Effect of Paeonol on Tissue Destruction in Experimental
Periodontitis of Rats
Chih-Yuan Chang, DDS, MSD *, †, Earl Fu, DDS, DScD *, †, Cheng-Yang Chiang,
DDS, MSD *, Wei-Jeng Chang, PhD §, Wan-Chien Cheng, DDS *, Hsiao-Pei Tu, PhD
*, ‡
Affiliation
*: School of Dentistry, National Defense Medical Center and Tri-Service General
Hospital, 114 No.161, Sec. 6, Minquan E. Rd., Neihu Dist., Taipei City 114,
Taiwan, ROC
§: National Laboratory Animal Center, NARL, 128 Academia Road, Section 2,
Nankang, Taipei 115, Taiwan, ROC
‡: Department of Dental Hygiene, China Medical University, 91 Hsueh-Shih Road,
Taichung, 40402, Taiwan, ROC.
†: These authors equally contributed to the works
Running title: Protection of paeonol on periodontitis in rat (<40 bites)
Number of pages, figures and tables: 19 pages and 6 figures
Correspondence
Dr. Hsiao-Pei Tu
School of Dentistry, National Defense Medical Center, PO Box 90048-507, Taipei,
Taiwan, ROC, and
Department of Dental Hygiene, China Medical University, 91 Hsueh-Shih Road,
Taichung, 40402, Taiwan, ROC.
Email: dentalab@tpts5.seed.net.tw
Tel: +886-2-87927150; Fax: +886-2-87927145
Abstract
We evaluated the effects of paeonol, a phenolic compound of Moutan Cortex,
on the tissue inflammation and destruction in experimental periodontitis of rats.
Maxillary palatal bony surfaces of 18 rats received injections of lipopolysaccharide
(LPS, 5 mg/mL), PBS or LPS-plus-paeonol (40 mg/kg, intra-peritoneal injection) for
3 days. Five days later, the osteoclasts were examined and compared after
tartrate-resistant acid phosphatase staining. In another 36 rats, the experimental
periodontitis was induced by placing the ligatures around maxillary second and
mandibular first molars. Seven days later, the periodontal destruction and
inflammation in rats with paeonol (40 or 80 mg/kg) and those had no ligature or
without paeonol were compared by dental radiography, micro-computerized
tomography
(micro-CT),
and
histology.
Gingival
mRNA
expressions
of
pre-inflammatory cytokines, including IL-1β、IL-6 and TNF-α were also examined.
Compared to the effect of the LPS positive control, paeonol injection significantly
reduced the induced osteoclast formation. In ligature-induced periodontitis, the
periodontal
bone
supporting
ratio
was
significantly
higher
in
the
ligature-plus-paeonol groups compared to that of the ligature group, although they
were still less than those in the non-ligature group. By micro-CT and by
histology/histometry, a consistent anti-destructive effect was observed when paeonol
was added. Moreover, less amount of inflammatory cell-infiltrated connective tissue
area, connective tissue attachment and mRNA expressions of pro-inflammatory
cytokines were presented in the ligature-plus-paeonol groups than those in the
ligature group. These results suggested paeonol might have a protective potential on
gingival tissue inflammation and alveolar bone loss during the process of
periodontitis by inhibiting pro-inflammatory cytokines.
Key words: paeonol, periodontitis, Moutan Cortex, anti-inflammatory agents
Introduction
Periodontal disease is an inflammation-associated disease and bacterial plaque is
the primary etiology. The periodontal pathogens, as well as their products, can induce
inflammatory cell infiltration, edema and vascular dilatation in inflamed periodontal
tissues (Page, 1991). This inflammatory reaction may damage surrounding cells and
connective tissue structures, including the alveolar bone, and eventually causes tooth
loss (Lindhe et al., 1987; Listgarten, 1987). However, a complex interaction among
various inflammatory mediators and tissue modeling are involved in this pathogenic
mechanism of periodontitis. Lipopolysaccharide (LPS) is a major component of the
outer membrane of gram-negative bacteria and can elicit strong immune responses.
