confirmed in Italian ryegrass (Lolium
multiflorum Lam.), rigid ryegrass (Lolium rigidum Gaudin),
and horseweed [Conyza canadensis (L.) Cronq.] (Dinelli et al.
2006; Feng et al. 2004; Koger and Reddy 2005; LorraineColwill et al. 2003; Michitte et al. 2005; Preston and Wakelin
2008; Wakelin et al. 2004). Inheritance studies demonstrated
that a single nuclear encoded and partially dominant gene
endows the reduced glyphosate translocation phenotype
(Lorraine-Colwill et al. 2001; Simarmata et al. 2005; Zelaya
et al. 2004, 2007). Polygenic resistance to glyphosate has thus
far only been reported in tall waterhemp [Amaranthus
tuberculatus (Moq.) J.D. Sauer] (Tranel et al. 2006; Zelaya
and Owen 2005).
Conversely, altered target-site based mechanisms confer
lower resistance levels to glyphosate, in the order of 2- to 4fold, and recently their relevance to field efficacy of glyphosate
has been questioned (Dinelli et al. 2006; Sammons et al.
2007). A naturally occurring target-site mutation in Italian
ryegrass, rigid ryegrass, and goosegrass results from a
transition of cytosine875 to thymine, encoding a seryl106
EPSPS isoform that is less sensitive to glyphosate (Baerson et
al. 2002b; Perez-Jones et al. 2007; Simarmata and Penner
2008). A transversion at this same site, cytosine875 to adenine,
encodes for a glyphosate insensitive threonyl106 EPSPS
isoform in goosegrass and rigid ryegrass (Ng et al. 2003;
Wakelin and Preston 2006). More recently, a proline106 to
alanine point mutation in EPSPS was reported in a multipleresistant rigid ryegrass population from South Africa (Yu et al.
2007). Importantly, the occurrence of both impaired
glyphosate translocation and altered target-site resistance
mechanisms in a single population purportedly result in an
additive effect with respect to the level of glyphosate
resistance, compared to populations with a single resistance
mechanism (Yu et al. 2007).
In this study we confirm resistance to glyphosate in a
goosegrass population from a new country—the Philippines.
In addition, we conduct extensive analysis between plant
survival at different growth stages and presence of the
prolyl106 to serine point mutation in EPSPS (P106S) to
demonstrate unequivocally the importance of this mutation in
conferring moderate resistance levels that result in glyphosate
failure at the recommended field rates.
Materials and Methods
Plant Material. The study was conducted on a mixedresistant goosegrass population and a standard sensitive
population. Seeds for the mixed-resistant goosegrass population were collected in a noncropping area in Davao,
Mindanao Island, The Philippines (Davao). This noncropping area was normally used for drying and cleaning crop
seed, repairing farm equipment, and other general farm
operations. Glyphosate resistance was suspected in this
goosegrass population after 5 yr of four annual field-rate
applications of glyphosate. The standard sensitive goosegrass
population (STD1; batch number PS-201) used for comparison was acquired from a local distributor.1
638
N
Weed Science 56, September–October 2008
Growth Conditions. Seeds from either the STD1 sensitive or
the Davao mixed-resistant goosegrass population were sown
separately in a soil media2 containing a 1:1 ratio of compost
and peat and the soil media was irrigated as required. The
emerged plants were maintained in a controlled greenhouse
set at 24/18 day/night temperature, 65% relative humidity
conditions, and a photon flux density of approximately
250 mmol quanta m22 s21. Fourteen days after sowing,
seedlings were transplanted into individual pots (75-mm
diam) with the soil media previously described; pots were
irrigated and plants fertilized as necessary.
Whole-Plant Rate Response on the Standard Sensitive and
Mixed-Resistant Populations. Plants at two-leaf stage were
treated with a precision CO2-powered laboratory sprayer3
equipped with a flat-fan spray nozzle,4 delivering a spray
volume of 200 L ha21. Both the STD1 and Davao goosegrass
populations were treated with rates of 0 (unsprayed control),
62.5; 125; 250; 500; 1,000; 2,000; 4,000; 8,000; 16,000 g ae
of glyphosate5 ha21. Fourteen plants per rate were sprayed
and arranged in a completely randomized design (n 5 140);
plants were then allowed to grow in the aforementioned
greenhouse conditions. Plant mortality was recorded 21 d
after glyphosate treatment (21 DAT).
Assessment of Altered Target-Site Resistance Mechanism.
To ascertain whether point mutations in a highly conserved
region of EPSPS were present in the Davao goosegrass
populations, genomic DNA was extracted from plants and a
330–base pair (bp) fragment was amplified through PCR; this
region encompassed the prolyl106 residue (corresponding to
the Arabidopsis EPSPS sequence reported by Klee et al. 1987)
previously associated with an increased Ki for glyphosate
(Comai et al. 1983; Padgette et al. 1991; Stalker et al. 1985).
Genomic DNA was also extracted from STD1 goosegrass
plants and the 330-bp fragment amplified for comparison to
the Davao goosegrass population. Further, the obtained
putative EPSPS sequences were confirmed by sequence
homology comparison to a previously reported EPSPS
genomic sequence from goosegrass (Genbank AY157642
and AY157643). Lastly, a PCR amplification of specific alleles
(PASA) method was developed, based on the goosegrass
EPSPS genomic sequences obtained, for rapid and unambiguous detection of polymorphisms at the codon corresponding
to prolyl106 in the mature EPSPS (Bottema and Sommer
1993).
DNA Extraction. Approximately 0.25 g of plant tissue was
excised from leaves, placed in a single well in 96 deep-well
blocks, and stored at 2 80 C. The tissue was then ground in a
bead mill to a dry powder and centrifuged at 2,200 3 g for
5 min. Finally, a Magnesil Plant DNA Extraction kit6 was
used to extract the genomic DNA with the use of a Biomek
FX automation workstation.7
PCR Amplification and EPSPS Sequencing. PCR reactions were
conducted with Ready-to-Go Taq Beads8 in a volume of
25 ml, a sample of genomic DNA (10 to 50 ng), and a primer
concentration of 20 pmol ml21. The Mastercycle Gradient
Thermocycler Model 96 machine9 was used and PCR
was conducted on genomic DNA with EPSPS–SeqF1
(CTCTTCTTGGGGAATGCTGGA) and EPSPS–SeqR1
(TAACCTTGCCACCAGGTAGCCCTC) primers to amplify a 330-bp fragment covering the aforementioned EPSPS
region. PCR conditions included: 1 cycle of 95 C for 5 min;
40 cycles of 95 C for 30 s, 60 C for 30 s, and 72 C for
2 min; and a final extension cycle of 72 C for 10 min. Lastly,
the obtained PCR fragments were directly sequenced with the
use of the EPSPS–R1 primer.
