Supporting Online Material for
advertisement
www.sciencemag.org/cgi/content/full/334/6053/222/DC1 Supporting Online Material for The Dynamic Architecture of Hox Gene Clusters Daan Noordermeer, Marion Leleu, Erik Splinter, Jacques Rougemont, Wouter De Laat, Denis Duboule* *To whom correspondence should be addressed. E-mail: denis.duboule@epfl.ch Published 14 October 2011, Science 334, 222 (2011) DOI: 10.1126/science.1207194 This PDF file includes: Materials and Methods Figs. S1 to S17 Tables S1 to S6 References (18–24) Materials and Methods Tissue sampling, animal care and mouse strains Tissue samples (as illustrated in Figure 1A) were isolated at day E10.5 to E10.75, with day E0.5 being noon on the day of the vaginal plug. Tissue pieces for Affymetrix gene expression analysis and 4C-sequencing were isolated in PBS and subsequently transferred to PBS supplemented with 10% Fetal Calf Serum, incubated for 45 minutes with 1 mg/ ml collagenase (Sigma) and made single cell using a cell strainer (BD Falcon). Wildtype material was then divided for further use in a pool for Affymetrix gene expression analysis and a pool for 4C-sequencing. All experiments were performed in agreement with institutional guidelines and Swiss laws on animal protection. Mutant mice used in this study were previously described: Del(8-10)/Del(1-13)-d11LacZ embryos were obtained by crossing heterozygous Del(1-13)-d11LacZ mice (18) versus heterozygous Del(8-10) mice (19); Del(i8-10)/Del(1-13)-d11LacZ embryos were obtained by crossing heterozygous Del(1-13)-d11LacZ mice versus heterozygous Del(i8-10) mice (20); Heterozygous control Del(1-13)-d11LacZ embryos were obtained from the two previous crosses. Genotyping using standard PCR protocols was done on material remaining after isolation of tissue samples. Affymetrix gene expression analysis Total RNA from tissue samples, of which a part was also used in the 4C-sequencing analysis, was isolated using Trizol LS reagent (Invitrogen) and RNeasy Mini Kit columns (Qiagen). Generation of biotinylated cRNA, slide hybridization, washing and scanning was done according to the manufacturers’ instructions (Affymetrix). For each sample, two technical replicates were performed. For genes represented by multiple probe-sets, the probe-set with highest value in the posterior trunk was used. 4C–sequencing 4C–seq libraries were constructed according to the previously described 3C-onChip (21) protocol, with few minor adjustments. Cells were lysed using a buffer containing 50 mM Tris-HCl (pH 8), 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton and Protease Inhibitor Cocktail (Roche). NlaIII (New England Biolabs) was used as primary restriction enzyme, DpnII (New England Biolabs) was used as secondary restriction enzyme. Wildtype libraries consisted of pooled tissue samples from 12 (anterior trunk and forebrain) or 24 (posterior trunk) E10.5 to E10.75 embryos. Mutant libraries consisted of a minimum of 8 E10.5 to E10.75 embryos. Random 4C–seq libraries were prepared by sequential NlaIII and Sau3AI (New England Biolabs) digestion and ligation of BACs covering the mouse Hox clusters (HoxD: RP23-331E7; HoxC: RP23-430C12; HoxB: RP23-381I12 and RP23196F5; HoxA: RP24-298M24). For each viewpoint, a total of 1 mg of each 4C-seq library was amplified using 16 individual PCR reactions with inverse primers including Illumina Solexa adapter sequences (primer sequences in Table S6, locations of restriction fragments used as viewpoints in Figure S3). For random 4C–seq libraries, a total of 1 ng BAC template substituted with 1 mg of Salmon Sperm DNA was amplified using 16 individual PCR reactions. Illumina sequencing was done on multiplexed samples, containing PCR amplified material of up to 5 viewpoints, using 76 bp Single end reads on the Illumina Genome Analyzer system according to the manufacturer’s specifications. 4C-sequencing reads were sorted, aligned, and translated to restriction fragments using a newly developed 4C-seq application, hosted as part of the HTSstation service by the Swiss Institute of Bioinformatics (available, including a detailed documentation, at http:// htsstation.vital-it.ch/ and outlined in Figure S2). Reads in a region directly surrounding the viewpoint were highly enriched and showed considerable experimental variation rather than biological significance, thereby severely influencing overall fragment count. To minimize these effects, the viewpoint itself, the directly neighboring ‘undigested’ fragment and fragments 2 kb up- and downstream were excluded during the procedure (Table S4A). The fragment counts were then normalized per one million reads. Due to different orders of magnitude in the interactions, the data were analyzed differently depending upon which kind of analysis was performed (long-range interactions with DNA regions located in cis (4 Mb) or local interactions (200-300 kb). For long-range interactions, the identification of interacting regions was done using a running mean approach with window size 29 and thresholding using randomized data (FDR = 0.05). To increase the sensitivity of the method, the domains of very high fragment count covering Hox clusters (local saturated domains) were removed from the analysis by fitting the data to a power-law model similar to a previously published model (22). Fragment scores in a one Mb large neighborhood around the viewpoints were fitted to the model, with up- and downstream profiles treated independently to correct for potential asymmetries. Boundaries of the local saturated domains were defined from the fit values as the first position falling below background level, as estimated from a percentile value of all scores, excluding a region 250 kb up- and downstream from each viewpoint. For each Hox cluster, percentile values were chosen to best fit overall domain size by visual inspection (percentile values: HoxD: 99%; HoxC: 99.5%; HoxB: 97.5%; HoxA: 97.5%; boundaries of local saturated domains in Table S5). Local interactions were studied by first normalizing the value of each restriction fragment to the value of a random digested 4C-seq library, which consisted of BACs covering the respective Hox clusters. Quantitative fragment count was then normalized to the total fragment count in the region covered by the random 4C-seq template. Mutant 4C-sequencing patterns were additionally normalized for the amount of deleted fragments. Quantitative log2 ratios were calculated by dividing the quantitative fragment count between tissue samples. ChIP–sequencing ChIP was performed according to the Millipore protocol (http:// www.millipore. com), with three modifications: tissue samples were made single cell by collagenase treatment and applying a cell-strainer cap (BD Biosciences); cells were fixed for 5 minutes in a 2% formaldehyde solution at room temperature and were then lysed in a buffer containing 50 mM Tris HCl pH7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100 and 1x Complete protease inhibitors. For each ChIP assay, 10 μg of cross-linked chromatin was used. Antibodies used: anti Histone H3K27me3 (#17-622, Millipore); anti H3K4me3 (#17-614, Millipore. 