Studies have shown that LPS can penetrate gingival connective tissue and induce
local inflammatory responses that lead to periodontal bone resorption (Schwartz et al.,
1972). Therefore, the injection of bacterial toxins has been commonly used to induce
an experimental periodontitis in vivo (Cheng et al., 2010). Periodontal destruction has
also been successfully induced in animals by other modalities e.g. dietary
manipulation (Robinson et al., 1991), introduction of pathogenic microorganisms
(Fiehn et al., 1992), and placement of a ligature that acts as a site for bacterial
colonization (Cheng et al., 2010; Fiehn et al., 1992; Robinson et al., 1991).
Paeonol, 2′-hydroxy-4′-methoxyacetophenone, is a major phenolic compound of
Moutan Cortex, the root bark of Paeonia moutan Sims (Paeonia suffruticosa Andrews)
(Huang et al., 2008; Mimura et al., 1979). Paeonol is commonly known as an
important component in traditional Chinese medicine. Paeonol has been known as an
antioxidant, anxiolytic-like and anti-inflammatory agent (Chou, 2003; Mi et al., 2005;
Okubo et al., 2000). Although the anti-inflammatory effect of paeonol has been
demonstrated both in vitro and in vivo (Chae et al., 2009; Chou, 2003; Kim et al.,
2004), its effects on periodontal inflammation and destruction have never been
examined. The present study was therefore designed to examine the effects of paeonol
on the periodontal destruction and pro-inflammatory cytokine expressions by using
two animal models of experimental periodontitis.
Materials and Methods
Experimental Design
To evaluate the effect of paeonol on osteoclast formation induced by LPS,
eighteen SD rats were randomly divided into three groups (control, LPS, and
LPS-plus-paeonol) with six animals in each group, as described in our previous study
(Cheng et al., 2010). Briefly, the rats in the LPS group received 5 mg/mL of LPS
10uL (Escherichia coli Serotype 055:B5; Sigma Co.) injection daily at the right
palatal gingiva around the first and second molars for 3 days. The animals in the
control group were received daily phosphate buffered saline (PBS) injections. The rats
in the LPS-plus-paeonol group not only received LPS as the LPS group but also had
the intra-peritoneal injection of paeonol (40 mg/kg body weight; Alfa Aesar)
dissolved in dimethyl sulfoxide (DMSO; Mallinckrodt Baker) 1 day before the start of
the experiment (Rotelli et al., 2003). All animals were sacrificed on day 5th and the
palatal specimens were taken and prepared for histology.
The inhibitory effect of paeonol on the dental alveolar bony destruction was
further examined in an experimental periodontitis induced by placing silk-ligature
around molars of rats. Thirty-six male SD rats were randomly divided into four
groups. The rats in the non-ligature group received no ligature, whereas the 3-O silk
(surgical silk sutures; UNIK) were wrapped bilaterally around the cervical margins of
maxillary second and mandibular first molars in the ligature group. The rats in these
two groups received the intra-peritoneal injection of were fed daily with dimethyl
sulfoxide (DMSO), a solvent of paeonol. The rats in the ligature-plus-paeonol groups
were given with the same silk ligatures as rats in the ligature group, but they also
received daily doses of paeonol (40 or 80 mg/kg in DMSO) from 1 day before the
ligation. On day 8th, all animals were sacrificed by carbon dioxide inhalation. The
gingival specimens around the maxillary 2nd and the mandibular 1st molars were taken
and stored to determine the mRNA expressions of specific inflammatory cytokines.
The remained specimens were then fixed in 4% paraformaldehyde and prepared for
dental radiography, micro computerized tomography (micro-CT) or histology. In the
present study, all animals were kept in a specific pathogen free facility and handled
according to the protocols approved by Institutional Animal Care and Use Committee,
National Defense Medical Center, Taipei, Taiwan.
Dental Radiography
In this study, the first mandible molars were selected to determine the bone loss
examined by radiography as previous studies did (de Souza et al., 2006; Holzhausen
et al., 2002). In brief, the standardized digital radiographs were obtained with the use
of a computerized imaging system that utilizes an electronic sensor instead of x-ray
film. Electronic sensors were exposed at 65 KV and 10 mA with the time of
exposition at 12 impulses per second. The source-to-film distance was always set at
50 cm. The distance between the cemento-enamel junction (CEJ) and the crest of
alveolar bone was determined from the mesial root surfaces of the right and left first
molars with the aid of the software (Figure 1). Moreover, the periodontal bone
support ratio (PBSr) was measured on the same images. Along the long axis of the
distal roots of the molars, three points were taken as references: the apex of the distal
root (A), the distal cusp tip (C) and the bottom of the deepest bony defect distal to the
tooth (B). Afterwards the distances from apex to cusp tip (AC) and to deepest bone
defect (AB) were measured in mm. Periodontal bone supporting ratio was determined
by the formula: PBSr = AB/AC x100.