PASA Analysis of EPSPS Polymorphisms. Based on the
goosegrass EPSPS sequence gathered in the previous section,
four PCR primers were designed for PASA analysis. These
comprised two external and non-allele specific primers,
PASA–F1 (ACAAAGCTGCCAAAAGAGCGGTAG) and
PASA–R1 (TAACCTTGCCACCAGGTAGCCCTC), in addition to two allele-specific primers, PASA–P (GAATGCTGGAACTGCAATGCGTC) and PASA–S (GCAGCAGTTACGGCTGCTGTCAATTA), to identify positively the
wild-type homozygous prolyl106 genotype (PP106), the mutant
heterozygous seryl106 (PS106) and the mutant homozygous
seryl106 (SS106) genotypes. Noteworthy, the allele-specific
primers EPSPS–P and EPSPS–S were intentionally destabilized
at the nucleotide minus one position (N 2 1) with respect to
the 39 end of the polypeptide to increase PASA analysis
specificity (Liu et al. 1997). To detect the prolyl106 wild-type
and seryl106 mutant-type alleles robustly, primer destabilization
was achieved by replacing adenine and guanine residues by a
thymine residue, respectively. Finally, PCR was conducted with
Ready-to-Go Taq Beads8 in a volume of 25 ml; 10 to 50 ng of
genomic DNA was used in each reaction with a primer
concentration of 20 pmol ml21.
The PASA method was conducted in a Tgradient PCR
machine10 with the following conditions: 1 cycle of 95 C for
5 min; followed by 20 cycles of 95 C for 30 s, 61.5 C for
30 s (2 0.5 C per cycle), and 72 C for 60 s; then 15 cycles of
95 C for 30 s, 51.5 C for 30 s, and 72 C for 60 s; and a final
extension cycle of 72 C for 5 min. The PASA products were
then resolved in a 2% agarose gels in a 1 3 TBE (45 mM Tris
base, 45 mM boric acid, 1 mM EDTA; pH 8.0) running
buffer. Lastly, the presence or absence of the 320-bp and 136bp bands was then used to identify the PP106, PS106, and
SS106 genotype (Figure 1).
Whole-Plant Rate Response on Predetermined Genotypes.
Because the previous whole-plant rate response was conducted
on a sample from a mixed-resistant population, rate-response
tests were performed on a homogeneous sample of plants with
a predetermined genotype (PP106 or SS106), in order to
measure the level of resistance conferred by the P106S point
mutation.
Goosegrass plants from the Davao and STD1 populations were genotyped following the PASA method previously described; plants were then separated into PP106,
PS106, or SS106 genotypes within these populations. Given
the low frequency of the heterozygous PS106 genotype
within the mixed-resistant Davao population (3.3%),
insufficient plants were identified in this subgroup for
inclusion in the whole-plant rate-response study. Therefore,
further tests in this section were performed only on the
standard sensitive STD1 population (PP106) and the two
PP106 (frequency 39.1%) and SS106 (frequency 57.6%)
Figure 1. PASA method for the identification of goosegrass genotypes at EPSPS
amino acid position 106. All samples have a 411-bp nonspecific DNA fragment.
Homozygous wild-type plants have an additional 320-bp proline band,
homozygous mutant plants have a 136-bp serine band, and heterozygous mutant
plants have one copy each of the 320-bp mutant and 136-bp wild-type bands.
subgroups in the Davao population, for which enough
individuals were identified.
The predetermined goosegrass plants at two-leaf stage were
then treated with rates of 0 (unsprayed control); 62.5; 125;
250; 500; 1,000; 2,000; 4,000; 8,000; and 16,000 g ae
glyphosate ha21 under the spray conditions described above.
Four individuals per rate were sprayed, totaling 40 plants per
group (n 5 40). Following glyphosate treatment, plants were
arranged in a randomized complete block (RCB) design and
placed in the aforementioned greenhouse conditions; dry
biomasses were determined 21 DAT.
Plant Survival to Glyphosate at Different Growth Stages.
To determine the correlation of the observed P106S point
mutation and glyphosate efficacy at the recommended field
rates, studies were conducted between plant survival and
presence/absence of the P106S point mutation in EPSPS.
Goosegrass plants from the STD1 and the PP106 and SS106
genotypes from the Davao population were grown to three
different growth stages: 1.2 to 1.4 (7 cm tall), 2.0 to 2.2
(13 cm tall), and 2.3 to 2.4 (17 cm tall) based on the
Biologische Bundesanstalt, Bundessortenamt and Chemical
(BBCH) growth-stage scale. Plants at the early (7 cm tall) and
late growth stage (17 cm tall) were sprayed with a 880 and
1,200–g ae glyphosate ha21 rate, respectively, whereas plants
at the intermediate growth stage (13 cm tall) were sprayed
with 880; 1,040; and 1,200–g ae glyphosate ha21 rates. For
each growth stage and herbicide rate combination, 96 plants
per genotype from the Davao population were sprayed and
used in the phenotype–genotype correlation analysis. Additionally, 14 STD1 goosegrass plants were sprayed at the same
growth stage and herbicide rate combinations as reference.
Plant survival was recorded 31 DAT.
Kaundun et al.: P106S EPSPS point mutation
N
639
Assessment of Nonaltered Target-Site Resistance Mechanisms. Plants from the Davao population were separated into
PP106, PS106, and SS106 genotypes with the use of the
PASA method described earlier. As stated previously, PS106
individuals were not included in these tests given the low
frequency (3.3%) of this genotype in the Davao mixedresistant population. STD1 individuals (PP106) were also
included in the test as references.
14
C–Glyphosate Uptake and Translation Studies. Thirty plants
per genotype at the three-leaf stage and of uniform size were
used. For each of the five sampling times, six goosegrass plants
were assayed totaling 30 plants per genotype (n 5 30). Plants
were arranged in a RCB design and placed in the
aforementioned greenhouse conditions. A 2-cm section
(adaxial surface) in the middle of the youngest fully expanded
leaf was marked to delineate the treated area. The plants
were treated with technical b-labeled glyphosate ([3–14C]–
glyphosate) prepared in-house (2.29 MBq mg21 specific
activity) and mixed with commercial glyphosate formulation5;
each plant received a total of 3,000 Bq applied with a
microsyringe11 in 20 droplets of 0.2 ml. The 4.0 ml application
volume was equivalent to the recommended field rate of
840 g ae of glyphosate ha21 applied in a 200–L ha21 spray
volume.
