Genes-Answers
1.
2.
3.
4.
5.
6.
7.
8.
Adenine, Guanine, Thymine, Cytosine
Double helix
Hydrogen Bonds
Daughter strand
DNA replication
Phosphate group
3’ to 5’ direction
a. 3’ GAATCGTAT 5’ made right to left
b. 3’ TTTGGACAA 5’ made right to left
c. 5’ GCTAACCGG 3’ made left to right
d. 5’ ACACGCTAG 3’ made left to right
9. adenine to thymine; guanine to cytosine
10. covalent bonds
11. parent strand
12. DNA polymerase
13. Sugar group
14. 5’ to 3’ direction
15. Each new DNA double helix contains one “old” strand from the original DNA
molecule and one “new” synthesized strand. So each new helix has a parent
strand and a daughter strand.
16.
a. 5’ CCGAATTGC 3’ made right to left
b. 3’ GGATACCGG 5’ made left to right
c. 5’ TTGATAAGG 3’ made right to left
d. 5’ AATTCGAAT 3’ made right to left
17. Guanine, Cytosine, Adenine, Uracil
18. Gene
19. Non-template strand
20. 5’ to 3’
21. 3’ to 5’
22. DNA replication results in two new daughter strands, and transcription only
results in one new RNA strand. DNA replication synthesizes the whole DNA
strand, transcription makes RNA only from the DNA strand with the genes.
In DNA replication adenine pairs with thymine, in transcription the adenine
on DNA pairs with uracil on RNA. Both processes synthesis DNA and RNA
respectively in the 5’ to 3’ direction.
23. Initiation, Elongation, Termination
24. Attaches to the promoter sequence on DNA, brings the RNA nucleotides to
the DNA, unwinds the DNA double helix, and recognizes the stop sequence on
DNA
25.
a. 3’ AAAUGGCCU 5’ made right to left
b. 3’ UUGGCAGUC 5’ made right to left
c. 5’ UGCUAAUUG 3’ made left to right
26. Adenine to Uracil; Guanine to Cytosine
27. The process by with RNA is synthesized from DNA
28. Template strand
29. Phosphate group
30. Sugar group
31. RNA polymerase attaches at the promoter sequence on DNA
32. RNA polymerase moves down the DNA while unwinding it and reads the
bases of DNA and brings in the new complementary RNA bases
33. RNA polymerase reaches a stop sequence and falls off the DNA. The new
RNA strand separates from DNA. The DNA strands reform their double helix.
34.
a. 5’ UUGCUAAAG 3’ made left to right
b. 5’ AUAUGGCUA 3’ made left to right
35. The sequence of DNA that codes for protein
36. 64
37. Codons on DNA contain Thymine and condons on RNA contain Uracil
38. 61
39.
a. stop
b. aspartic acid
c. valine
d. proline
e. threonine
40. transcription and translation
41. Watson and Crick
42. The process of taking the code of nucleic acids and making the product for it
in amino acids, leading to proteins
43. Codon
44. Every organism uses the same 64 codons. The codes is the same for
everything, it is the results that are different.
45. They are STOP codons, they signal the end of translation
46. It is a START codon, it signals the start of translation
47.
a. Leucine
b. Phenylalanine
c. Methionine- START
d. Lysine
e. Proline
48. The idea that DNA is transcribed to make RNA, which is then translated to
make protein.
49. Messenger RNA or mRNA, transfer RNA or tRNA, ribosomal RNA or rRNA
50. In ribosomes
51. It helps make covalent bonds between the amino acids
52. T-shaped
53. 20
54. mRNA
55. False, changes in mRNA or in protein do not affect the DNA. The central
dogma proceeds from DNA to RNA to protein and does not circle back to
DNA.
56. The ribosome has a small subunit and a large subunit and is made of rRNA
and protein
57. To transfer amino acids from the surrounding area to the ribosome
58. The amino acid attachment site is where the specified amino acid will attach
to the tRNA. The anticodon loop is the three base sequence that is
complementary to the codon on the mRNA
59. Initiation, elongation, termination
60. The P site is where the new protein emerges from and the A site is where the
amino acids are delivered to
61. AUG
62. UAC
63. Covalent bonds
64. When the ribosome reaches a STOP codon
65. Translation is the process by which the mRNA code is used to create protein
66. Amino acids, tRNA, mRNA, rRNA
67. The mRNA becomes sandwiched between the large and small subunits of the
ribosome at the start codon.