Micro Computed Tomography Imaging
All maxillary and mandibular specimens from the experiment of ligature-induced
periodontitis were scanned for micro-CT imaging with a high resolution in vivo
micro-CT scanner (Skyscan1076 micro-CT system; SkyScan, Aartselaar, Belgium).
The tube was operated at an accelerated potential of 50 kVp with a beam current of
200 μA for 460 ms, with an image pixel size of 18 μm and an 0.8 degree rotation step.
All data were collected and reconstructed with medical image processing software
(Medical image illustrator, Visualization and Interactive Media Laboratory of
National Center for High-performance Computing, Taipei, Taiwan). This enabled us
to observe the 3D morphology around the tooth and dental alveolar bone in all
directions and dimensions, including the CEJ, root surface and dental alveolar crest,
as well as the relationships between these areas. The distance between the CEJ and
the coronal level of the alveolar bone crests were recorded at 4 sites (i.e. mesio-buccal,
disto-buccal, mesio-palatal, and disto-palatal) around maxillary second and
mandibular first molars bilaterally, on the reconstructed three-dimensional micro-CT
images (Cheng et al., 2010; Li et al., 2007).
Histology and Histometry:
After the scanning of micro-computed tomography, the maxillary specimens
were prepared for histology. On the mesial surfaces of the maxillary second molars of
each rat, the following histometric measurements were performed: the periodontal
tissue loss (the attachment loss, i.e. the distance from CEJ to the most coronal level of
epithelial cells), the histological distance from CEJ to bone, the surface area of
inflammatory cell-infiltrated connective tissue (ICT area), and the length connective
tissue attachment (i.e. the distance from the most apical level of epithelial cells to the
alveolar bone crest). The surface area of ICT was performed in a zone of 0.14 mm2 of
sub-epithelial gingiva on the mesial surface of the maxillary second molar of each rat
as the previous studies did (Cheng et al., 2010). The grid point intersection analysis
was used to estimate the areas of infiltrated and total connective tissue of inter-dental
gingiva at 120X magnification.
Extraction of RNA and Reverse Transcription–Polymerase Chain Reaction:
Total RNA was extracted from homogenized gingival tissue of rats. The RNA
was reverse transcribed, and the PCR reactions included an initial denaturation at 94
℃ for 2 min 30 s, followed by the denaturation cycles between 30 cycles for
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 35 cycles for others at 94
℃ for 30 s, annealing at 58 - 60 ℃ for 30 s, and elongation at 72 ℃ for 55 s. The
PCR primers used in the present study were as follows: interleukin (IL)-1β
(Accession
No.:
M98820),
5’-TTCATCTCGAAGCCTGCAGTG
-3’
and
5’-GACCTGTTCTTTGAGGCTGAC-3; tumor necrosis factor (TNF)-α (Accession
No.:
AY427675),
5’-GCCACTACTTCAGCATCTCG-3’
5’-AGTCTTCCAGCTGGAGAAGC-3’;
IL-6
(Accession
5’-TAGCCACTCCTTCTGTGACTCTAACT-3’
GACTGATGTTGTTGACAGCCACTGC
NM_017008),
-3’;
No.:
and
M26745),
and
and
GAPDH
5’-TGCTGGTGCTGAGTATGTCG-3’
5’(Accession
No.:
and
5’-ATTGAGAGCAATGCCAGCC-3’. Amplified RT-PCR products were then
analyzed on a 1% agarose gel and visualized with ethidium bromide staining using a
camera system (Transilluminator/SPOT; Diagnostic Instruments). The gel images
were directly scanned (ONE-Dscan 1-D Gel Analysis Software; Scanalytic Inc.), and
the relative intensities were obtained by determining the ratio of the signal intensity
relative to that of the GAPDH band.
Statistical Analysis:
One-way ANOVA with Duncan’s test as post hoc analysis was used to determine
the effect of LPS on osteoclast formation, and the effects of paeonol on the induced
osteoclast formation. The one-way ANOVA was also used to examine the effect of
paeonol on the ligature-induced radiographic bone loss and histometric measurements.