Plants were sampled 0, 2, 6, 24, and 72 h after glyphosate
treatment. The unabsorbed glyphosate was removed from the
leaf surface of the treated area with five washes of a 1-ml
solution of 1:1 0.1 M HCl:methanol. The amount of 14C–
glyphosate in the leaf wash (5 ml) was estimated by
scintillation counting. Three aliquots samples of 500 ml were
taken from each leaf wash and combined with 12 ml of
scintillation fluid12 for analysis in a liquid scintillation
counter.13 Four plants per sampling time were then sectioned
into (1) treated area (TA), (2) above treated area (AT), (3)
below treated area (BA), (4) the rest of foliage (RF), and (5)
roots (RO). Plant sections were freeze-dried and combusted in
an oxidizer14 to quantify radioactivity; glyphosate translocation was then estimated based on the proportion of
radioactivity in the different plant sections. The remaining
two plants per sampling time were freeze-dried and covered
with Mila film for phosphorimaging.15
Statistical Analysis. All statistical analyses were conducted
with the use of SAS software.
Whole-Plant Rate-Response Assays on Predetermined Genotypes.
Dry-weight measurements were converted to a percentage of
the untreated control by dividing the weight of each treated
plant by the average weight of the untreated plants. This was
done separately for each of the genotypes. Data were fitted to
both logistic nonparallel and parallel nonlinear regression
models and it was found that the improvement in the fit of
the latter was not statistically significant. Consequently, the
parallel-line regression model was used because it is simpler
and lends itself to a more straightforward interpretation of
resistance factors. The model is described by the equation
100 { L
P~
zL
1 z e {bðx{mi zrij Þ
where x denotes log10(Rate); mi denotes the log GR50 for
640
N
Weed Science 56, September–October 2008
genotype i; rij denotes the log resistance factor between
genotypes i and j; this is equal to the difference between the
log GR50s for genotypes i and j; b denotes the common slope
fitted to all three genotypes; and L denotes the common lower
asymptote fitted to all three lines.
Because the model fits a common slope to all three
genotypes, the horizontal distance between any two fitted
regression lines is independent of response level and is an
estimate of the logarithm of the resistance factor between the
genotypes in question. This quantity was estimated directly by
fitting the model to each pair of genotypes in turn. This also
permitted the direct estimation of standard errors from which
the 95% confidence intervals follow. The resistance factor is
also estimated as the ratio of the respective GR50s.
Plant Survival at Different Growth Stages. Plant survival was
analyzed by forming 2 3 2 contingency tables with genotype
(PP106 or SS106) in one margin and the observed phenotype
(dead or alive) in the other. Each plant growth stage was
analyzed separately; entries in tables represent the number of
plants belonging to each of the four categories (genotype 3
phenotype). The plant survival data were analyzed by Fisher’s
Exact test under the null hypothesis (H0) that the two margins
in the table—genotype and phenotype—were independent;
the resulting P value estimates the probability that the
observed data or a more extreme set of outcomes could have
arisen by chance.
Absorption and Translation. Absorption and translation data
were analyzed by analysis of variance (ANOVA). Data
underwent an arcsine transformation prior to ANOVA and
each plant part was analyzed separately. The ANOVA
comprised 12 treatments (3 genotypes 3 4 assessment
timings), which provided a pooled estimate of error variation
based on 33 degrees of freedom; this error was used for
comparisons between genotypes at each assessment time and
means were separated based on Fisher’s least significant
difference (LSDa 5 0.05) test.
Results
Confirmation of Glyphosate Resistance in the Davao
Population. The putative resistant goosegrass population
from Davao, Mindanao Island, The Philippines (Davao) was
compared to the known sensitive goosegrass population
(STD1) with the use of a whole-plant herbicide rate response
assay (Figure 2). Results from this test revealed that the
population STD1 was relatively homogeneous in response to
glyphosate because all 14 treated plants were killed at rate
$ 2.0 kg ae glyphosate ha21; conversely, the presence of live
and dead goosegrass plants at the 2.0–kg ae glyphosate ha21
rate suggested that the Davao population was comprised of a
mixture of sensitive and resistant individuals. Approximately
50% mortality was obtained at glyphosate rates of 2.0 and
4.0 kg ae glyphosate ha21 for the Davao population, whereas
similar mortality was observed at 0.5–kg ae ha21 rate for the
STD1 population (Figure 2).
Investigating the Resistance Mechanism(s) in the Davao
Population. Assessment of Target-Site Modifications. Though
meaningful differences in mortality were found between the
studies correlating plant survival at the recommended
glyphosate rates and presence or absence of P106S at three
different goosegrass growth stages.
Figure 2. Glyphosate whole-plant rate response of goosegrass plants from the
standard susceptible (STD1) and the mixed-resistant population from the Davao
Island, The Philippines (Davao). Mortality was recorded 21 d after glyphosate
treatment (DAT).
Davao and the STD1 populations, considerable biomass
reduction was observed for both populations at glyphosate
rates as low as 0.5 kg ae glyphosate ha21. Therefore, based on
our current understanding of the resistance level conferred by
the two predominant glyphosate resistance mechanisms in
goosegrass and other species, an altered target-site mechanism
was strongly suspected as opposed to an impaired glyphosate
translocation mechanism. Under this premise, the conserved
region in EPSPS around the highly conserved arginyl105 was
sequenced (Padgette et al. 1991); previous reports have
demonstrated that point mutations in glycyl101, threonyl102,
and/or prolyl106 within this region are associated with a
decreased Ki for glyphosate (Padgette et al. 1991; Sidhu et al.
2000).
Partial Sequencing of the EPSPS Gene. With genomic DNA
used as a template, a 330-bp fragment was amplified through
PCR covering the equivalent amino acid positions
glycyl101 throughout glycyl162 in the mature EPSPS; this
fragment also contained the 98-bp uncoding region comprising intron 2 of EPSPS. Sequence comparison to two
previously reported genomic EPSPS sequences from goosegrass, AY157642 and AY157643, yielded 99% homology at
the nucleotide level and thus confirmed identity of the EPSPS
fragment. Two nucleotide differences between the 330-bp
fragment and AY157642 were observed; the first was a
synonymous mutation and the second consisted of a cytosineto-thymine transition at the first base of the cognate codon
CCA, hence TCA. This codon transition resulted in a prolineto-serine point mutation at position 106 of EPSPS (P106S).
Of the 25 Davao individuals sequenced, 15 (60%) were
homozygous serine mutants at this position (SS106), 2 (8%)
were heterozygous serine mutants (PS106), and 8 (32%) were
homozygous proline wild types (PP106). Conversely, all 16
STD1 individuals sequenced were PP106 at this position. It
is well documented that mutations in prolyl106 of EPSPS
decrease the Ki for glyphosate (Baerson et al. 2002b; Comai
et al. 1983, 1985; Ng et al. 2004a; Stalker et al. 1985; Yuan
et al. 2005). Therefore, the importance of the P106S in
relation to goosegrass efficacy to glyphosate was further
determined through (1) whole-plant rate-response analysis on
plants with a predetermined genotype at the codon
corresponding to prolyl106 of the mature EPSPS and (2)
Development of a PASA Method for Genotype Identification at
Position 106 of EPSPS. Because a large sample size of
individuals (. 100) was desired to assess the response to
glyphosate of the different genotypes identified in the Davao
population confidently, a simple, expeditious, and costeffective PASA method was developed to identify unambiguously polymorphisms at the codon corresponding to
prolyl106 in the mature EPSPS (Bottema and Sommer 1993).
