Supplementary information
Characterization of DN SEMA3 receptors - Vertebrate class 3 semaphorins (SEMA3
proteins) consist of six (SEMA3A to SEMA3F) secreted disulfide-bound homodimeric
molecules. Neuropilin-1 (Npn-1) and Npn-2 are vertebrate transmembrane glycoproteins
acting as key components of SEMA3 receptors. The extracellular moiety of Npn contains
two repeated complement-binding domains (CUB domains, a1-a2 domains), two
coagulation factor-like domains (b1-b2 domains) and a juxtamembrane meprin/A5/muphosphatase (MAM, c) homology domain. The intracellular moiety contains a
transmembrane and a small cytoplasmic domain without signalling motifs. Npn-1 and
Npn-2 form ligand independent homo- and heterodimers. SEMA3 proteins elicit Npn
noncovalent oligomerization, which is absolutely required for biological response1-4.
Npn-1 homodimers confer responsiveness to SEMA3A and SEMA3E, Npn-2
homodimers to SEMA3F, Npn-1/Npn-2 heterodimers to SEMA3B and SEMA3C 5. The
a1-a2 and b1-b2 domains of Npn bind respectively sema and Ig-basic domains of
SEMA3 proteins respectively, contributing to the specificity of the receptor3. The
MAM/c domain is pivotal for Npn oligomerization in response to SEMA3 proteins and
biological activity2,3. Vascular endothelial growth factor-A165 (VEGF-A165) interacts with
b1-b2 domains of Npn-1
3,6-8
and competes with SEMA3 proteins for binding to Npn-19.
Placental growth factor 2 (PlGF2) binds with strong affinity b1-b2 domains of Npn-1 as
well. However, while VEGF-A165 signals through both VEGF-R1 and –R2, PlGF2
transduces only through the latter7,10,11. Besides Npn, additional component(s) are
required to form functional receptor complexes for SEMA3 proteins. The plexins (Plex)
are a family of 9 integral membrane proteins with a large cytoplasmic sex-plexin (SP)
domain with homology to Ras GTPase activating proteins and interacting with Rhofamily GTPases
12
. While they are functional receptors for classes 1, 4, and 7 SEMA,
Plex do not bind directly to SEMA3 proteins and constitute a signalling moiety in
1
SEMA3 receptor complex, while Npn provide the ligand binding sites. Npn-1/Plex-A1,
Npn-1/Plex-A2, and Npn-1/Plex-A3 complexes transduce SEMA3A, Npn-2/Plex-A1
complex transduces SEMA3F, Npn-1/Plex-A2 and Npn-2/Plex-A2 complexes transduce
SEMA3C 13.
Deleting the cytoplasmic domain of Plex-A1 gives rise to a Plex-DN
14
blocks the
response to both SEMA3A and SEMA3F (Fig. S2, a), but not to VEGF-A165 and PlGF2
(Fig. S2, b-d). We sought to generate a Npn DN construct which is capable of inhibiting
the response to both SEMA3A and SEMA3F, but not VEGF-A165 and PlGF2. We found
that a modified Npn-1 consisting of the MAM/c, transmembrane, and cytoplasmic
domains (Fig. S1 a, b) behaves as a Npn-1-DN negative construct interfering with the
biological response to both Npn-1 and Npn-2 binding SEMA3 proteins (Fig. S2, a), but
not to VEGFA-165 and PlGF2 (Fig. S2, b-c). Such a DN activity results from an impaired
homo- and hetero-oligomerization of Npn-1 and Npn-2 as well as from an inhibition of
hetero-oligomerization between Npn-1 or Npn-2 and PlexA1 (Fig. S1 c). Since ligand
induced association of Npn-1 with VEGF-R2 is the molecular basis by which Npn-1
enhances EC biological response to VEGF-A165
15
, we tested whether Npn-1-DN and
PlexA1-DN could inhibit this association. In accordance with data concerning the
biological response, neither SEMA3 DN receptor inhibited VEGF-A165-dependent
association of Npn-1 with VEGF-R2 or VEGF-R2 tyrosine phosphorylation (Fig S2 d).
