Supplemental Materials and Methods
Reagents
All chemicals were from Sigma-Aldrich Chemicals (USA), unless otherwise stated.
HIL-6 (HIL-6) was produced as previously described (1).
Histological and Immunohistochemical Analysis
Livers samples were fixed in 4% buffered formaldehyde, followed by 80% ethanol
and embedded in paraffin blocks. P-STAT3 immunohistochemical staining was
performed as described (2). BrdU incorporation was analyzed using Mouse
monoclonal anti-BrdU antibody (Dako, Glostrup, Denmark) diluted 1:50, followed by
anti-Mouse HRP polymer (Dako) and developed with AEC. PCNA was stained using
Mouse monoclonal anti-PCNA (Santa Cruz Biotechnology, Santa Cruz, CA) diluted
1:200, followed by anti-Mouse HRP polymer (Dako) and developed with AEC. Ki-67
was stained using Rat anti-Mouse Ki-67 antigen (clone TEC-3, Dako), diluted 1:25,
followed by Biotinylated Rabbit Anti-Rat (Dako) 1:50, and anti-Rabbit HRP polymer
(Dako) and developed with AEC. LacZ immunohistochemical staining on paraffin
embedded sections was performed using Rabbit anti-β-gal (Abcam Cambridge, UK)
diluted 1:400, followed by anti-Rabbit HRP polymer (Dako) and developed with
AEC. In situ staining for β-galactosidase activity was performed on frozen liver
sections. Liver samples were removed and fixed in 2% formaldehyde for 30 min at
4°C. Samples were then washed with PBS and put in 0.5M sucrose in 1X PBS
overnight at 4°C. Tissues were embedded in Tissue-Tek OCT Compound (Ted Pella
Inc., Redding, CA) and frozen at -80°C. 12 micrometer tissue sections were cut using
a cryostat and placed on super frost plus slides (Menzel-Gläser, Braunschweig,
Germany). Frozen sections were stained by incubation for 1 hour at 37°C with
staining solution containing 0.1M sodium phosphate buffer PH 8.3-8.5, 2 mM MgCl2,
0.1% sodium deoxycholate, 0.2% Triton-X, 5mM potasssium ferricyanide, 5mM
potassium ferrocyanide and 1mg/ml X-gal (4-chloro-5-bromo-3-indolyl β-Dgalactopyranoside) and counter-stained with Nuclear Fast Red (Sigma). Periodic
Acid-Schiff (PAS) staining was performed using a Sigma Periodic Acid-Schiff kit
following the manufacturer's instructions.
Western blot analysis
Protein extracts were prepared from tissue samples (~100mg) by homogenization
and subjected to Western blot analysis probed with antibodies to p-STAT3, STAT3,
SMAD2/3, ERK2 (Santa Cruz Biotechnology, Santa Cruz, CA), p-ERK1/2 (antidiphosphorylated ERK1/2, Clone MAPK-YT, Sigma), pSMAD2 (Ser465/467) (Cell
Signaling, Danvers, MA), p-AKT (Ser473) and AKT (Cell Signaling), or -actin
(Sigma), as indicated, was performed as previously described (2). Blots were stripped
and re-probed for β-actin as a loading control. Quantitation of Western blot bands was
performed using TINA® 2.10g Imaging software. Calculation of relative fold change
in p-AKT levels was performed by dividing the OD value of p-AKT (ODp-AKT) of
each sample by the OD value of -actin (OD-actin) and then normalized to the average
ODp-AKT/OD-actin values of two Control Plasmid sample that were common to all gels.
Preparation and Transduction of MFGnlsLacZ
Ecotropic retroviral vector, MFGnlsLacZ (3), was concentrated by low speed
centrifugation (6000 x g) at 4° C for 16 h (4) from 1 L conditioned media from TM01
cells (3) (kindly provided by F-L Cosset, CNRS, Lyon, France) and gently
resuspended in 10 ml PBS containing 10 mg/ml lactose. For in vivo transduction
experiments (Supplemental Fig. 1D), mice were administered 3 doses of
MFGnlsLacZ (1x108 TU) in 1ml saline by high pressure intravenous injection on
three consecutive days beginning 24 hours following plasmid DNA transfection.
Retroviral transduction was evaluated 2 days following the last MFGnlsLacZ
injection.