Repeated-measures analysis of variance was used to evaluate the effect of paeonol or
ligature treatment (the between-subject factor), as well as the effects of anatomic
location (e.g. maxillary vs. mandibular molars, right vs. left side, or buccal vs.
palatal/lingual) (the within-subject factors) on the tomographic distance from CEJ to
bone. P < 0.05 was considered as significant.
Results
Generally speaking, small amount of active osteoblasts with osteoids underneath
were observed on the bony surfaces of the control rats (Figure 2, left histograms).
Osteoclasts with resorptive lacunae were easily observed in the alveolus treating with
LPS (Figure 2, center histograms), whereas the number of osteoclasts was reduced in
the group treating with LPS and paeonol (Figure 2, right histograms). The number of
osteoclast was significantly increased in the LPS group, compared to the control, but
significantly reduced in LPS-plus-paeonol group, compared to LPS group, although it
was still higher than that in control group. The nucleus numbers of osteoclast were
statistically similar among the three animal groups (Figure 2, lower plots).
For the experiment of the ligature-induced periodontitis, the periodontal bone
supporting ratio by radiography was significantly decreased in the ligature group
when compared with that of the non-ligature group on both right and left jaws (Figure
3A). However, the ratios were rebounded in the ligature-plus-paeonol groups,
although they were still less than those in the non-ligature group. The radiographic
distances from enamel to bone, which indicate periodontal bone loss, presented with
an opposite result: the distance was increased in the ligature group, but reduced in
ligature-plus-paeonol groups (Figure 3B).
By micro-CT, the alveolar bone crests could be identified and measured easily
(Figure 4). Consistent findings were also observed in the tomographic distance from
CEJ to bone. The distance was significantly increased in the ligature group when
compared with that of the non-ligature group but reduced again in the
ligature-plus-paeonol groups, and the distances were not different between the right
and left, the maxilla and mandible, the buccal and lingual surfaces, and the mesial and
distal surfaces (Figure 4).
By histology, periodontal inflammation and alveolar bone loss were easily
observed in the ligature group (Figure 5); however, the inflammation and destruction
was significantly less in animals received paeonol. The histometric measurements,
including periodontal tissue loss, histological distance from CEJ to bone, ICT surface
area, and connective tissue attachment, were significantly different among the four
animal groups. Post-hoc analysis revealed that the periodontal tissue loss was
significantly increased in the ligature group if compared with that in the non-ligature
group; however, the increased tissue loss was significantly reduced in the
paeonol-plus-ligature groups. Consistent pattern was again observed in the other three
histometric measurements, including the histological distance from CEJ to bone, the
ICT surface area, and the connective tissue attachment (Figure 5).
The mRNA expressions of cytokines of IL-1β, TNF-α and IL-6 in gingiva among
different animal groups also demonstrated a consistent pattern with the expressions
significantly increased in the ligature group if compared with those in the non-ligature
group, but the increased expressions was reduced in the paeonol-plus-ligature groups
(Figure 6).
Discussion
In this study, the effects of paeonol on the periodontal destruction and
inflammation were examined by using two experimental periodontitis models of rats.
Our results illustrated a consistent ameliorative effect of paeonol on ligature- or
LPS-induced periodontal destruction, bony loss, gingival inflammation, and cytokine
responses. Various Chinese medicinal herbs have been shown to safely suppress
pro-inflammatory pathways and possess anti-inflammatory effects (Cyong et al.,
1982). A review study has demonstrated that a considerable number of Chinese
medicinal herbs can perform dual roles on immunological regulation by activating
and/or suppressing immune responses (Liu et al., 2010). A few different types of
Chinese medicinal herbal composites have been selected for examining their
inhibitory effects on periodontal pathogens and their therapeutic effects on
periodontitis (Chan et al., 2003; Chang et al., 1998; Wong et al., 2010). However, the
scientific evidence of applying paeonol in periodontal disease is still absent.
Periodontitis is an inflammation-associated disease and involves a complex
mechanism associated with bacterial and immune modulations. The experimental
periodontitis in animal models have been frequently used to overcome the limitations
of clinical study; however, the experimental periodontitis in animals still have their
own limitations (Graves et al., 2008). In the model of LPS injection, for instance, the
endotoxin from bacteria is directly delivered into the tissue, and this direct delivery
might have simplified the mechanisms of the disease (Garcia de Aquino et al., 2009).