6 to 10 nanograms of immune-precipitated DNA or sheared genomic DNA was prepared for Illumina sequencing according to the manufacturer’s instructions. Sequencing was done using 40 bp Single end reads on the Illumina Genome Analyzer system according to the manufacturer’s specifications. Reads were mapped to the mouse genome using bowtie version 0.12.5 (23) allowing 2 mismatches and up to 5 hits per read. Duplicated reads (reads mapping at exactly the same genomic position in the same orientation) were removed as probable PCR artifacts. Genome coverage densities were calculated for each strand separately, then shifted downstream by 70 bp, averaged and normalized by the total number of mapped reads (times 10-7). Enriched regions were detected using MACS version 1.4.0beta (Model-based Analysis of ChIP-seq, (24)) and selected for a p-value < 0.001 and an FDR < 0.05. Fig. S1. A 25 HoxD 30 Relative mRNA level Relative mRNA level 20 15 10 5 0 160 Hoxd13 Hoxd12 Hoxd11 Hoxd10 Hoxd9 Hoxd8 Hoxd4 Hoxd3 20 10 0 Hoxd1 HoxC Hoxd13 Hoxd12 Hoxd11 Hoxd10 Hoxd9 Hoxd8 Hoxd4 Hoxd3 Hoxd1 12 Relative mRNA level Relative mRNA level 120 80 40 0 NP NP Hoxc13 Hoxc12 Hoxc11 Hoxc10 Hoxc9 Hoxc8 8 4 0 Hoxc6 Hoxc5 Hoxc4 NP NP Hoxc13 Hoxc12 Hoxc11 Hoxc10 Hoxc9 Hoxc8 Hoxc6 Hoxc5 Hoxc4 8 HoxB 80 Relative mRNA level Relative mRNA level 6 60 40 20 0 120 Hoxb13 Hoxb13 Hoxb9 Hoxb8 Hoxb7 Hoxb6 Hoxb5 Hoxb4 Hoxb3 Hoxb2 Hoxb1 12 HoxA Forebrain Anterior trunk 9 Relative mRNA level Relative mRNA level 2 0 Hoxb9 Hoxb8 Hoxb7 Hoxb6 Hoxb5 Hoxb4 Hoxb3 Hoxb2 Hoxb1 90 60 30 0 4 NP Hoxa13 Hoxa11 Hoxa10 Hoxa9 Hoxa7 Hoxa6 Hoxa5 Hoxa4 Hoxa3 Hoxa2 Hoxa1 (based on Affymetrix data) 0 NP Hoxa13 Hoxa11 Hoxa10 Hoxa9 Hoxa7 Hoxa6 Hoxa5 Hoxa4 Hoxa3 Hoxa2 Hoxa1 (based on Affymetrix data) Anterior trunk Posterior trunk Inactive Value Anterior trunk < 50 Value Posterior trunk < 50 Being activated Value Anterior trunk > 50 Value Posterior trunk > 2x Anterior trunk Value Posterior trunk > 50 Value Anterior trunk < 50 Active Value Anterior trunk > 50 Value Posterior trunk < 2x Anterior trunk Value Posterior trunk > 50 Value Anterior trunk > 50 inactive 3 C Activity state of Hox-genes B Decision scheme for activity state Activity state: Posterior trunk 6 being activated Forebrain Anterior trunk Posterior trunk d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Forebrain Anterior trunk Posterior trunk c13 c12 c11 c10 c9 c8 c6 c5 c4 HoxC Forebrain Anterior trunk Posterior trunk b13 b9 b7 b6 b5 b4 b3 b2 b1 HoxB active HoxA Forebrain Anterior trunk Posterior trunk a1 a2 a3 a4 a5 a6 a7 a9 a11 a13 Relative mRNA levels of Hox genes in embryonic tissues used in this study. A. Affymetrix expression array values for Hox genes, normalized to values in forebrain (left) and anterior trunk (right). Error-bars represent standard deviations from two technical replicates. NP: not present on the expression array. B. Decision scheme for the determination of activity states of Hox genes in tissue samples. Schematic representation of activity states is illustrated below. C. Transcriptional activity of Hox genes in the various clusters in the different tissue samples. Fig. S2. Multiplex 4C-seq (Multiplex Circular Chromosome Conformation Capture - sequencing) Preparation of 4C library (circular 3C library) NlaIII digestion of cross-linked DNA Dilution Ligation Reversal of cross-links DpnII digestion religated DNA Circularization (second ligation) Preparation of PCR-amplified 4C-sequencing material PCR amplification (with primers containing Illumina adapters) Mapping of Illumina (Solexa) reads Multiplex Illumina sequencing (76 bp reads) De-multiplexing: separation based on PCR primer sequence Removal of PCR primer sequence Mapping of reads NlaIII NlaIII NlaIII NlaIII Visualization of interacting fragments and regions 1 2 3 4 Removal of noninformative reads NlaIII DpnII NlaIII NlaIII NlaIII NlaIII DpnII NlaIII DpnII NlaIII NlaIII NlaIII NlaIII DpnII DpnII NlaIII Non-informative reads: 1. repeat sequences 2. too short NlaIII fragment 3. absence of DpnII site (secondary cutter) in NlaIII fragment 4. DpnII site too close to NlaIII site :2 Translation to interacting restriction fragments DpnII NlaIII Smoothing of data and identification of interacting regions Outline of the Multiplex 4C-seq procedure and data analysis. Running mean algorithm Window size: 29 informative fragments FDR: 0.05 Fig. S3 HoxD cluster Hoxd11 Hoxd13 Hoxd9 935 bp 1985 bp Hoxd(i4-8) 832 bp 1176 bp Hoxd4 Hoxd3 1237 bp 1169 bp Hoxd1 1149 bp HoxC cluster Hoxc13 Hoxc9 1756 bp HoxB cluster Hoxc4 2685 bp Hoxb13 Hoxb(i9-13) 719 bp 653 bp 1191 bp Hoxb9 917 bp Hoxb4 1628 bp HoxA cluster Hoxa13 Hoxa9 Hoxa4 845 bp 1530 bp Exon Intron Other Hoxgene 982 bp 5 kb Location of the NlaIII restriction sites (vertical black lines) around the selected viewpoints. Restriction fragments used as viewpoints are depicted by red boxes below each region, with arrowheads indicating the orientation of the inverse forward primer used for amplification. The lengths of the viewpoints are indicated. Fig. S4 A B Anterior trunk Hoxd13 Hoxd9 1 2 1 2 Viewpoint Replicate Hoxd4 1 2 4200 Hoxd13 Replicate 1 0 Interacting regions Common interacting regions 4200 1000 bp Hoxd13 Replicate 2 * 500 bp 0 Interacting regions 300 bp 4500 * Hoxd9 Replicate 1 * 0 100 bp Interacting regions Common interacting regions 4500 C Hoxd13 Local saturated domain: Start Replicate 1 Replicate 2 74,392,704 74,356,339 Hoxd9 Local saturated domain: Start Replicate 1 Replicate 2 74,594,185 74,616,294 Start Replicate 1 Replicate 2 0 Interacting regions End 74,459,555 74,493,239 Hoxd4 Local saturated domain: Hoxd9 Replicate 2 End 2500 74,590,305 74,563,341 Hoxd4 Replicate 1 End 74,509,505 74,489,559 74,633,434 74,640,152 0 Interacting regions D Hoxd13 Replicate 1 2,324,145 bp 2,196,827 bp Common interacting regions 2500 Replicate 2 2,451,626 bp Hoxd4 Replicate 2 Hoxd9 Replicate 1 2,496,164 bp 1,742,116 bp Replicate 2 1,771,412 bp 1,614,333 bp Replicate 2 1,679,978 bp 0 Interacting regions Hoxd4 Replicate 1 1,808,591 bp HoxD E 42k 75.0 Chromosomal Position (Mb) 55k Hoxd4 Replicate 1 0 0 8 8 Ratio Rep. 1 / Rep. 2 (log2) 0 0 8 Ratio Rep. 1 / Rep. 2 (log2) 0 0 -8 -8 -8 42k 55k 52k Hoxd4 Replicate 2 Hoxd9 Replicate 2 Hoxd13 Replicate 2 Chr 2 0 0 0 HoxD Evx2 d13 d11 d9 d4 d3 d1 74.5 74.6 Chromosomal Position (Mb) 76.0 52k Hoxd9 Replicate 1 Hoxd13 Replicate 1 Ratio Rep. 1 / Rep. 2 (log2) 74.0 73.0 Chr 2 HoxD Chr 2 Evx2 d13 d11 d9 d4 d3 d1 74.5 74.6 Chromosomal Position (Mb) HoxD Chr 2 Evx2 d13 d11 d9 d4 d3 d1 74.5 74.6 Chromosomal Position (Mb) Reproducibility of multiplex 4C-seq experiments. A. Inverse PCR amplification patterns visualized by gel electrophoresis of two independent experimental replicates showing the general reproducibility between the 4C-sequencing libraries. Results for three inverse PCR primer sets are given, with the predicted size of the PCR product from undigested fragments indicated by asterisks. B. Running-mean 4C-seq interaction patterns of three viewpoints in anterior cells for two independent samples, in a 4 Mb