The initial PASA method was based on a 100% complementary nucleotide sequence between the allele-specific
primers and the template goosegrass genomic DNA; however,
this method was ambiguous when the sequence information
was analyzed, as genotypes could not be unequivocally
identified. Consequently, the original PASA method was
further optimized by destabilization of primers at the
nucleotide minus one position (N 2 1) from the 39 end
(Liu et al. 1997). A direct comparison between the normal
and destabilized PASA method was made, confirming that the
nondestabilized primers lost all specificity by amplifying both
320-bp and 136-bp bands in the PCR. Conversely, the
optimized PASA method with destabilized primers accurately
identified the correct genotypes at EPSPS position 106 when
compared with sequencing results (data not shown). In
addition to the nonspecific 411-bp fragments, homozygous
wild-type (PP106) and homozygous mutant (SS106) individuals had a second 320-bp or a 136-bp band, respectively
(Figure 1). The heterozygous mutant individuals (PS106)
contained, as expected, a 320-bp band corresponding to the
wild-type allele and a 136-bp band equivalent to mutant
allele. The PASA-developed analysis in this work is applicable
only to detection of plants with prolyl106 or seryl106 substitution in EPSPS of goosegrass; ambiguous results may be
obtained if the method is applied to other weed species or
other point mutations in prolyl106 (P106T and P106A).
Out of the 453 random individuals within the Davao
population, 57.6% (261) were of the homozygous mutant
SS106 genotype, 39.1% (177) were homozygous wild-type
PP106, and only a small fraction, 3.3% (15), were of the
heterozygous mutant PS106 genotype. Importantly, the
genotype proportions identified with the destabilized PASA
method mirrored those initially estimated through direct
sequencing of the conserved EPSPS region. The low frequency
of heterozygous mutant PS106 individuals is consistent with
the primarily autogamous nature of goosegrass (Holm et al.
1977).
Whole-Plant Rate Response on Plants with the PP106 or SS106
Genotype. Rate-response assays were conducted on three
groups: (1) the STD1 homozygous wild-type PP106, (2)
the Davao homozygous wild-type PP106, and (3) the Davao
homozygous mutant SS106 genotype. Given that both the
Davao PP106 and SS106 genotypes originated from the same
population, rate- response comparisons of these genotypes
allowed for a more precise quantification of the importance of
P106S in goosegrass and glyphosate efficacy, as comparisons
were less affected by population genetic variability, which can
distort the interpretation of results. The STD1 goosegrass
population did not originate from an agroecosystem, and thus
Kaundun et al.: P106S EPSPS point mutation
N
641
Table 1. Estimated resistance factors based on GR50 values between the three
predetermined genotypes in the standard sensitive (STD1) and Davao goosegrass
populations with corresponding 95% confidence intervals (CI).
PP106 (STD1)a vs. PP106 (Davao)b
PP106 (STD1) vs. SS106 (Davao)c
PP106 (Davao) vs. SS106 (Davao)
Resistance
factor
Lower
95% CI
Upper
95% CI
1.33
2.80
2.09
1.06
2.20
1.64
1.69
3.55
2.67
a
Homozygous wild-type proline at position 106 of EPSPS (PP106) in the
standard sensitive population (STD1).
b
Homozygous wild-type proline at position 106 of EPSPS (PP106) in the
Davao population (Davao).
c
Homozygous mutant serine at position 106 of EPSPS (SS106) in the Davao
population (Davao).
Figure 3. Whole-plant rate response of goosegrass plants from the standard
susceptible (STD1) and Davao, Philippines population (Davao) to glyphosate.
Plants were genotyped at position 106 of EPSPS based on the PASA method
developed for goosegrass (refer to Materials and Methods section) and grouped
into homozygous wild–type proline (PP106) or homozygous mutant serine
(SS106) genotypes prior to the test. STD1 was comprised of 100% PP106 (m)
individuals whereas the Davao population contained 39.1% PP106 ($), 57.6%
SS106 (#), and 3.3% heterozygous mutant (PS106) individuals; the latter
genotype was not used in the test due to insufficient plant samples. Percentage
biomass relative to the untreated control was determined 35 d after treatment
(DAT). Data points represent the mean of four replicates (n 5 4); extensions on
symbols designate the standard error associated with individual means (sM).
has not undergone glyphosate selection pressure. Therefore,
comparison of STD1 PP106 and Davao PP106 genotypes
allowed for estimation of whether minor gene(s) present in the
Davao goosegrass could confer low levels of resistance to
glyphosate.
The logistic model estimated GR50 values of 0.081, 0.109,
and 0.227 kg ae glyphosate ha21 for the STD1 PP106, the
Davao PP106, and the Davao SS106 genotypes, respectively
(Figure 3). GR50 pairwise comparisons estimated a resistance
factor of 1.34 (confidence interval [CI] 5 1.06 to 1.69) for
the STD1 PP106 and Davao PP106 genotype contrast, 2.80
(CI 5 2.20 to 3.55) for the STD1 PP106 and Davao SS106
contrast, and a 2.09 (CI 5 1.64 to 2.67) resistance factor
estimate for the PP106 and SS106 Davao genotype
comparison (Table 1). These results suggested that the main
factor conferring resistance to glyphosate in the Davao
population was the presence of P106S in EPSPS. Further,
the low resistance factor (1.34) estimated for the comparison
between the homozygous wild-type allele in the STD1 and
Davao populations was statistically significant (P , 0.05).
This suggested that the Davao goosegrass population probably
contained other gene(s) that conferred low resistance to
glyphosate, a potential result of the 5-yr selection pressure that
the population underwent prior to suspicion of evolved
glyphosate resistance. Minor resistance mechanisms, including
reduced glyphosate absorption into plants and higher EPSPS
activity, have been associated with a decreased sensitivity to
glyphosate (Norsworthy et al. 2001; Westwood and Weller
1997).
Analysis Between the Presence or Absence of P106S and Plant
Survival. To further ascertain the importance of P106S in
EPSPS and glyphosate efficacy, extensive analysis was
conducted to compare plant survival at three growth stages
642
N
Weed Science 56, September–October 2008
sprayed with the recommended glyphosate field rates and
goosegrass plants with a confirmed PP106 or SS106 genotype
(Table 2). For the intermediate growth stage evaluated
(13 cm), 84%, 72%, and 57% of plants with the homozygous
mutant allele survived glyphosate rates of 0.88, 1.00 and
1.20 kg ae ha21, respectively. On the contrary, less than 10%
survival was observed in goosegrass plants with the wild-type
genotype at identical glyphosate rates (Table 2). Similar
results were observed with 7- and 17-cm-tall plants sprayed
with glyphosate rates of 0.88 and 1.2 kg ae ha21. The
observed differences between plant survival and presence or
absence of P106S were highly significant for all growth stages
and glyphosate rates tested (P , 0.001). These data provided
further support to the whole-plant rate-response results,
confirming that the presence of P106S resulted in glyphosate
failure at the recommended field rates.