Thus, SEMA3 DN receptors employed in this study specifically disrupt SEMA3 protein
signalling, but do not inhibit either VEGF-A165 or PlGF2 signalling in ECs.
SEMA3 proteins, Npn, and PlexA expression in cultured human ECs - Western blot
analysis showed that cultured ECs synthesise SEMA3A, whose expression was enhanced
by VEGF-A (Fig.S3 a; 2.4 fold increase after 24 hours). Synthesis of SEMA3A by
unstimulated ECs is likely due to the fact that, when grown in vitro, ECs become
2
activated and express molecules usually induced in vivo by angiogenic factors16. Next,
we tested whether SEMA3 genes other than SEMA3A are expressed by ECs.
Semiquantitative RT-PCR analysis (Fig. S3 b) showed that ECs synthesise five out of six
SEMA3 mRNAs and VEGF-A treatment increases transcription of all expressed SEMA3
genes except SEMA3F. Moreover, the mRNAs of both ligand binding and signal
transducing subunits of SEMA3 receptor complexes, respectively represented by Npn
(not shown and Refs. 11, 17) and PlexA (Fig. S3 b), were present in ECs.
Supplementary methods
In vivo angiogenic assays. Murine Matrigel plug
18
and CAM angiogenic assays19 were
performed as previously described.
Immunohistochemistry. Paraffin sections (5 m) were dewaxed by standard techniques.
To improve staining, dewaxed sections were treated with antigen retrieval citra
(BioGenex). Sections were incubated in 3% H2O2 for 10 min, and in 1% Triton X-100 for
10 min, and then blocked with antibody buffer (0.5% bovine serum albumin and serum)
for 30 min at room temperature (RT). Primary antibodies were applied overnight at 4°C.
Secondary antibodies were applied for 1 hr RT. Finally, sections were incubated in a
streptavidin-peroxidase-complex (DAKO) according to manufacturer's instructions.
Colour detection of immunoreactivity was achieved using 3'.3'-diaminobenzidine
(DAKO). Sections were then counterstained in Mayer’s hemalum solution (MERK).
Indirect immunofluorescence microscopy. Cells were plated onto FN-coated 0.95 cm2
glass coverslips, allowed to adhere for 20 min, fixed for 20 min RT in 3.7%
paraformaldehyde (PAF), and then permeabilised for 2 min at 4°C with 0.1% Triton X100 in PBS.
3
Tissue samples were embedded in KILLIK (Bio-Optica) and snap frozen in precooled liquid isopentane. Four m serial sections were fixed for 20 min in freshly
prepared solution of 3.7% PAF.
Cells and tissue sections were sequentially incubated with the first primary
antibody, revealed by a Cy3-tagged secondary antibody (Jackson Laboratories), and then
with the second primary antibody, followed by the corresponding FITC-labelled
secondary antibody (Jackson Laboratories). Specimens were observed with an inverted
photomicroscope (model DM IRB HC; Leica Microsystems) equipped with mercury
short arc epifluorescence lamp and appropriate combination of filters. The objective was
immersion oil PL APO 63×/1.4. Images were captured using a cooled digital CCD
Hamamatsu ORCA camera (Hamamatsu Photonics), digitally recorded and analysed with
ImageProPlus 4.0 imaging software (Media Cybernetics).
Cell motility assay and analysis of cell paths. 20,000 were plated onto 20 mm dish
(Falcon) coated with 3 g/ml FN (Sigma), allowed to adhere in medium 199 for 1 h at 37
°C, and then observed with an inverted microscope equipped with thermostatic and CO2
controlled chamber. Images of motile ECs were captured with a 5 min time interval over
4 h using an ORCA camera (Hamamatsu Photonics). Images were then processed with
DIAS software (Solltech). Cell motility data were displayed as a centroid plot showing
the location of the geometrical centre of the cell as a function of time. Directional
persistence was calculated by determining the ratio between the net path length and the
total path length. Single cell trajectories were plotted using Excel software (Microsoft)
and displayed in windrose graphs.