large genomic region surrounding the HoxD cluster. Significant interactions are indicated below each pattern (in red, with local saturated regions around the viewpoint depicted in black) and the interacting regions shared between the two replicate samples are shown in between (purple). Genomic coordinates, location of the HoxD cluster (red) and other transcriptional units (black) are depicted below. Viewpoints are indicated with arrowheads. C. Coordinates of local saturated domains of three viewpoints for two independent samples, as determined by fitting the data to a power-law model. D. Venn-diagram showing, for three viewpoints, the large overlap in interacting regions between the two independent samples within the 4 Mb large region surrounding the HoxD cluster. E. Quantitative local 4C-seq interactions patterns of three viewpoints for two independent samples in anterior trunk cells. Genomic coordinates, location of Hox genes (red) and other transcripts (black) are depicted below each panel. Viewpoints are indicated with arrowheads and excluded regions around these viewpoints are indicated with the light grey vertical boxes. Fig. S5 Fraction of mappable reads A 100% 100% 80% 80% 60% 60% 40% 40% 20% 20% 0% Fb AT PT Hoxd13 Fb AT PT Hoxd11 Fb AT PT Hoxd9 Fb AT PT Hoxd(i4-8) Fb AT PT Hoxd4 100% 100% 80% 80% Fb AT PT Hoxd3 Fb AT PT Hoxd1 0% Fb AT PT Hoxc13 Fb AT PT Hoxc9 Fb AT PT Hoxc4 100% 80% Mappable reads (including repeats) Fraction of mappable reads 60% 60% 60% 40% 40% 20% 20% 0% 0% 40% Discarded reads (unmappable, undigested, self-ligated) 20% 0% Fb: Forebrain Fb AT PT Hoxb13 Fb AT Hoxb(i9-13) Fb AT PT Hoxb9 Fb AT PT Hoxb4 Fb AT PT Hoxa13 Fb AT PT Hoxa9 AT: Anterior trunk Fb AT PT Hoxa4 PT: Posterior trunk B NlaIII - DpnII fragment length bias 8k 6k Hoxd13 inverse primers 10k Hoxd9 inverse primers Hoxd4 inverse primers 8k 6k 4k Read number Read number Read number 6k 4k 2k 2k 0 2k 0 500 1000 1500 2000 0 0 Fragment length (bp) 6k 500 1000 1500 2000 10k ρ = 0.89 10k ρ = 0.87 2k 4k 6k 8k 6k 4k 2k 0 500 1000 1500 2000 ρ = 0.80 8k Hoxd4 read number Hoxd4 read number Hoxd9 read number 2k Hoxd13 read number 0 Fragment length (bp) 8k 0 0 Fragment length (bp) 4k 0 4k 0 2k 4k Hoxd13 read number 6k 8k 6k 4k 2k 0 0 2k 4k 6k Hoxd9 read number 4C-seq quality control. A. Fraction of reads that can be mapped for each viewpoint and tissue sample. The numbers of reads are provided in Table S4B. B. Fragment length bias in a random template with equimolar presence of ligated fragments. Top: normalized numbers of sequence reads for three random 4C–seq BAC libraries are sorted, based on their predicted size after inverse PCR, consisting of the length of the NlaIII-DpnII fragment and the genomic sequences of the inverse primers. The numbers of sequence reads are biased depending upon the fragment length, with optimal results obtained when fragments of approximately 150 bp are used. Bottom: comparison of sequence read numbers for individual fragments amplified by different primer sets. A strong correlation is observed between datasets derived from different primer sets, indicating that the normalized sequence read numbers are largely independent from the set of primers used. Fig. S6 Hoxd13 4200 Forebrain Interacting regions 0 4200 Anterior trunk Interacting regions 0 4200 Posterior trunk 0 Interacting regions HoxD Chr 2 73.0 74.0 73.0 74.0 73.0 74.0 Chromosomal Position (Mb) 75.0 76.0 75.0 76.0 75.0 76.0 Hoxd9 4500 Forebrain Interacting regions 0 4500 Anterior trunk Interacting regions 0 4500 Posterior trunk 0 Interacting regions HoxD Chr 2 Chromosomal Position (Mb) Hoxd4 2500 Forebrain Interacting regions 0 2500 Anterior trunk Interacting regions 0 2500 Posterior trunk Interacting regions 0 HoxD Chr 2 Chromosomal Position (Mb) Hoxc13 4600 Forebrain Interacting regions 0 4600 Anterior trunk Interacting regions 0 4600 Posterior trunk 0 Interacting regions HoxC - telomere 101.0 Chr 15 102.0 103.0 Chromosomal Position (Mb) Hoxc9 3200 Forebrain Interacting regions 0 3200 Anterior trunk Interacting regions 0 3200 Posterior trunk 0 Interacting regions HoxC - telomere 101.0 Chr 15 102.0 103.0 Chromosomal Position (Mb) Hoxc4 2400 Forebrain Interacting regions 0 2400 Anterior trunk Interacting regions 0 2400 Posterior trunk Interacting regions 0 HoxC Chr 15 - telomere 101.0 102.0 103.0 Chromosomal Position (Mb) Hoxb13 1600 Forebrain Interacting regions 0 1600 Anterior trunk Interacting regions 0 1600 Posterior trunk 0 Interacting regions HoxB Chr 11 95.0 96.0 Chromosomal Position (Mb) 97.0 98.0 95.0 96.0 Chromosomal Position (Mb) 97.0 98.0 95.0 96.0 Chromosomal Position (Mb) 97.0 98.0 Hoxb9 2500 Forebrain Interacting regions 0 2500 Anterior trunk Interacting regions 0 2500 Posterior trunk 0 Interacting regions HoxB Chr 11 Hoxb4 4600 Forebrain Interacting regions 0 4600 Anterior trunk Interacting regions 0 4600 Posterior trunk Interacting regions 0 HoxB Chr 11 Hoxa13 3100 Forebrain Interacting regions 0 3100 Anterior trunk Interacting regions 0 3100 Posterior trunk 0 Interacting regions HoxA Chr 6 51.0 52.0 Chromosomal Position (Mb) 53.0 54.0 51.0 52.0 Chromosomal Position (Mb) 53.0 54.0 51.0 52.0 Chromosomal Position (Mb) 53.0 54.0 Hoxa9 3700 Forebrain Interacting regions 0 3700 Anterior trunk Interacting regions 0 3700 Posterior trunk 0 Interacting regions HoxA Chr 6 Hoxa4 2600 Forebrain Interacting regions 0 2600 Anterior trunk Interacting regions 0 2600 Posterior trunk Interacting regions 0 HoxA Chr 6 Long-range contacts of Hox genes with DNA regions located in cis are primarily observed in the surrounding gene-deserts, rather than with annotated transcription units. Runningmean 4C-seq interaction patterns in 4 Mb genomic regions surrounding the Hox clusters, in those tissue samples used in this study. Significant interactions are indicated below each pattern, with local saturated regions around the viewpoint depicted in black. Genomic coordinates, location of Hox clusters (red) and other transcriptional units (black) are indicated below each panel. Viewpoints are indicated with arrowheads. Fig. S7 42k Hoxd13 random corrected 0 12k Hoxd13 raw data 0 38k Hoxd11 random corrected 0 10k Hoxd11 raw data 0 55k Hoxd9 random corrected 0 9k Hoxd9 raw data 0 48k Hoxd(i4-8) random corrected 0 7k Hoxd(i4-8) raw data 0 Random Coverage RP23-331E7 30 H3K27me3 0 30 H3K4me3 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 52k Hoxd4 random corrected 0 9k Hoxd4 raw data 0 40k Hoxd3 random corrected 0 9k Hoxd3 raw data 0 50k Hoxd1 random corrected 0 11k Hoxd1 raw data 0 Random Coverage RP23-331E7 30 H3K27me3 0 30 H3K4me3 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 The inactive HoxD cluster forms a discrete 3D domain. Quantitative local 4C-seq association patterns (corrected, top; uncorrected, bottom) in forebrain (no Hoxd gene expressed), as seen from different viewpoints. Viewpoints are indicated with arrowheads and excluded regions around viewpoints are indicated with vertical light grey boxes. H3K27me3 and H3K4me3 ChIP-seq patterns are depicted below the 4C-seq data. Random 4C-seq template coverage, genomic