Noncorrelation Between Glyphosate Absorption and Translation
and Plant Survival. In order to evaluate whether differences in
glyphosate uptake or translocation were associated with the
resistant phenotype, 14C–glyphosate studies were conducted
on plants with a predetermined genotype for the STD1 and
Davao populations. Glyphosate uptake expressed as the percentage of absorbed 14C–glyphosate from that applied did not
differ statistically in the four evaluations; however, PP106
STD1 plants tended to absorb more glyphosate (8%) at 72 h
after application (Figure 4). These results correlated with the
higher translocation of 14C–glyphosate to below the treated
area (P , 0.05) at 72 h in PP106 STD1 compared to both
PP106 and SS106 in the Davao population. Approximately
30 to 40% of the total 14C–glyphosate applied on goosegrass
leaves was absorbed by the plant (Figure 4).
Glyphosate translocation, estimated as the percent accumulated in different plant sections in time from the total 14C–
glyphosate absorbed, was not different at 2 h after treatment,
although a statistical difference was observed for root tissues
(Figure 4). Translocation of glyphosate was rapid, as only
20% of the total 14C–glyphosate absorbed remained in the
treated area after 24 h. At 6 and 24 h after treatment, more
glyphosate tended to accumulate in the treated area of SS106
Davao plants; nevertheless, no difference was observed at
72 h. Conversely, PP106 STD1 plants tended to translocate
more glyphosate above the treated area at 6 and 24 h
(Figure 4). Although statistically significant differences for
comparisons between genotypes existed primarily at 6 and
24 h, these were not consistent across all timings. These
results were consistent with phosphorimaging determinations
suggesting that the pattern of 14C–glyphosate absorption and
Table 2. Analysis between plant survival and presence of polymorphisms at position 106 of EPSPS in the Davao population. Plant survival was assessed at three growth
stages for the recommended glyphosate rate expected to result in effective goosegrass suppression.
Observed phenotypea
Group
A
B
C
D
E
b
c
Growth stage and glyphosate rate
Genotype
Alive
Dead
Survival (%)
P value
Stage: 1.2–1.4 (7 cm tall)
Rate: 0.88 kg ae ha21
Stage: 2.0–2.2 (13 cm tall)
Rate: 0.88 kg ae ha21
Stage: 2.0–2.2 (13 cm tall)
Rate: 1.00 kg ae ha21
Stage: 2.0–2.2 (13 cm tall)
Rate: 1.20 kg ae ha21
Stage: 2.3–2.4 (17 cm tall)
Rate: 1.20 kg ae ha21
PP106
SS106
PP106
SS106
PP106
SS106
PP106
SS106
PP106
SS106
9
48
3
49
0
34
2
27
0
45
37
1
30
9
48
13
44
20
23
21
20
98
9
84
0
72
4
57
0
68
0.001
0.001
0.001
0.001
0.001
a
Efficacy was assessed 31 d after glyphosate treatment by comparing the phenotype of treated goosegrass plants to that of the untreated control plants; dead plants were
completely necrotic and alive plants had marginal to no visual glyphosate injury symptoms and developed to reproductive stage.
b
Growth stage based on the Biologische Bundesanstalt, Bundessortenamt and Chemical (BBCH) guidelines.
c
Polymorphisms at position 106 of EPSPS: PP106, homozygous wild-type proline; PP106, homozygous mutant serine.
translocation throughout PP106 STD1, PP106 Davao, and
SS106 Davao plants was similar (data not shown). Overall,
the distribution of glyphosate within the three plant genotypes
was similar, thus suggesting that differences in glyphosate
absorption or translocation were not associated with the
resistant phenotype in the Davao population.
Evolution of Glyphosate Resistance in Goosegrass. Contrary to
early assessments regarding the perceived infrequency of
evolved glyphosate resistance (Bradshaw et al. 1997; Jasieniuk
1985), the chronicled phenotypic plasticity of goosegrass
suggests that evolved resistance can occur in this species with
moderate glyphosate selection pressure. For instance, the
Figure 4. Absorption and translocation of 14C–glyphosate in the tissue of
goosegrass plants from the standard susceptible (STD1) and Davao, Philippines
populations (Davao) at the three-leaf growth stage. Prior to conducting 14C–
glyphosate studies, goosegrass plants were genotyped at position 106 of EPSPS
according to the PASA method and segregated into homozygous wild-type
proline (PP106) or homozygous mutant serine (SS106) genotypes (refer to the
Materials and Methods section). Thirty plants per genotype within population
were tested and assessed 0, 2, 6, 24, or 72 h after 14C–glyphosate treatment.
Insert: Total 14C–glyphosate absorbed from that applied. Main plot: Total 14C–
glyphosate from that absorbed in the treated area (TA) and translocated to above
TA (AT), below TA (BA), the rest of the foliage (RF), and root tissue (RO). Each
bar represents the mean of four goosegrass independent samples (n 5 4);
extensions on bars indicate the standard error associated with individual means
(sM). Letters above bars designate the statistical difference (P # 0.05) within
assessment time and assayed plant section, for comparisons between genotypes.
original Teluk Intan population reported in Malaysia evolved
resistance within 3 yr of glyphosate selection pressure at
rates of 0.72 to 1.92 kg ae ha21 and application frequencies
of six to seven applications per year (Lee and Ngim 2000).
This may suggest that the frequency of the resistance allele(s)
existed at higher initial frequencies compared to other species.
Similarly, glyphosate resistance in the Lenggeng population
from Malaysia and the Davao population in this publication
evolved after 5 yr of four to six applications per annum. Other
populations in Malaysia, namely, Chaah and Temerloh,
evolved resistance after 10 yr of 7 to 8 glyphosate applications
per year and a third, Bidor, required 9 to 10 applications per
year over a 10-yr period (Ng et al. 2004b). Nonetheless, the
goosegrass populations requiring 10 yr to evolve resistance
demonstrated a higher resistance factor (2.8- to 3.3-fold)
compared to the Lenggeng (2.1-fold) population, suggesting
that continuous glyphosate selection pressure will further
increase the levels of resistance to glyphosate. Although
resistance in the Bidor population was confirmed after 10 yr,
the farmer reported nonperformance at the recommended
field rate of 1.08 kg ae ha21 within 5 yr of continuous
glyphosate use; from this point onward, goosegrass suppression required a consistent increase of glyphosate rates (Ng et
al. 2004b). Glyphosate resistance in the Lenggeng population
does not appear to be target-site based (Ng et al. 2004b),
suggesting the existence of at least another glyphosate
resistance mechanism or an unknown point mutation(s) in
EPSPS, different from those reported thus far at position 106
(P106S, P106T, and P106A).