Npn-1-DN construct. A two-step PCR protocol was used to generate a Npn-1 dominant
negative (Npn-1 DN) construct where domains a1, a2, b1, and b2 were deleted and Npn-1
signal peptide was fused in frame with the c domain. Oligonucleotide primers were as
4
follows:
i)
cgccatggagagggggctgccgttg
(F1)
and
cccattgggtgtcgtgggtccagcgaaagcccccagggcgagggc (R1) to amplify the signal sequence; ii)
gctggacccacgacacccaatggg (F2) and ttctcaattcagatcctcttctgagatg (R2) to amplify the rat
Npn-1 region spanning the c domain, transmembrane and cytoplasmic domains. The
sequence on either side of the deleted region was amplified in the first step. The 5' end
(underscored) of the internal reverse primer R1 is complimentary to the internal forward
primer F2. Consequently, the two pieces of DNA amplified in the first round of PCR
acted as the template for the second step of PCR, where they were left to anneal together
at low temperature (45°C for 5 min.) and then amplified using the outermost primers F1
and R2. The C-terminus of Npn-1 DN was myc-tagged (italicised lettering in R2). The
corresponding PCR product was TA-cloned into the pCR2.1TOPO (Invitrogen).
RT-PCR analysis. Total RNA was isolated from ECs stimulated with 20 ng of VEGFA165 using TRI-REAGENT kit (Sigma) according to the manufacturer’s instructions,
digested with DNAse, and subjected to reverse transcription (MuLV; Perkin Elmer). RT
product was amplified in a PCR reaction with AmpliTaqGold (Perkin Elmer). Reactions
were performed in a 9700 GeneAmp PCR System (Perkin Elmer) and calibrated on the
exponential phase of amplification according to the following conditions: 10 min at 94°C,
30 sec at 94°C, 30 sec at annealing temperature (Tm), 30 sec at 72°C, and, finally, 7 min
at 72°C for SEMA3A, 3B, 3C, 3E and 3F. The same conditions with a 45 sec of
extension were used for SEMA3D, Plexin A1, A2, and A3 amplification. GAPDH was
used as internal control.
Primer sequences were as follows: SEMA3A fw 5’ ACTCACTGTTCAGACTTAC
3’ and re 5’ GAGCTGCATGAAGTCTCT 3’ (30 cycles, Tm 50°C). SEMA3B fw 5’
CAACTGGGCAGGGAAGGACAT 3’ and re 5’ CGTCTGGGTTCTCGCTCTCCG 3’
(37 cycles, Tm 60°C). SEMA3C fw 5’ GCAAAATGGCTGGCAAAGATCC 3’ and re 5’
CCCATGAAATCTATATACATTCC 3’ (37 cycles, Tm 60°C). SEMA3D fw 5’
5
TTAGTCATGAAACTGCTG 3’ and re 5’ GCTCATCCAGGTCTCTGT 3’ (45 cycles,
Tm
50°C).
SEMA3E
fw
GTCTTATCCAAAGCATCCC
5’
3’
CAACAGGCACACATGCAA
(40
cycles,
Tm
60°C).
3’
and
re
5’
SEMA3F
fw
5’
GCGCATGAAGTTGATCAC 3’ and re 5’ ACCAGTGGATGCCCTTCT 3’. PLEXIN
A1, A2, A3 fw 5’ CCTCGAGA(G/A)CAAGAACCACCCCAAGCTGCT 3’ and re A1 5’
CCCTTCACCGGCACCTCAGGTGCATT
AACACCTTCACTGGGATCTCTGGACTGTTC
3’,
re
3’,
A2
re
A3
5’
5’
CTTCACTGGGACCTGGGCGCTGCC 3’ (35 cycles, Tm 68°C). GAPDH fw 5’
ACCACAGTCCATGCCATCAC 3’ and re 5’ TCCACCACCCTGTTGCTGTA 3’.