coordinates, location of Hoxd genes (red) and other transcripts (black) are depicted below each panel. Fig. S8 45k Hoxc13 random corrected 0 8k Hoxc13 raw data 0 30k Hoxc9 random corrected 0 8k Hoxc9 raw data 0 40k Hoxc4 random corrected 0 9k Hoxc4 raw data 0 Random Coverage RP23-430C12 30 H3K27me3 0 30 H3K4me3 0 c13 c12 c11 c10 c9 c8 c6 c5 c4 HoxC Chr 15 102.8 Chromosomal Position (Mb) 102.9 38k Hoxb13 random corrected 0 8k Hoxb13 raw data 0 45k Hoxb9 random corrected 0 9k Hoxb9 raw data 0 36k Hoxb4 random corrected 0 12k Hoxb4 raw data 0 Random Coverage RP23-381I12 RP23-196F5 30 H3K27me3 0 30 H3K4me3 0 b13 b9 b8 b7 b6 b5 b4 b3 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 b2 b1 45k Hoxa13 random corrected 0 11k Hoxa13 raw data 0 45k Hoxa9 random corrected 0 8k Hoxa9 raw data 0 40k Hoxa4 random corrected 0 8k Hoxa4 raw data 0 Random Coverage RP24-298M24 30 H3K27me3 0 30 H3K4me3 0 HoxA Chr 6 a1 52.1 a2 a3 a4 a5 a6 a7 a9 Chromosomal Position (Mb) a10 a11 a13 52.2 Inactive Hox clusters form discrete 3D domains. Quantitative local 4C-seq association patterns (corrected, top; uncorrected, bottom) in forebrain cells, using different viewpoints in the HoxA, B and C clusters. Viewpoints are indicated with arrowheads, and excluded regions around the viewpoints are indicated with vertical light grey boxes. H3K27me3 and H3K4me3 ChIP-seq patterns are depicted below the 4C-seq data. Random 4C-seq template coverage, genomic coordinates, location of Hox genes (red) and other transcripts (black) are depicted below each panel. Fig. S9 Forebrain Anterior trunk 1.00 HoxD 3 d1 0.25 0.00 d13 d11 d9 d4 d3 d1 74.5 74.6 Chromosomal Position (Mb) 1.00 HoxC 0.00 Gene activity c13 c12 c11 c10 c9 c8 c6 c4 74.6 Chromosomal Position (Mb) HoxC c1 Ho 3 xc 4 0.50 0.25 c13 c12 c11 c10 c9 c8 c6 c4 HoxC 102.8 Chromosomal Position (Mb) 102.9 102.8 Chromosomal Position (Mb) Chr 15 1.00 HoxB 102.9 HoxB 0.75 0.00 Gene activity 4 Ho 13 Hoxb 0.25 Hoxb13 0.50 Hoxb xb4 0.50 Cummulative signal 0.75 0.25 0.00 b13 b9 b7 b5 b4 b3 b2 b1 HoxB Gene activity b13 b9 b7 b5 b4 b3 b2 b1 HoxB 96.0 96.1 96.2 Chromosomal Position (Mb) Chr 11 1.00 HoxA 96.0 96.1 96.2 Chromosomal Position (Mb) HoxA xa4 0.75 0.50 13 xa Ho 0.25 0.00 Gene activity Ho Cummulative signal Ho xa 4 0.75 Cummulative signal d1 0.00 Chr 15 Cummulative signal 74.5 Gene activity HoxC Chr 6 d4 d3 ox Cummulative signal 3 c1 ox H Cummulative signal 4 xc Ho 0.25 HoxA d9 0.75 0.50 1.00 d13 d11 Chr 2 0.75 Chr 11 0.25 HoxD Chr 2 1.00 0.50 Gene activity HoxD 1.00 Hoxd4 H Hoxd 13 d4 ox 0.50 0.00 Gene activity H3K27me3 H3K4me3 0.75 x Ho HoxD H Cummulative signal 0.75 Cummulative signal 1.00 0.50 0.25 a13 Hox 0.00 Gene activity a1 52.1 a3 a4 a6 a7 a9 a11 a13 52.2 Chromosomal Position (Mb) HoxA Chr 6 a1 52.1 a3 a4 a6 a7 a9 a11 a13 52.2 Chromosomal Position (Mb) Patterns of local 3D organization coincide with domains of shared chromatin marks. Cumulative local 4C-seq association patterns (green for forebrain, red for anterior trunk) and distribution of chromatin marks (purple is H3K27me3; blue is H3K4me3) in forebrain and anterior trunk cells. The expression status of a given gene is depicted below each pattern (in blue, active; in red, inactive). In forebrain, 4C-seq association patterns share similar distributions with the H3K27me3 domains, most of the variation being introduced due to the location of viewpoints. In anterior trunk, the 3D organization around the inactive genes (e.g. group 13 genes) still share similar distributions with the H3K27me3 domains, yet the active genes (e.g. group 4 genes) and to a lesser extent those genes that are shifting from an inactive to an active status (e.g. group 9 genes) adopt a 3D conformation, which now resembles the H3K4me3 domain. Genomic coordinates, location of Hox genes (red) and other transcripts (black) are depicted below each panel. Fig. S10 Hoxd13 42k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 42k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 42k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd11 38k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 38k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 38k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd9 55k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 55k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 55k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd(i4-8) 48k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 48k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 48k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd4 52k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 52k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 52k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd3 40k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 40k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 40k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd1 50k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 50k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 50k Posterior trunk (random corrected) 0 Gene activity Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 HoxD Chr 2 74.5 Chromosomal Position (Mb) 74.6 Local association dynamics of Hoxd genes. Quantitative local 4C-seq interaction patterns of different Hoxd genes, in the tissues used in this study. Quantitative ratios of associations between tissues are indicated in between patterns. Viewpoints are indicated with arrowheads and excluded regions around the viewpoints are indicated with vertical light grey boxes. H3K27me3 and H3K4me3 signals (in both forebrain and anterior trunk) and the collinear expression status of Hox genes (blue, active; red, inactive) are depicted below the patterns. Genomic coordinates, location of Hoxd genes (red) and other transcripts (black) are indicated. Fig. S11 Hoxc13 45k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 45k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 45k Posterior trunk (random corrected) 0 Gene activity c13 c12 c11 c10 c9 c8 c6 c5 c4 HoxC Chr 15 102.8 Chromosomal Position (Mb) 102.9 Hoxc9 30k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 30k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 30k Posterior trunk (random corrected) 0 Gene activity c13 c12 c11 c10 c9 c8 c6 c5 c4 HoxC Chr 15 102.8 Chromosomal Position (Mb) 102.9 Hoxc4 40k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 40k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 40k Posterior trunk (random corrected) 0 Gene activity c13 c12 c11 c10 c9 c8 c6 c5 c4 HoxC Chr 15 102.8 Chromosomal Position (Mb) 102.9 Hoxb13 38k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 38k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 38k Posterior trunk (random corrected) 0 Gene activity b13 b9 b8 b7 b6 b5 b4 b3 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 b2 b1 Hoxb9 45k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 45k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 45k Posterior trunk (random corrected) 0 Gene activity b13 b9 b8 b7 b6 b5 b4 b3 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 b2 