EPSPS Mutations Conferring Resistance to Glyphosate. Of the
two glyphosate resistance mechanisms characterized to date,
impaired glyphosate translocation confers high resistance
levels (8- to 12-fold); therefore confirmation of resistance is
simpler, as the biological difference between the standard
sensitive and putative resistant population is large. Conversely,
modified target-site resistance may be more difficult to
confirm, given that this mechanism typically confers lower
resistance levels (2- to 4-fold), and the biological difference
between standard sensitive and putative resistant populations
may be small.
Several point mutations in EPSPS are associated with a
decreased Ki for glyphosate. The documentation of the
importance of mutations in EPSPS in conferring resistance to
Kaundun et al.: P106S EPSPS point mutation
N
643
glyphosate was first reported in prokaryotes (Comai et al.
1983). It was further reported that point mutations, namely,
G96A and P101S, increased the Ki for glyphosate and Km for
PEP and rendered an insensitive enzyme that was kinetically
less efficient compared to the wild-type EPSPS; however,
plant transformation with these point mutations resulted in
transgenic tobacco (Nicotiana tabacium L.) or petunia
(Petunia sp.) plants with resistance to glyphosate (Comai
et al. 1985; Kishore et al. 1986; Padgette et al. 1991; Sost and
Amrhein 1990). More recently, the T42M mutation was
reported to result in a more efficient EPSPS enzyme with
increased Ki for glyphosate but decreased Km for PEP (He et al.
2003). Furthermore, the P106L point mutation in tobacco
and the G96A and A183T double point mutations in
rapeseed (Brassica napus L.) have been demonstrated to confer
resistance to glyphosate (Kahrizi et al. 2007; Zhou et al.
2006). Lastly, some glyphosate-resistant crops are endowed
with the double point mutation threonyl102 and prolyl106 that
confers resistance to commercial field rates of glyphosate
(Sidhu et al. 2000).
From the aforementioned point mutations, only prolyl106
has thus far been documented to evolve naturally within
confirmed glyphosate-resistant weeds; these include P106S in
goosegrass, rigid ryegrass, and Italian ryegrass (Baerson et al.
2002b; Perez-Jones et al. 2007; Simarmata and Penner 2008),
P106T in goosegrass and rigid ryegrass (Ng et al. 2003;
Wakelin and Preston 2006), and P106A in rigid ryegrass (Yu
et al. 2007). Because of the lower resistance level conferred by
the naturally occurring EPSPS prolyl106 variants, conflicting
views exist regarding the significance of these point mutations
in conferring resistance to glyphosate at the recommended
field rates. An elegant study by Baerson et al. (2002b)
conducted enzyme kinetics on the wild-type P106 and mutant
S106 EPSPS isolated from goosegrass and confirmed these
results by expressing the proteins in an EPSPS-deficient
Escherichia coli system. The EPSPS kinetic data estimated a 5fold increase in the concentration of glyphosate required to
inhibit EPSPS in the resistant goosegrass population; this
translated to only a 3-fold increase when the enzymes were
expressed in E. coli. However, this work did not conduct any
studies at the whole-plant level to establish unambiguously the
importance of P106S by correlating genotype to the observed
phenotype. This is also the instance with other studies that
associated the loss of glyphosate field efficacy and presence of
P106S, P106T, or P106A in goosegrass and Lolium species.
Here we address this lack of data by characterizing
genotypes from a mixed-resistant goosegrass population and
by conducting analysis on confirmed genotypes within this
population. Whole-plant rate responses estimated a 2.14-fold
resistance increase between PP106 and SS106 individuals
within the Davao population (Table 1). Given that both
genotypes arose from plants of the same population, it is
reasonable to assert that the observed resistant phenotype was
attributable to the presence of P106S in EPSPS. The other
resistance mechanisms studied, alterations in absorption and
translocation of glyphosate, were not present in a consistent
manner in the genotypes studied (Figure 4). Further, the
importance of P106S in conferring resistance to glyphosate
was established (P , 0.001) by comprehensive survival
studies with large plant numbers at different phenological
stages (Table 2). This study demonstrates the importance of
P106S in conferring glyphosate resistance in the Davao
goosegrass population. However, it would be imprudent to
644
N
Weed Science 56, September–October 2008
extrapolate the results obtained in this study to other 106
EPSPS mutations, such as P106T and P106A identified in
goosegrass, or to other weed species, without conducting
proper and rigorous rate responses and studies on predetermined genotypes.
Sources of Materials
1
Herbiseed, New Farm, Mire Lane, West End, Twyford, RG10
0NJ, UK.
2
Potting Compost 3, John Innes Manufacturers, P.O. Box 8,
Harrogate, North Yorkshire, HG2 8XB, UK.
3
Sprayer, Thurnall Plc, Northbank Industrial Park, Irlam,
Manchester M44 5BL, UK.
4
Flat-fan spray nozzle 11002VS, TeeJet Spraying Systems, P.O.
Box 7900, Wheaton, IL 60189.
5
Glyphosate, Touchdown Total, Syngenta Crop Protection, Inc.
Greensboro, NC 27409.
6
Magnesil Plant DNA Extraction kit, Promega Corporation,
2800 Woods Hollow Road, Madison, WI 53711.
7
Biomek FX automation workstation, Beckman Coulter, Inc.,
4300 North Harbor Boulevard, P.O. Box 3100, Fullerton, CA
92834.
8
Ready-to-Go Taq Beads, Amersham Biosciences, 800 Centennial Avenue, P.O. Box 1327, Piscataway, NJ 08855.
9
Mastercycle Gradient Thermocycler Model 96, Eppendorf AG,
Barkhausenweg 1, 22339 Hamburg, Germany.
10
Tgradient PCR machine, Whatman Biometra, Biometra
GmbH i. L, Rudolf-Wissell-Strasse 30, 37079 Göttingen, Germany.
11
Microsyringe, Hamilton Company, 4970 Energy Way, Reno,
NV 89502.
12
Scintillation fluid, Optiphase Safe, Pharmacia-LKB Biotechnology, Pharmacia House, Midsummer Boulevard, Central Milton
Keynes, Bucks, MK9 3HP, UK.
13
Liquid scintillation counter, Tri-Carb 2900TR, PerkinElmer,
940 Winter Street, Waltham, MA 02451.
14
Oxidizer, Oximate 80, PerkinElmer, 940 Winter Street,
Waltham, MA 02451.
15
Mila film, FLA-5000, Fujifilm Corporation, 15th AraiBuilding, 19–20 Jingumae 6-chome, Shibuya-ku, Tokyo, 1500001, Japan.
Acknowledgments
The authors would like to thank the Plant Production and
Screening teams at Syngenta Ltd., Jealott’s Hill International
Research Centre, UK, for their assistance and the technical business
managers for their support of this study.