Plasmid DNA Constructs
Details of plasmid DNA construction and preparation are in the Supplementary
Methods. Construction of expression plasmids phAAT-IL6 and phAAT-HIL6 were
described previously (2). phAAT-HGF was constructed by ligation of an XbaI – SalI
DNA fragment encoding human HGF cDNA (a kind gift from Ilan Tzarfati, Univ. Tel
Aviv, Tel Aviv, Israel) into the SmaI-NotI sites of pCI (Promega, Madison, WI,
USA). The CMV promoter was removed by digestion with BglII and HindIII, filled in
at the HindIII site and replaced with a BglII – NotI (filled) DNA fragment containing
the human α1-antitrypsin promoter (kindly provided by Dr. Katherine Ponder,
University of Washington, St. Louis, MO, USA). pBS-sgp130Fc was constructed by
ligation of a NotI (filled) – SalI restriction fragment encoding the murine sgp130-Fc
cDNA (S.R.-J.) into the SalI and EcoRV digested pBS-HCRHPI-A (5) (a kind gift
from Carol H. Miao, University of Washington, Seattle, WA). For in vivo
administration by high-pressure tail vein injection, plasmid DNAs were purified using
Enodotoxin-Free plasmid Maxi kits (NucleoBond® from MACHEREY-NAGEL,
Düren, Germany or Qiagen Sciences, Maryland, USA). All plasmid DNA solutions
for injection were prepared in endotoxin tested normal saline and normalized with
control plasmid DNAs to 20 μg DNA in a final volume of 1.8 ml.
RNA extraction and RT-PCR
RNA samples were prepared from approximately 100 mg snap-frozen tissue and
subjected to RT-PCR as previously described (2). The primer sequences used were as
follows: SOCS3 (sense) 5’-TCAGTACCAGCGGAATCTTC and (anti-sense) 5’TACTGATCCAGGAATCTCCCGA;
GAGGTCTCCAGCCAGAAGTG
SOCS1
and
(sense)
(anti-sense)
5'5'-
CTTAACCCGGTACTCCGTGA.
ELISA Analyses
Murine IL6 and sIL6R, and human HGF levels were determined using a mouse IL6,
a mouse sIL6R and human HGF DuoSet ELISA kits, respectively (R&D) according
to the manufacturer’s instructions on serum samples that were collected and frozen at
-20° C until analysis. Hyper-IL6 levels were analyzed using a human IL6 DuoSet
ELISA kit (R&D). Serum msgp130Fc levels were determined using goat anti-Human
IgG-Fc antibody (Bethyl Laboratories, Montgomery, TX, USA) diluted 1:2000 as a
capture antibody, and biotinylated goat anti-Mouse gp130 (R&D) (0.2µg/ml) as a
detection antibody and measured against a purified recombinant sgp130Fc protein
standard.
Transcription factor assay (non-radioactive EMSA)
Nuclear protein extracts were prepared from liver samples using a Nuclear
Extraction kit (Millipore, Billerica, MA) according to the manufacturer's instructions.
DNA binding activity for STAT3 and AP-1 was evaluated in 25μg of nuclear proteins
extract using Transcription Factor Assay kits (Millipore) according to the
manufacturer's instructions.
Statistical Analysis
Comparisons were subjected to either the Student t-Test, or Tukey One-way
ANOVA analysis, with P0.05 considered statistically significant was performed
using GraphPad InStat version 3.00 (GraphPad Software, San Diego California USA).
References for Supplemental Methods
1. Fischer M, Goldschmitt J, Peschel C, Brakenhoff JP, Kallen KJ, Wollmer A, et al.
I. A bioactive designer cytokine for human hematopoietic progenitor cell
expansion. Nat Biotechnol 1997 Feb;15(2):142-145.
2. Nechemia-Arbely Y, Barkan D, Pizov G, Shriki A, Rose-John S, Galun E, et al.
IL-6/IL-6R Axis Plays a Critical Role in Acute Kidney Injury. J Am Soc Nephrol
2008 Mar 12.
3. Cosset FL, Takeuchi Y, Battini JL, Weiss RA, Collins MK. High-titer packaging
cells producing recombinant retroviruses resistant to human serum. J Virol 1995
Dec;69(12):7430-7436.
4. Prachar J, Hlubinova K, Kovarik A, Feldsamova A, Simkovic D. Concentration of
retroviruses by low-speed centrifugation. Neoplasma 1988;35(6):651-655.
5. Miao CH, Ye X, Thompson AR. High-level factor VIII gene expression in vivo
achieved by nonviral liver-specific gene therapy vectors. Hum Gene Ther 2003
Sep 20;14(14):1297-1305.