b1 Hoxb4 36k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 36k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 36k Posterior trunk (random corrected) 0 Gene activity b13 b9 b8 b7 b6 b5 b4 b3 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 b2 b1 Hoxa13 45k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 45k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 45k Posterior trunk (random corrected) 0 Gene activity HoxA Chr 6 a1 52.1 a2 a3 a4 a5 a6 a7 a9 Chromosomal Position (Mb) a10 a11 a13 52.2 Hoxa9 45k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 45k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 45k Posterior trunk (random corrected) 0 Gene activity HoxA Chr 6 a1 52.1 a2 a3 a4 a5 a6 a7 a9 Chromosomal Position (Mb) a10 a11 a13 52.2 Hoxa4 40k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 8 Ratio Forebrain / 0 Anterior trunk (log2) -8 40k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 8 Ratio Anterior trunk / Posterior trunk 0 (log2) -8 40k Posterior trunk (random corrected) 0 Gene activity HoxA Chr 6 a1 52.1 a2 a3 a4 a5 a6 a7 a9 Chromosomal Position (Mb) a10 a11 a13 52.2 Local association dynamics of Hox genes from the HoxA, B and C clusters. Quantitative ratios of associations between the tissues are indicated in between patterns. Viewpoints are indicated with arrowheads and excluded regions around the viewpoints are indicated with vertical light grey boxes. H3K27me3 and H3K4me3 signals (forebrain and anterior trunk) and the collinear expression status of Hox genes (blue, active; red) are depicted below the patterns. Genomic coordinates, location of Hox genes (red) and other transcripts (black) are indicated. Fig. S12 Hoxb13 38k Forebrain (random corrected) 0 Hoxb(i9-13) 50k Forebrain (random corrected) 0 Hoxb9 45k Forebrain (random corrected) 0 Gene activity 30 H3K27me3 Forebrain 0 30 H3K4me3 Forebrain 0 b13 b9 b8 b7 b6 b5 b4 b3 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 b2 b1 Hoxb13 38k Anterior trunk (random corrected) 0 Hoxb(i9-13) 50k Anterior trunk (random corrected) 0 Hoxb9 45k Anterior trunk (random corrected) 0 Gene activity 30 H3K27me3 Anterior trunk 0 30 H3K4me3 Anterior trunk 0 b13 b9 b8 b7 b6 b5 b4 b3 b2 b1 HoxB Chr 11 96.0 96.1 Chromosomal Position (Mb) 96.2 The large intergenic region within the HoxB cluster is excluded from the inactive local 3D domain. Quantitative local 4C-seq association patterns, as observed from viewpoints located in the HoxB cluster (Hoxb13 and Hoxb9) and from within the intergenic region between Hoxb13 and Hoxb9 (Hoxb(i9-13)), in forebrain and anterior trunk cells. The intergenic region, which displays very low amounts of H3K27me3 and H3K4me3 signal, does not associate with the surrounding sequences, indicating it’s looping out of the HoxB 3D domain. Viewpoints are indicated with arrowheads and the excluded region around the viewpoint is shown with vertical light grey boxes. H3K27me3 and H3K4me3 signals and the collinear expression status of a given gene (blue, active; red, inactive) are depicted below each pattern. Genomic coordinates, location of Hoxb genes (red) and of other transcripts (black) are indicated. Fig. S13 A 13k 2600 0 2400 0 12k 0 1800 0 9k 0 30 0 30 0 30 0 30 inactive domain Dlx1 raw data active domain Hoxd13 raw data Hoxd4 raw data H3K27me3 H3K4me3 0 0 Dlx1 Dlx2 d13 d11 d9 d4 d1 HoxD Dlx1 1449470_at Hoxd13 1440626_at Hoxd4 1450209_at 0 89% 11% 0 91% 9% 0 Hoxd4 active domain max inactive domain Hoxd13 74.6 cummulative raw signal max active domain 250 Dlx1 inactive domain cummulative raw signal mRNA level (Affymetrix) max Chromosomal Position (Mb) cummulative raw signal C 500 0 74.5 active domain B 71.4 Chromosomal Position (Mb) inactive domain 71.3 Chr 2 16% 84% Ultra-long range associations between the HoxD cluster and the Dlx1 locus matches the presence of H3K27me3 domains. A. Quantitative local 4C-seq interaction patterns in anterior trunk, between the Dlx1 gene and Hoxd genes, which are separated by ca. 3 Mb. The inactive (see B) Dlx1 locus is organized in a 3D compartment, which again coincides with the extent of its coverage by H3K27me3 marks (left panels). Infrequent, yet significant, interactions between the Dlx1 locus and the HoxD cluster occur (right panels). However, these interactions are observed only between the H3K27me3 domains, both when Hoxd13 and Dlx1 are used as viewpoints. Thus, Dlx1 does not contact the active part of the HoxD cluster and, likewise, interactions are lost when Hoxd4 is used as a viewpoint, showing the high selectivity of these contacts. B. Affymetrix expression array values. Error-bars represent standard deviations from two technical replicates. C. Total cumulative signal from long-range (Dlx1) or local (Hoxd13 and Hoxd4) viewpoints located inside the inactive or active domain at the HoxD cluster, in anterior trunk cells. Long-range 3D interaction behavior of the silent Dlx1 gene is similar to the local interaction behavior of the silent Hoxd13 gene. Fig. S14 Wildtype Del(8-10) Del(i8-10) d11 d11 d11 Del (8-10) Evx2 HoxD cen d13 d11 74.5 d9 d4 d3 d1 74.6 Chromosomal Position (Mb) Evx2 tel cen d13 d11 74.5 Del(i8-10) d4 d3 d1 74.6 Chromosomal Position (Mb) Evx2 tel cen d13 d11 74.5 d4 d3 d1 74.6 Chromosomal Position (Mb) tel Hoxd11 embryonic expression patterns in wildtype (left) and the two mutant stocks used in this study. In the Del(8-10) mutant specimen (middle) Hoxd11 is expressed as in wildtype (domain in grey), i.e. outside the sample dissected as ‘anterior trunk’ (delimited by a red dashed line). In contrast, in the Del(i8-10) mutant embryo (right), Hoxd11 is expressed ectopically up to a very anterior level. As a consequence, ‘anterior trunk’ cells dissected from this mutant stock contain cells expressing Hoxd11, unlike in the Del(8-10) mutant sample. The positions and extents of the deletions are shown below. Expression data are taken from (17). Fig. S15 A Hoxa4 B Hoxa4 24k Del(i8-10) Forebrain (random corrected) 32k Del(i8-10) Anterior trunk (random corrected) 0 8 Ratio Del(i8-10) / WT (log2) 0 8 Ratio Del(i8-10) / WT (log2) 0 -8 24k 0 -8 32k WT Forebrain (random corrected) WT Anterior trunk (random corrected) 0 8 0 8 Ratio WT / Del(8-10) (log2) Ratio WT / Del(8-10) (log2) 0 -8 24k -8 32k Del(8-10) Forebrain (random corrected) Del(8-10) Anterior trunk (random corrected) 0 0 a1 a2 Chr 6 0 52.1 a3 a4 a6 a7 a9 Chromosomal Position (Mb) a11 52.2 a13 a1 a2 Chr 6 52.1 a3 a4 a6 a7 a9 Chromosomal Position (Mb) a11 a13 52.2 Reproducibility of multiplex 4C-seq experiments on mutant mouse material. Quantitative local 4C-seq association patterns of Hoxa4 in both forebrain (A) and anterior trunk (B) cells. Quantitative ratios of interactions between mutants and wild-type controls are indicated in between the profiles. The globally similar 3D organization of the HoxA cluster in both HoxD mutant and control tissues is used as a quality control. Hoxa4 viewpoints are indicated with arrowhead and excluded regions around the viewpoints are indicated with vertical light grey boxes. Genomic coordinates, location of Hoxa genes (red) and of