68. 5’
69. methionine
70. The first tRNA leaves the ribosome so the next tRNA can enter.
71. The ribosome moves the mRNA using energy and new amino acids are
continually added by new tRNA molecules. Each new tRNA moves from the A
site to the P site and then leaves the ribosome.
72. Termination occurs when the ribosome reaches a stop codon. The ribosome
subunits separate from the mRNA and the protein is released.
73. A protein in its primary sequence
Free Response Answers
1.
a. DNA is made of the sugar deoxyribose, contains the base thymine, is
double stranded, is helix shaped. RNA is made of the sugar ribose,
contains the base uracil, is single stranded, can be many different
shapes.
b. In both DNA replication and transcription the new DNA strands and
the new RNA strand respectively are synthesized in the 5’ to 3’
direction. In DNA replication both DNA strands are replicated, in
transcription only the template strand is transcribed. DNA replication
pairs adenine from one DNA strand with thymine on the new DNA
strand, and in transcription adenine from the template DNA strand is
paired with uracil on the new RNA strand. In DNA replication two
new DNA molecules containing one parent and one daughter strand
each are produced. In transcription only one new RNA strand is
produced.
2.
3.
4.
a. 3’ TGCATCTAATGC 5’ synthesized from right to left
b. DNA polymerase
c. It is semi-conservative because each new DNA molecule contains one
parent strand and one daughter strand.
a. Gene expression is the process of taking the code from DNA and
transcribing it into mRNA, and then into the amino acids or proteins.
b. Changes in RNA and protein do not affect DNA because the process of
gene expression is not circular and is unidirectional.
c. A change in DNA would result in a changed code for protein, so that
the codons in mRNA would be altered, and therefore the amino acids
coded for would be different. A change in the sequence of amino acids
results in a change of the primary structure of protein, which would
result in changes to the secondary and tertiary structure, and
therefore the function of the protein.
a. The steps of transcription are initiation, elongation, and termination.
In initiation, the RNA polymerase attaches to the DNA template strand
at the promoter sequence. In elongation, the RNA polymerase moves
down the DNA while uncoiling it and brining in the new RNA
nucleotide bases. In termination, the RNA polymerase reaches a
termination sequence and detaches from the DNA, the DNA recoils,
and the RNA strand is released.
b. The end product is a single strand of RNA.
c. The steps of translation are initiation, elongation, and termination. In
initiation, that small and large ribosomal subunits attach to the start
codon on the mRNA strand near the 5’ end, the tRNAs with the
appropriate amino acids attach surround the ribosome, and the tRNA
with the anticodon for AUG enters the A site and delivers the amino
acid methionine. In elongation the tRNAs carrying the anticodons for
the codons on mRNA continue to enter at the A site and deliver the
appropriate amino acids which covalently bond together. In
termination, a stop codon is reached, the ribosomal subunits detach
releasing the mRNA strand and a chain of amino acids.
d. A protein in its primary sequence.
5.
6.
AUG
a. Messenger RNA, transfer RNA, ribosomal RNA
b. One significant part of tRNA is the anticodon loop, which is a three
base sequence on the tip of the tRNA molecule that is complementary
to a specific codon on the mRNA. The other significant part of tRNA is
the amino acid attachment site, which is where the amino acid,
specified by the codon complementary to the tRNA anticodon, is
attached to the tRNA so that it can be transferred to the ribosome.
c. During translation, mRNA carries the codons that specify the chain of
amino acids. rRNA is found in the ribosomes and the ribosomes are
responsible for covalently bonding the amino acids together, while
separating the amino acids from their tRNAs. tRNA brings the
specified amino acids to the ribosome during translation.
a. 5’ AUGUUCCAGGAUCCCUGAUAA 3’ synthesized from left to right
b.
UUC
CAG
GAU
CCC
Methionine- Serine- Glutamine- Aspartic Acid- Proline- Tyrosine
UGA
UAA