Literature Cited
Anderson, K. S., J. A. Sikorski, and K. A. Johnson. 1988. Evaluation of 5enolpyruvoylshikimate-3-phosphate synthase substrate and inhibitor binding
by stopped-flow and equilibrium fluorescence measurements. Biochemistry
27:1604–1610.
Baerson, S. R., D. J. Rodriguez, N. A. Biest, M. Tran, J. You, R. W. Kreuger, G.
M. Dill, J. E. Pratley, and K. J. Gruys. 2002a. Investigating the mechanism of
glyphosate resistance in rigid ryegrass (Lolium rigidum). Weed Sci.
50:721–730.
Baerson, S. R., D. J. Rodriguez, M. Tran, Y. Feng, N. A. Biest, and G. M. Dill.
2002b. Glyphosate-resistant goosegrass. Identification of a mutation in the
target enzyme 5-enolpyruvylshikimate-3-phosphate synthase. Plant Physiol.
129:1265–1275.
Bottema, C. D. and S. S. Sommer. 1993. PCR amplification of specific alleles:
rapid detection of known mutations and polymorphisms. Mutat. Res.
288:93–102.
Bradshaw, L. D., S. R. Padgette, S. L. Kimball, and B. H. Wells. 1997.
Perspectives on glyphosate resistance. Weed Technology 11:189–198.
Comai, L., D. Facciotti, W. R. Hiatt, G. Thompson, R. E. Rose, and D. M.
Stalker. 1985. Expression in plants of a mutant aroA gene from Salmonella
typhimurium confers tolerance to glyphosate. Nature 317:741–745.
Comai, L., L. C. Sen, and D. M. Stalker. 1983. An altered aroA gene product
confers resistance to the herbicide glyphosate. Science 221:370–371.
Dinelli, G., I. Marotti, A. Bonetti, M. Minelli, P. Catizone, and J. Barnes. 2006.
Physiological and molecular insight on the mechanisms of resistance to
glyphosate in Conyza canadensis (L.) Cronq. biotypes. Pestic. Biochem.
Physiol. 86:30–41.
Duke, S. O. and S. B. Powles. 2008. Glyphosate: a once-in-a-century herbicide.
Pest Manag. Sci. 64:319–325.
Feng, P.C.C., M. Tran, T. Chiu, R. D. Sammons, G. R. Heck, and C. A.
CaJacob. 2004. Investigations into glyphosate-resistant horseweed (Conyza
canadensis): retention, uptake, translocation, and metabolism. Weed Sci.
52:498–505.
Franz, J. E., M. K. Mao, and J. A. Sikorski. 1997. Glyphosate: A Unique Global
Herbicide. Washington, DC: American Chemical Society. 678 p.
He, M., Y. F. Nie, and P. Xu. 2003. A T42M substitution in bacterial 5enolpyruvylshikimate-3-phosphate synthase (EPSPS) generates enzymes with
increased resistance to glyphosate. Biosci. Biotechnol. Biochem. 67:1405–
1409.
Heap, I. 2008. The International Survey of Herbicide Resistant Weeds. http://
www.weedscience.com/. Accessed March 4, 2008.
Holländer, H. and N. Amrhein. 1980. The site of the inhibition of the shikimate
pathway by glyphosate. I. Inhibition by glyphosate of phenylpropanoid
synthesis in buckwheat (Fagopyrum esculentum Moench). Plant Physiol.
66:823–829.
Holm, L. G., D. L. Plucknett, J. V. Pancho, and J. P. Herberger. 1977. The
World’s Worst Weeds—Distribution and Biology. Honolulu, HA: The
University Press of Hawaii. 609 p.
Jasieniuk, M. 1985. Constraints on the evolution of glyphosate resistance in
weeds. Resistant Pest Manag. Newsl. 7:31–32.
Jaworski, E. G. 1972. Mode of action of N-phosphonomethylglycine. Inhibition
of aromatic amino acid biosynthesis. J. Agric. Food Chem. 20:1195–1198.
Kahrizi, D., A. H. Salmanian, A. Afshari, A. Moieni, and A. Mousavi. 2007.
Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and
transformation of rapeseed (Brassica napus L.) in order to make tolerance to
glyphosate. Plant Cell Rep. 26:95–104.
Kishore, G. M., L. Brundage, K. Kolk, S. R. Padgette, D. Rochester, K. Huynh,
and G. della-Cioppa. 1986. Isolation, purification and characterization of a
glyphosate tolerant mutant E. coli EPSP synthase. Proc. Fed. Am. Soc. Exp.
Biol. 45:1506–1506.
Kishore, G. M. and D. M. Shah. 1988. Amino acid biosynthesis inhibitors as
herbicides. Annu. Rev. Biochem. 57:627–663.
Klee, H. J., Y. M. Muskopf, and C. S. Gasser. 1987. Cloning of an Arabidopsis
thaliana gene encoding 5-enolpyruvylshikimate-3-phosphate synthase: sequence analysis and manipulation to obtain glyphosate-tolerant plants. Mol.
Gen. Genet. 210:437–442.
Koger, C. H. and K. N. Reddy. 2005. Role of absorption and translocation in the
mechanism of glyphosate resistance in horseweed (Conyza canadensis). Weed
Sci. 53:84–89.
Krekel, F., C. Oecking, N. Amrhein, and P. Macheroux. 1999. Substrate and
inhibitor-induced conformational changes in the structurally related enzymes
UDP-N-acetylglucosamine enolpyruvyl transferase (MurA) and 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS). Biochemistry 38:8864–8878.
Lee, L. J. and J. Ngim. 2000. A first report of glyphosate-resistant goosegrass
(Eleusine indica (L) Gaertn) in Malaysia. Pest Manag. Sci. 56:336–339.
Liu, Q., E. C. Thorland, J. A. Heit, and S. S. Sommer. 1997. Overlapping PCR
for bidirectional PCR amplification of specific alleles: a rapid one-tube method
for simultaneously differentiating homozygotes and heterozygotes. Genome
Res. 7:389–398.
Lorraine-Colwill, D. F., S. B. Powles, T. R. Hawkes, P. H. Hollinshead, S.A.J.
Warner, and C. Preston. 2003. Investigations into the mechanism of
glyphosate resistance in Lolium rigidum. Pestic. Biochem. Physiol. 74:62–72.
Lorraine-Colwill, D. F., S. B. Powles, T. R. Hawkes, and C. Preston. 2001.
Inheritance of evolved glyphosate resistance in Lolium rigidum (Gaud.). Theor.
Appl. Genet. 102:545–550.
Michitte, P., R. de Prado, N. Espinosa, and C. Gauvrit. 2005. Glyphosate
resistance in a Chilean Lolium multiflorum. Commun. Agric. Appl. Biol. Sci.
70:507–513.