other transcripts (black) are depicted below each panel. Fig. S16 Hoxd11 48k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(i8-10) / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio Del(i8-10) / WT (log2) 0 -8 48k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 WT / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio WT / Del(8-10) (log2) 0 -8 48k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(8-10) / Del(1-13)D11 Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd4 56k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(i8-10) / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio Del(i8-10) / WT (log2) 0 -8 56k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 WT / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio WT / Del(8-10) (log2) 0 -8 56k Forebrain (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(8-10) / Del(1-13)D11 Chr 2 74.5 Chromosomal Position (Mb) 74.6 The borders of the 3D domain formed by the inactive HoxD cluster in brain cells remain unchanged whenever deletions are introduced within the gene cluster. Quantitative local 4C-seq interactions patterns of Hoxd genes in forebrain cells of deletion mutants and wildtype controls animals. Quantitative ratios of interactions between mutants and controls are indicated in between patterns. The viewpoints are indicated with arrowheads and the excluded regions around the viewpoints are indicated with vertical light grey boxes. Below each pattern, the allelic structure, genomic coordinates, locations of Hoxd genes (red) and of other transcripts (black) are indicated. Fig. S17 Hoxd11 45k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(i8-10) / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio Del(i8-10) / WT (log2) 0 -8 45k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 WT / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio WT / Del(8-10) (log2) 0 -8 45k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(8-10) / Del(1-13)D11 Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd4 65k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(i8-10) / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio Del(i8-10) / WT (log2) 0 -8 65k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d10 d9 d8 d4 d3 d1 WT / Del(1-13)D11 74.5 Chr 2 74.6 Chromosomal Position (Mb) 8 Ratio WT / Del(8-10) (log2) 0 -8 65k Anterior trunk (random corrected) 0 Evx2 d13 d12 d11 d4 d3 d1 Del(8-10) / Del(1-13)D11 Chr 2 74.5 Chromosomal Position (Mb) 74.6 Hoxd11 ectopic expression in anterior trunk cells of Del(i8-10) mutant embryos is associated with increased associations of this locus with the telomeric (active) parts of the HoxD cluster. Quantitative local 4C-seq interactions patterns of Hoxd genes in anterior trunk cells of both mutant and controls embryos. Quantitative ratios of interactions between mutants and controls are indicated in between the profiles. The viewpoints are indicated with arrowheads and the excluded regions around the viewpoints are indicated with vertical light grey boxes. Below each pattern, the allelic structure, genomic coordinates, locations of Hoxd genes (red) and of other transcripts (black) are indicated. Table S1. Top 20 up-regulated transcripts after a pair-wise comparison between the tissues sampled in this study. Affymetrix expression array values were obtained from two technical replicates on a subset of the cells used for 4C-seq experiments. Genes and transcripts located within the Hox clusters are indicated in red. Anterior Trunk versus Forebrain Gene / transcript ENSEMBL ID Affymetrix probe Hoxc8 Hoxa9 Hoxb3 Hoxc5 Hoxb7 / b8 C1qtnf3 Hoxc10 Hoxc4 Hoxa5 AK007148 Actc1 Myl4 Hoxb9 Myh3 Myl1 AI448005 Dmrt2 Aldh1a2 AK002860 Hoxb2 ENSMUSG00000001657 ENSMUSG00000038227 ENSMUSG00000048763 ENSMUSG00000022485 ENSMUSG00000056648 ENSMUSG00000058914 ENSMUSG00000022484 ENSMUSG00000075394 ENSMUSG00000038253 ENSMUSG00000052371 ENSMUSG00000068614 ENSMUSG00000061086 ENSMUSG00000020875 ENSMUSG00000020908 ENSMUSG00000061816 ENSMUSG00000048138 ENSMUSG00000013584 ENSMUSG00000085645 ENSMUSG00000075588 1452412_at 1455626_at 1456229_at 1439885_at 1452493_s_at 1422606_at 1439798_at 1422870_at 1448926_at 1460056_at 1415927_at 1422580_at 1452317_at 1427115_at 1452651_a_at 1435673_at 1426867_at 1422789_at 1447886_at 1449397_at Posterior Trunk versus Anterior Trunk Gene / transcript ENSEMBL ID Affymetrix probe Hoxd13 Hoxd10 Hoxd11 Hoxc13 Hoxa11 AK012157 Hoxa10 T Hoxc10 Hoxb13 Hoxa11as Olig1 Olig2 Tbx4 Ifitm1 Tbx6 Tmem30b Hoxd12 Fgf17 Sall4 ENSMUSG00000001819 ENSMUSG00000050368 ENSMUSG00000042499 ENSMUSG00000001655 ENSMUSG00000038210 ENSMUSG00000000938 ENSMUSG00000062327 ENSMUSG00000022484 ENSMUSG00000049604 ENSMUSG00000046160 ENSMUSG00000039830 ENSMUSG00000000094 ENSMUSG00000025491 ENSMUSG00000030699 ENSMUSG00000034435 ENSMUSG00000001823 ENSMUSG00000022101 ENSMUSG00000027547 1440626_at 1418606_at 1450584_at 1425874_at 1420414_at 1435639_at 1431475_a_at 1419304_at 1439798_at 1419576_at 1452400_a_at 1416149_at 1416232_at 1456033_at 1424254_at 1449868_at 1433579_at 1450553_at 1421523_at 1424152_at Value Forebrain 20.3 24.7 25.6 26.2 28.3 10.5 15.4 59.0 45.1 20.4 154.8 38.1 74.7 46.9 66.2 19.7 35.2 59.4 173.5 75.1 Value Forebrain 38.6 40.7 27.9 47.0 50.8 21.0 27.8 39.0 15.4 38.5 26.1 204.1 352.1 37.1 373.4 40.1 334.4 28.7 383.9 1213.2 Value Anterior trunk 3269.7 2724.6 2235.6 2136.0 2224.9 796.1 823.8 3008.1 2266.4 875.2 5948.9 1278.3 2477.9 1504.9 2043.1 599.7 972.3 1572.3 4538.7 1948.2 Value Posterior trunk 658.9 3892.4 1492.9 371.0 844.9 361.1 5282.3 1153.9 1310.0 1191.8 3625.9 499.1 1396.0 478.1 683.0 478.6 953.5 1738.8 6084.5 1607.4 Anterior trunk / Fore-brain Value Anterior trunk 41.5 159.8 33.9 46.8 58.1 30.7 107.1 205.8 823.8 36.7 25.7 32.3 46.5 45.1 582.4 41.2 119.3 27.3 50.0 704.2 Value Posterior trunk 1269.8 3616.5 537.0 574.6 617.9 309.8 905.2 1645.8 5282.3 233.7 150.3 183.4 255.2 215.4 2503.1 176.9 508.1 98.6 180.2 2520.4 Posterior trunk / Anterior trunk 161.0 110.3 87.4 81.6 78.5 75.9 53.5 51.0 50.2 43.0 38.4 33.5 33.2 32.1 30.9 30.5 27.6 26.5 26.2 25.9 30.6 22.6 15.8 12.3 10.6 10.1 8.5 8.0 6.4 6.4 5.9 5.7 5.5 4.8 4.3 4.3 4.3 3.6 3.6 3.6 Table S2. mRNA levels of Hox genes in those tissues sampled in this study. Affymetrix expression array values were obtained from two technical replicates on a subset of the cells used for 4C-seq experiments. Gene ENSEMBL ID Affymetrix probe Hoxd13 Hoxd12 Hoxd11 Hoxd10 Hoxd9 Hoxd8 Hoxd4 Hoxd3 Hoxd1 Hoxc13 Hoxc12 Hoxc11 Hoxc10 Hoxc9 Hoxc8 Hoxc6 Hoxc5 Hoxc4 Hoxb13 Hoxb9 Hoxb7 / b8 Hoxb6 Hoxb5 Hoxb4 Hoxb3 Hoxb2 Hoxb1 Hoxa13 Hoxa11 Hoxa10 Hoxa9 Hoxa7 Hoxa6 Hoxa5 Hoxa4 Hoxa3 Hoxa2 Hoxa1 ENSMUSG00000001819 ENSMUSG00000001823 ENSMUSG00000042499 ENSMUSG00000050368 ENSMUSG00000043342 ENSMUSG00000027102 ENSMUSG00000001819 ENSMUSG00000001823 ENSMUSG00000042499 ENSMUSG00000001655 ENSMUSG00000050328 ENSMUSG00000001656 ENSMUSG00000022484 ENSMUSG00000036139 ENSMUSG00000001657 ENSMUSG00000001661 ENSMUSG00000022485 ENSMUSG00000075394 ENSMUSG00000049604 ENSMUSG00000020875 ENSMUSG00000056648 ENSMUSG00000000690 ENSMUSG00000038700 ENSMUSG00000038692 ENSMUSG00000048763 ENSMUSG00000075588 ENSMUSG00000018973 ENSMUSG00000038203 ENSMUSG00000038210 ENSMUSG00000000938 ENSMUSG00000038227 ENSMUSG00000038236 ENSMUSG00000043219 ENSMUSG00000038253 ENSMUSG00000000942 ENSMUSG00000079560 ENSMUSG00000014704 ENSMUSG00000029844 1440626_at 1450553_at 1450584_at 1418606_at 1419126_at 1431099_at 1450209_at 1421537_at 1420573_at 1425874_at Not present Not present 1439798_at 1449867_at 1452412_at 1427361_at 1439885_at 1422870_at 1419576_at 1452317_at 1452493_s_at 1451660_a_at 1418415_at 1460379_at 1456229_at 1449397_at 1453501_at 1422336_at 1420414_at 1431475_a_at 1455626_at 1449499_at Not present 1448926_at 1427354_at 1427433_s_at 1419602_at 1420565_at Value Forebrain Value Anterior Trunk 38.6 28.7 27.9 40.7 119.0 59.4 21.1 178.9 17.9 47.0 41.5 27.3 33.9 159.8 1012.3 978.5 403.8 968.8 388.3 46.8 Value Posterior Trunk 1269.8 98. 