Intensity levels of PCR products were quantified using Phoretics 1D Standard
(Abel Science-Warw SRL) and normalised for GAPDH levels.
References
1.
Kitsukawa, T. et al. Neuropilin-semaphorin III/D-mediated chemorepulsive
signals play a crucial role in peripheral nerve projection in mice. Neuron 19, 995-1005.
(1997).
2.
Chen, H., He, Z., Bagri, A. & Tessier-Lavigne, M. Semaphorin-neuropilin
interactions underlying sympathetic axon responses to class III semaphorins. Neuron 21,
1283-90. (1998).
3.
Giger, R. J. et al. Neuropilin-2 is a receptor for semaphorin IV: insight into the
structural basis of receptor function and specificity. Neuron 21, 1079-92. (1998).
4.
Takahashi, T., Nakamura, F., Jin, Z., Kalb, R. G. & Strittmatter, S. M.
Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neuropilin-2
receptors. Nat Neurosci 1, 487-93. (1998).
6
5.
Raper, J. A. Semaphorins and their receptors in vertebrates and invertebrates.
Curr Opin Neurobiol 10, 88-94. (2000).
6.
Nakamura, F., Tanaka, M., Takahashi, T., Kalb, R. G. & Strittmatter, S. M.
Neuropilin-1 extracellular domains mediate semaphorin D/III-induced growth cone
collapse. Neuron 21, 1093-100. (1998).
7.
Mamluk, R. et al. Neuropilin-1 binds vascular endothelial growth factor 165,
placenta growth factor-2, and heparin via its b1b2 domain. J Biol Chem 277, 24818-25.
(2002).
8.
Gu, C. et al. Characterization of neuropilin-1 structural features that confer
binding to semaphorin 3A and vascular endothelial growth factor 165. J Biol Chem 277,
18069-76. (2002).
9.
Miao, H. Q. et al. Neuropilin-1 mediates collapsin-1/semaphorin III inhibition of
endothelial cell motility: functional competition of collapsin-1 and vascular endothelial
growth factor-165. J Cell Biol 146, 233-42. (1999).
10.
Migdal, M. et al. Neuropilin-1 is a placenta growth factor-2 receptor. J Biol Chem
273, 22272-8. (1998).
11.
Gluzman-Poltorak, Z., Cohen, T., Herzog, Y. & Neufeld, G. Neuropilin-2 is a
receptor for the vascular endothelial growth factor (VEGF) forms VEGF-145 and VEGF165 [corrected]. J Biol Chem 275, 18040-5. (2000).
12.
Rohm, B., Rahim, B., Kleiber, B., Hovatta, I. & Puschel, A. W. The semaphorin
3A receptor may directly regulate the activity of small GTPases. FEBS Lett 486, 68-72.
(2000).
13.
Tamagnone, L. & Comoglio, P. M. Signalling by semaphorin receptors: cell
guidance and beyond. Trends Cell Biol 10, 377-83. (2000).
7
14.
Tamagnone, L. et al. Plexins are a large family of receptors for transmembrane,
secreted, and GPI-anchored semaphorins in vertebrates. Cell 99, 71-80. (1999).
15.
Soker, S., Miao, H. Q., Nomi, M., Takashima, S. & Klagsbrun, M. VEGF165
mediates formation of complexes containing VEGFR-2 and neuropilin-1 that enhance
VEGF165-receptor binding. J Cell Biochem 85, 357-68 (2002).
16.
Garlanda, C. & Dejana, E. Heterogeneity of endothelial cells. Specific markers.
Arterioscler Thromb Vasc Biol 17, 1193-202. (1997).