Nail, E. L., D. L. Young, and W. F. Schillinger. 2007. Diesel and glyphosate
price changes benefit the economics of conservation tillage versus traditional
tillage. Soil Tillage Res. 94:321–327.
Ng, C. H., W. Ratnam, S. Surif, and B. S. Ismail. 2004a. Inheritance of
glyphosate resistance in goosegrass (Eleusine indica). Weed Sci. 52:564–570.
Ng, C. H., R. Wickneswari, S. Salmijah, Y. T. Teng, and B. S. Ismail. 2003.
Gene polymorphisms in glyphosate-resistant and -susceptible biotypes of
Eleusine indica from Malaysia. Weed Res. 43:108–115.
Ng, C. H., R. Wickneswary, S. Salmijah, Y. T. Teng, and B. S. Ismail. 2004b.
Glyphosate resistance in Eleusine indica (L.) Gaertn. from different origins and
polymerase chain reaction amplification of specific alleles. Aust. J. Agric. Res.
55:407–414.
Norsworthy, J. K., N. R. Burgos, and L. R. Oliver. 2001. Differences in weed
tolerance to glyphosate involve different mechanisms. Weed Technol.
15:725–731.
Owen, M.D.K. and I. A. Zelaya. 2005. Herbicide-resistant crops and weed
resistance to herbicides. Pest Manag. Sci. 61:301–311.
Padgette, S. R., D. B. Re, C. S. Gasser, D. A. Eichholtz, R. B. Frazier, C. M.
Hironaka, E. B. Levine, D. M. Shah, R. T. Fraley, and G. M. Kishore. 1991.
Site-directed mutagenesis of a conserved region of the 5-enolpyruvylshikimate3-phosphate synthase active site. J. Biol. Chem. 266:22,364–22,369.
Perez-Jones, A., K. W. Park, N. Polge, J. Colquhoun, and C. A. Mallory-Smith.
2007. Investigating the mechanisms of glyphosate resistance in Lolium
multiflorum. Planta 226:395–404.
Powles, S. B. 2008. Evolved glyphosate-resistant weeds around the world: lessons
to be learnt. Pest Manag. Sci. 64:360–365.
Preston, C. and A. M. Wakelin. 2008. Resistance to glyphosate from altered
herbicide translocation patterns. Pest Manag. Sci. 64:372–376.
Sammons, R. D., D. C. Heering, N. Dinicola, H. Glick, and G. A. Elmore.
2007. Sustainability and stewardship of glyphosate and glyphosate-resistant
crops. Weed Technol. 21:347–354.
Sidhu, R. S., B. G. Hammond, R. L. Fuchs, J. N. Mutz, L. R. Holden, B.
George, and T. Olson. 2000. Glyphosate-tolerant corn: the composition and
feeding value of grain from glyphosate-tolerant corn is equivalent to that of
conventional corn (Zea mays L.). J. Agric. Food Chem. 48:2305–2312.
Simarmata, M., S. Bughrara, and D. Penner. 2005. Inheritance of glyphosate
resistance in rigid ryegrass (Lolium rigidum) from California. Weed Sci.
53:615–619.
Simarmata, M. and D. Penner. 2008. The basis for glyphosate resistance in rigid
ryegrass (Lolium rigidum) from California. Weed Sci. 56:181–188.
Smart, C. C., D. Johänning, G. Müller, and N. Amrhein. 1985. Selective
overproduction of 5-enol-pyruvylshikimic acid 3-phosphate synthase in a plant
cell culture which tolerates high doses of the herbicide glyphosate. J. Biol.
Chem. 260:16,338–16,346.
Sost, D. and N. Amrhein. 1990. Substitution of Gly-96 to Ala in the 5enolpyruvylshikimate-3-phosphate synthase of Klebsiella pneumoniae results in
a greatly reduced affinity for the herbicide glyphosate. Arch. Biochem.
Biophys. 282:433–436.
Stalker, D. M., W. R. Hiatt, and L. Comai. 1985. A single amino acid
substitution in the enzyme 5-enolpyruvylshikimate-3-phosphate synthase
confers resistance to the herbicide glyphosate. J. Biol. Chem. 260:4724–4728.
Steinrücken, H. C. and N. Amrhein. 1980. The herbicide glyphosate is a potent
inhibitor of 5-enolpyruvyl-shikimic acid-3-phosphate synthase. Biochem.
Biophys. Res. Commun. 94:1207–1212.
Tranel, P. J., R. M. Lee, M. S. Bell, S. Singh, J. R. Walter, and K. W. Bradley.
2006. What we know (and don’t know) about glyphosate resistance in
waterhemp. Proc. North Cent. Weed Sci. Soc. Abstr. 61:100.
Wakelin, A. M., D. F. Lorraine-Colwill, and C. Preston. 2004. Glyphosate
resistance in four different populations of Lolium rigidum is associated with
reduced translocation of glyphosate to meristematic zones. Weed Res.
44:453–459.
Wakelin, A. M. and C. Preston. 2006. A target-site mutation is present in a
glyphosate-resistant Lolium rigidum population. Weed Res. 46:432–440.
Westwood, J. H. and S. C. Weller. 1997. Cellular mechanisms influence
differential glyphosate sensitivity in field bindweed (Convolvulus arvensis)
biotypes. Weed Sci. 45:2–11.
Yu, Q., A. Cairns, and S. B. Powles. 2007. Glyphosate, paraquat and ACCase
multiple herbicide resistance evolved in a Lolium rigidum biotype. Planta
225:499–513.
Yuan, C. I., Y. C. Hsieh, and M. Y. Chiang. 2005. Glyphosate-resistant
goosegrass in Taiwan: cloning of target enzyme (EPSPS) and molecular assay
of field populations. Plant Prot. Bull. 47:251–261.
Zelaya, I. A. and M.D.K. Owen. 2005. Differential response of Amaranthus
tuberculatus (Moq ex DC) JD Sauer to glyphosate. Pest Manag. Sci.
61:936–950.
Kaundun et al.: P106S EPSPS point mutation
N
645
Zelaya, I. A., M.D.K. Owen, and M. J. VanGessel. 2004. Inheritance of evolved
glyphosate resistance in Conyza canadensis (L.) Cronq. Theor. Appl. Genet.
110:58–70.
Zelaya, I. A., M.D.K. Owen, and M. J. VanGessel. 2007. Transfer of glyphosate
resistance: evidence of hybridization in Conyza (Asteraceae). Am. J. Bot.
94:660–673.
646
N
Weed Science 56, September–October 2008
Zhou, M., H. Xu, X. Wei, Z. Ye, L. Wei, W. Gong, Y. Wang, and Z. Zhu. 2006.
Identification of a glyphosate-resistant mutant of rice 5-enolpyruvylshikimate
3-phosphate synthase using a directed evolution strategy. Plant Physiol.
140:184–195.
Received September 11, 2007, and approved May 1, 2008.