6 537.0 3616.5 2981.3 1589.2 451.8 890.7 524.7 574.6 15.4 205.3 20.3 85.7 26.2 59.0 38.5 74.7 28.3 97.5 25.3 71.1 25.6 75.1 17.7 42.6 50.8 27.8 24.7 223.6 823.8 1387.3 3269.7 1611.0 2136.0 3008.1 36.7 2477.9 2224.9 1561.2 654.6 681.9 2235.6 1948.2 294.4 43.1 58.1 107.1 2724.6 1353.0 5282.3 1259.3 658.9 607.0 371.0 1153.9 233.7 1396.0 845.0 1179.6 355.4 486.6 1492.9 1607.4 541.4 68.6 617.9 905.2 3892.4 521.3 45.1 16.4 26.0 21.9 29.7 2266.3 413.8 436.8 292.9 370.7 1310.0 163.0 310.8 228.3 545.8 Table S3. Fragment number and genome coverage of the 4C-seq library, with NlaIII used as a primary and DpnII as a secondary restriction enzymes. Primary restriction enzyme: Secondary restriction enzyme: Number of fragments All fragments Excluded due to restriction site configuration Excluded due to repeats Informative fragments NlaIII DpnII Average length 12,456,688 Fraction of total number (%) 100 % 203 bp / frag 2,532,070,302 bp Fraction of total genome (%)* 95 % 8,679,038 70 % 129 bp / frag 1,116,024,980 bp 42 % 1,391,135 2,386,515 11 % 19 % 360 bp / frag 382 bp / frag 500,736,390 bp 911,531,282 bp 19 % 34 % * Total genomic length considered: 2,654,911,517 bp Theoretical average resolution: 1112 bp / fragment Genomic coverage Table S4. 4C-seq quality control. A. Regions surrounding the viewpoints that have been excluded. The excluded regions consist of the viewpoint itself, the directly neighboring ‘undigested fragment’ and fragments located within 2 kb on both sides. Signals within these regions were highly enriched and showed considerable experimental variation rather than biological significance. The DNA fragments covered by using these criteria were excluded before normalization of the overall fragment count. B. The total reads, reads that can be mapped and reads that are excluded, are shown for different viewpoints and tissue samples. A. Excluded regions surrounding viewpoints Wildtype samples Viewpoint Hoxd13 Hoxd11 Hoxd9 Hoxd(i4-8) Hoxd4 Hoxd3 Hoxd1 Hoxc13 Hoxc9 Hoxc4 Hoxb13 Hoxb(i9-13) Hoxb9 Hoxb4 Hoxa13 Hoxa9 Hoxa4 Chromosome 2 2 2 2 2 2 2 15 15 15 11 11 11 11 6 6 6 Start End 74,501,237 74,521,560 74,534,116 74,551,067 74,558,887 74,572,778 74,597,926 102,752,381 102,810,363 102,864,639 96,054,982 96,076,073 96,133,441 96,176,849 52,210,042 52,171,265 52,136,882 74,508,317 74,526,558 74,539,344 74,556,034 74,564,566 74,578,858 74,603,162 102,758,254 102,817,195 102,869,848 96,059,808 96,080,742 96,138,987 96,182,606 52,215,742 52,176,379 52,141,946 Mutant samples Wildtype/Del(1-13)-D11 Viewpoint Hoxd11 Hoxd4 Hoxa4 Chromosome 2 2 2 6 Start End 74,521,560 74,601,162 74,558,887 52,136,882 74,526,558 74,604,549 74,564,566 52,141,946 Del(i8-10)/Del(1-13)-D11 Viewpoint Hoxd11 Hoxd4 Hoxa4 Chromosome 2 2 2 6 Start End 74,521,560 74,601,162 74,521,623 52,136,882 74,562,637 74,604,549 74,564,566 52,141,946 Del(8-10)/Del(1-13)-D11 Viewpoint Hoxd11 Hoxd4 Hoxa4 Chromosome 2 2 2 6 Start End 74,521,560 74,601,162 74,558,887 52,136,882 74,549,228 74,604,549 74,564,566 52,141,946 B. Quality of 4C-seq reads Wildtype samples HoxD cluster Viewpoint Tissue Hoxd13 Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Hoxd11 Hoxd9 Hoxd(i4-8) Hoxd4 Hoxd3 Hoxd1 HoxC cluster Viewpoint Tissue Hoxc13 Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Hoxc9 Hoxc4 HoxB cluster Viewpoint Tissue Hoxb13 Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Hoxb(i9-13) Hoxb9 Hoxb4 Total reads (million) 9.41 7.38 8.22 15.96 9.15 17.12 20.53 15.31 16.24 4.83 6.39 3.43 3.84 3.36 3.58 8.45 9.31 10.26 14.83 13.6 12.49 Total reads (million) 11.05 7.89 9.26 6.48 4.30 6.19 8.80 6.26 9.25 Total reads (million) 3.35 3.52 2.97 5.30 5.66 4.38 5.39 5.94 1.94 4.09 2.51 Mappable reads (million) 2.88 2.43 2.65 3.03 2.77 1.34 3.31 4.29 3.96 2.93 4.54 1.98 2.78 2.52 2.53 1.54 3.33 0.90 9.01 8.06 6.35 Mappable reads (million) 3.44 2.23 2.86 3.61 2.44 3.31 2.60 2.35 3.16 Mappable reads (million) 1.69 1.72 1.41 2.20 1.93 1.54 2.05 1.89 1.19 2.55 1.48 Excluded reads (million) 6.53 4.96 5.58 12.93 6.38 15.77 17.22 11.02 12.28 1.89 1.85 1.45 1.06 0.84 1.05 6.91 5.97 9.36 5.81 5.54 6.14 Excluded reads (million) 7.61 4.65 6.40 2.87 1.86 2.88 6.20 3.91 6.09 Excluded reads (million) 1.66 1.80 1.56 3.10 3.73 2.83 3.34 4.05 0.76 1.54 1.02 HoxA cluster Viewpoint Tissue Hoxa13 Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Hoxa9 Hoxa4 Mutant samples Wildtype/Del(1-13)-D11 Viewpoint Tissue Hoxd11 Forebrain Anterior trunk Forebrain Anterior trunk Forebrain Anterior trunk Hoxd4 Hoxa4 Del(i8-10)/Del(1-13)-D11 Viewpoint Tissue Hoxd11 Forebrain Anterior trunk Forebrain Anterior trunk Forebrain Anterior trunk Hoxd4 Hoxa4 Del(8-10)/Del(1-13)-D11 Viewpoint Tissue Hoxd11 Forebrain Anterior trunk Forebrain Anterior trunk Forebrain Anterior trunk Hoxd4 Hoxa4 Total reads (million) 2.84 3.45 3.07 6.36 6.61 8.09 4.29 4.07 3.60 Total reads (million) 3.70 3.97 3.78 4.18 5.93 6.38 Total reads (million) 3.96 4.67 4.26 5.12 4.81 7.16 Total reads (million) 4.82 5.02 4.99 3.63 5.95 6.01 Mappable reads (million) 1.40 1.56 1.41 3.59 3.78 4.21 2.81 2.77 2.53 Mappable reads (million) 2.63 2.78 3.04 3.13 0.91 5.53 Mappable reads (million) 2.63 3.41 3.41 3.91 3.94 6.21 Mappable reads (million) 2.69 2.01 3.96 2.55 5.08 5.10 Excluded reads (million) 1.44 1.89 1.66 2.77 2.83 3.89 1.48 1.30 1.07 Excluded reads (million) 1.06 1.19 0.75 1.05 5.01 0.85 Excluded reads (million) 1.33 1.26 0.85 1.20 0.87 0.95 Excluded reads (million) 2.13 3.02 1.03 1.08 0.87 0.91 Table S5. 