17.
Soker, S., Takashima, S., Miao, H. Q., Neufeld, G. & Klagsbrun, M. Neuropilin-1
is expressed by endothelial and tumor cells as an isoform- specific receptor for vascular
endothelial growth factor. Cell 92, 735-45. (1998).
18.
Bussolino, F. et al. Platelet activating factor produced in vitro by Kaposi's
sarcoma cells induces and sustains in vivo angiogenesis. J Clin Invest 96, 940-52. (1995).
19.
Valdembri, D., Serini, G., Vacca, A., Ribatti, D. & Bussolino, F. In vivo
activation of JAK2/STAT-3 pathway during angiogenesis induced by GM-CSF. Faseb J
16, 225-7. (2002).
Supplementary Figure Legends
Figure S1. Characterisation of Npn-1-DN. a, Structural features of wild type Npn-1 and
Npn-1-DN. Npn-1-DN consists of the MAM/c, transmembrane, and cytoplasmic domain,
the a1-a2 and b1-b2 domains of Npn-1 binding SEMA3 are missing and a Myc tag is
present at its C-terminus. b, Western Blot analysis on U293 cells lysates transducted with
Npn-1-DN. MAb directed against the Myc tag included in Npn-1-DN and polyclonal Ab
recognising the cytoplasmic domain of Npn-1 stain the same band of at about 50kD. c,
Western Blot of immunoprecipitated samples from WT or Npn-1-DN U293 cells cotransfected with different subunits of SEMA3 receptor complexes. Specific mAbs were
8
used directed against the VSV tag included in Npn-1, Npn-2, and plexins, or the HA tag
included in Npn-1 and Npn-2. While in WT U293 the different subunits of SEMA3A
receptor co-immunoprecipitate, the presence of Npn-1-DN impeded such interactions.
Figure S2. Npn-1-DN and PlexA1-DN inhibit SEMA3A and SEMA3F, but not VEGFA165 and PlGF2 activity. a, Npn-1-DN and PlexA1-DN inhibit SEMA3A and SEMA3F
activity. Cells were resuspended in the absence (Ctl) or the presence of SEMA3A or
SEMA3F and allowed to migrate towards FN. b, c, Npn-1-DN and PlexA1-DN do not
inhibit VEGF-A165 and PlGF2 activity. Cells were allowed to migrate towards 20 ng/ml
VEGF-A165 or 30 ng/ml PlGF2 employing fibronectin (b) or vitronectin (c) as substrate.
d, Npn-1-DN and PlexA1-DN do not inhibit VEGF-A165 dependent VEGF-R2 tyrosine
phosphorylation and association with Npn-1. ECs were stimulated with 10 ng/ml VEGFA165 for 10 min. Cell lysates were immunoprecipitated with anti-VEGF-R2 and blotted
with the indicated antibodies.
Figure S3. SEMA3, Npn, and PlexA expression in cultured human ECs. a, VEGF
regulates SEMA3A expression in ECs. Western Blot analysis of EC lysates reveals an
increase (2.4 fold) in SEMA3A expression after 24 h VEGF-A stimulation. The goat
polyclonal Ab N-17 recognising the N-terminus of SEMA3A specifically stains a protein
of at about 100kD. b, ECs synthesise multiple SEMA3 mRNAs. Ethidium bromide–
stained amplification products of semiquantitative RT-PCR with SEMA3A-3F, Plexin A1A3, and GAPDH–specific primer pairs are shown. mRNAs from cultured ECs stimulated
with VEGF-A were used. Relative intensity levels of different PCR products were
measured and normalised for GAPDH levels. mRNAs of SEMA3A, B, D, and E, but not
SEMA3F are increased. ECs do not express SEMA3C mRNA even after VEGF
stimulation. Transcripts of SEMA3A receptor subunits PlexinA1, A2, and A3 are present
in ECs. Fold increases in red are higher than 1.5.
9