4C-seq local saturated domains. Domains of very high fragment counts covering the Hox gene clusters that have been removed from the long-range interaction analysis, as determined by fitting the data to a power-law model. HoxD cluster Viewpoint Hoxd13 Hoxd9 Hoxd4 Tissue sample Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Chromosome chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 Start 74,392,412 74,392,704 74,393,976 74,461,835 74,459,555 74,463,386 74,478,036 74,509,505 74,507,949 End 74,600,877 74,594,185 74,566,497 74,602,854 74,590,305 74,614,449 74,612,146 74,633,434 74,607,136 Tissue sample Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Chromosome chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 Start 102,696,348 102,706,593 102,705,389 102,700,920 102,745,519 102,712,899 102,789,560 102,803,233 102,788,128 End 102,965,012 102,852,156 102,845,832 102,944,018 102,898,398 102,937,589 102,910,946 102,918,902 102,922,993 Tissue sample Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Chromosome chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 Start 96,045,784 96,035,991 96,042,044 96,060,722 96,080,379 96,089,022 95,978,849 96,079,580 96,074,474 End 96,075,371 96,084,596 96,071,005 96,230,022 96,250,175 96,200,492 96,270,670 96,290,340 96,282,206 Tissue sample Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Forebrain Anterior trunk Posterior trunk Chromosome chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 Start 52,187,651 52,177,945 52,186,582 52,120,081 52,117,390 52,081,511 52,092,252 52,066,140 52,083,291 End 52,232,566 52,243,494 52,235,158 52,218,782 52,206,173 52,232,382 52,211,219 52,214,026 52,203,455 HoxC cluster Viewpoint Hoxc13 Hoxc9 Hoxc4 HoxB cluster Viewpoint Hoxb13 Hoxb9 Hoxb4 HoxA cluster Viewpoint Hoxa13 Hoxa9 Hoxa4 Table S6. Primer Sequences. Inverse primer CAAGCAGAAGACGGCATACGAGTGCGCTTTAACGGCAAAGG Sequence AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAATTACCGAGACTAATACGTGCACA CAAGCAGAAGACGGCATACGAGTGGTGTTACTGTGCACTC AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCAAGGAGAGGAAACTAC CAAGCAGAAGACGGCATACGAACAGTGTTCAAGTATTTTGG AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGGATGCATAGATTCATG CAAGCAGAAGACGGCATACGAGGCGAGGCTCAGGCTTTTAT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAACACTTGCACAACCAGAAATGC CAAGCAGAAGACGGCATACGACTCCCCGAATTAGTGCGTGAAT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCACACGCACAAGAACACCC CAAGCAGAAGACGGCATACGATCATCAAACCAAGCAGGGCA AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGATTGAGGAGTCTGGCCACTT CAAGCAGAAGACGGCATACGAGCTGAAGACCTCTGGATGCG AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAAGTGGGGGTTGATGAGGTG CAAGCAGAAGACGGCATACGAATCTGGCGTTCAGAGAGGCT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGACTGTTCCTCGGGGCTAT CAAGCAGAAGACGGCATACGATGATGTGAAATGCCCCGTGA AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTACAACAACAAAAACCCAGCAGGT CAAGCAGAAGACGGCATACGAGTGTCCACAGGAGAGAAGGAGT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATTCCCCGGGCGAGCCGTACAT CAAGCAGAAGACGGCATACGAGCTCAATGTTCCCTTCCCTAACG AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATAATTTTCCTGAGACATTGTAAC CAAGCAGAAGACGGCATACGACATCCTGGGGACTGGTCAGA AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAACTATTTACCTCGGGCTCGCT CAAGCAGAAGACGGCATACGAGCTGCCTCACCAATTGGCAATAA AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCAGCATTTCATTTGGCCCC CAAGCAGAAGACGGCATACGATCCAGTGGAATTGGGTGGGAT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGACAATAAAGCATCCATAGGCG CAAGCAGAAGACGGCATACGACTGGTGCCCGTTCAAACTGA AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTACCTGGGCTGGGCTATTTCAC CAAGCAGAAGACGGCATACGACCCTCAGCTTGCAGCGAT AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTACGAACACCTCGTCGCCCT CAAGCAGAAGACGGCATACGACTAGGAAAATTCCTAATTTCAGG AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGCATACTTCCTCAGAAGAGGCA CAAGCAGAAGACGGCATACGAGGCCGATGGTGCTGTATAGG AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTAAAAATCCTAGACCTGGTCATG iHoxd13 forward iHoxd13 reverse iHoxd11 forward iHoxd11 reverse iHoxd9 forward iHoxd9 reverse iHoxd(i4-8) forward iHoxd(i4-8) reverse iHoxd4 forward iHoxd4 reverse iHoxd3 forward iHoxd3 reverse iHoxd1 forward iHoxd1 reverse iHoxc13 forward iHoxc13 reverse iHoxc9 forward iHoxc9 reverse iHoxc4 forward iHoxc4 reverse iHoxb13 forward iHoxb13 reverse iHoxb(i9-13) forward iHoxb(i9-13) reverse iHoxb9 forward iHoxb9 reverse iHoxb4 forward iHoxb4 reverse iHoxa13 forward iHoxa13 reverse iHoxa9 forward iHoxa9 reverse iHoxa4 forward iHoxa4 reverse iDlx1 forward iDlx1 reverse 4C – sequencing inverse primers Analyzed gene / region Hoxd13 Hoxd11 Hoxd9 Hoxd(i4-8) Hoxd4 Hoxd3 Hoxd1 Hoxc13 Hoxc9 Hoxc4 Hoxb13 Hoxb(i9-13) Hoxb9 Hoxb4 Hoxa13 Hoxa9 Hoxa4 Dlx1 References and Notes 1. M. Kmita, D. Duboule, Organizing axes in time and space; 25 years of colinear tinkering. Science 301, 331 (2003). 2. R. Krumlauf, Hox genes in vertebrate development. Cell 78, 191 (1994). 3. N. Soshnikova, D. Duboule, Epigenetic temporal control of mouse Hox genes in vivo. Science 324, 1320 (2009). 4. R. J. Palstra et al., The beta-globin nuclear compartment in development and erythroid differentiation. Nat. Genet. 35, 190 (2003). 5. M. A. Ferraiuolo et al., The three-dimensional architecture of Hox cluster silencing. Nucleic Acids Res. 38, 7472 (2010). 6. J. Fraser et al., Chromatin conformation signatures of cellular differentiation. Genome Biol. 10, R37 (2009). 7. K. C. Wang et al., A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. Nature 472, 120 (2011). 8. S. Chambeyron, W. A. Bickmore, Chromatin decondensation and nuclear reorganization of the HoxB locus upon induction of transcription. Genes Dev. 18, 1119 (2004). 9. C. Morey, N. R. Da Silva, M. Kmita, D. Duboule, W. A. Bickmore, Ectopic nuclear reorganisation driven by a Hoxb1 transgene transposed into Hoxd. J. Cell Sci. 121, 571 (2008). 10. R. Eskeland et al., Ring1B compacts chromatin structure and represses gene expression independent of histone ubiquitination. Mol. Cell 38, 452 (2010). 11. Material and methods are available as supporting material on Science Online. 12. M. Simonis et al., Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nat. Genet. 38, 1348 (2006). 13. A. P. Lee, E. G. Koh, A. Tay, S. Brenner, B. Venkatesh, Highly conserved syntenic blocks at the vertebrate Hox loci and conserved regulatory elements within and outside Hox gene clusters. Proc. Natl. Acad. Sci. U.S.A. 103, 6994 (2006). 14. L. Zeltser, C. Desplan, N. Heintz, Hoxb-13: a new Hox gene in a distant region of the HOXB cluster maintains colinearity. Development 122, 2475 (1996). 15. P. Tschopp, B. Tarchini, F. Spitz, J. Zakany, D. Duboule, Uncoupling time and space in the collinear regulation of Hox genes. PLoS Genet. 5, e1000398 (2009). 16. D. M. Wellik, Hox patterning of the vertebrate axial skeleton. Dev. Dyn. 236, 2454 (2007). 17. T. Young et al., Cdx and Hox genes differentially regulate posterior axial growth in mammalian embryos. Dev. Cell 17, 516 (2009). 18. J. Zakany, M. Kmita, P. Alarcon, J. L. de la Pompa, D. Duboule, Localized and transient transcription of Hox genes suggests a link between patterning and the segmentation clock. Cell 106, 207 (2001). 19. B. Tarchini, T. H. Huynh, G. A. Cox, D. Duboule, HoxD cluster scanning deletions identify multiple defects leading to paralysis in the mouse mutant Ironside. Genes Dev. 19, 2862 (2005). 20. B. Tarchini, D. Duboule, Control of Hoxd genes’ collinearity during early limb development. Dev. Cell 10, 93 (2006). 21. M. Simonis, J. Kooren, W. de Laat, An evaluation of 3C-based methods to capture DNA interactions. Nat. Methods 4, 895 (2007). 22. E. Lieberman-Aiden et al., Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science 326, 289 (2009). 23. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009). 24. Y. Zhang et al., Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