Whereas the periodontitis induced by ligature causes unnatural exaggerated plaque
retention and trauma into the local gingival tissue (Lohinai et al., 1998). Nevertheless,
by using LPS injection in the present study, osteoclasts in the resorptive pattern were
largely observed on the surface of dental alveolar bone in rats received LPS, but a
formative pattern was observed in rats did not receive LPS (Figure 2). The paeonol,
on the other hand, could significantly inhibit the LPS-induced osteoclast formation.
Similarly, paeonol prevented the ovariectomy-induced bone loss was recently
demonstrated in an animal study (Tsai et al., 2008). Because paeonol further in vitro
inhibited the induced osteoclast differentiation and the resorption activity of mature
osteoclasts, the authors suggested that paeonol inhibited osteoclastogenesis, which in
turn protect bone loss from ovariectomy.
For the experimental periodontitis with ligation, the periodontal destruction was
induced around molars with silk ligature (Figures 3 to 5). The periodontal destruction
and the dental alveolar bone resorption had been clearly demonstrated in many
previous experiments (Botelho et al., 2009; Cai et al., 2008; Cheng et al., 2010). In
the present study, we have successfully performed the ligature-induced periodontitis
model and verified that paeonol could significantly ameliorate the periodontal
destruction and inflammation in this model. In the present study, the effects of
paeonol on the induced periodontal destruction were confirmed by dental radiography,
micro-CT and histology. By using dental radiography, the quantitative measurements,
including the bone supporting ratio and the distance from CEJ to bone, were recorded
as the methods demonstrated in the previous study (de Souza et al., 2006; Holzhausen
et al., 2002). Although dental radiograph can easily provide dimensional images of
the bony structure around the tooth, the images by dental radiograph is
two-dimensional. Detailed surface morphology for tooth or bone was easily observed
by micro-CT, while the bone supporting ratio was merely evaluated by radiography.
Nevertheless, consistent findings were observed by the two radiographic methods.
Regrettably, the exact periodontal soft tissue changes could not be evaluated by the
two methods, but only by histology (Figure 5).
By microscopy, the distance from CEJ to bone and the attachment loss were
shown to be increased in the ligature group but that increase was inhibited in the
ligature-plus-paeonol groups (Figure 3) to the levels similar to those results obtained
by dental radiography and micro-CT (Figures 3 to 4). In combined with the findings
obtained from the LPS-induced osteoclast formation, all of our current results
indicated that paeonol might have an ameliorative effect on the dental alveolar bone
destruction during the induced experimental periodontitis. Moreover, a significantly
reduced ICT surface area was recorded in the ligature-plus-paeonol groups compared
with the ligature group which might further imply an anti-inflammatory activity
involved the amelioration. The detailed mechanism of the ameliorative effect of
paeonol in the periodontal destruction is still uncertain. However, the induced local
inflammation and tissue damage might be through the induction of proinflammatory
cytokines, such as IL-1, TNF, or IL-6 (Figure 6). The protective and destruction roles
of the pro-inflammatory cytokines against periodontal infection have been discussed
(Liu et al., 2010). These cytokines may further induce the production of secondary
mediators, resulting in an amplification of the inflammatory response and leading to
the destruction of connective tissue and osteoclastic bone resorption (Graves et al.,
2003). In the present study, nevertheless, the identification of the cell types at the site
that are predominantly producing the pro-inflammatory cytokines was not performed.
Further detailed evaluation is consequently needed.
Apart from the inhibitory effects of paeonol on cytokines in the present study,
the anti-inflammatory activities from paeonol have been observed in vitro and in vivo
in the literature. Orally administered paeonol has been shown to reduce the edema
induced by arachidonic acid in rats, and prevent LPS induced iNOS, COX-2 and ERK
activations in macrophages (Chae et al., 2009). The anti-inflammatory and analgesic
effects of paeonol have also been examined in carrageenan-evoked thermal
hyperalgesia in a paw model of rats. In that study, paeonol inhibited TNF-α, IL-1β
and IL-6 formation, but enhanced IL-10 production in the rat paw exudates (Chou,
2003). Paeonol has also been shown to inhibit the anaphylactic reaction by regulating
histamine, IL-1β, and TNF-α (Kim et al., 2004). Recently, a strong bactericidal effect
from paeonol has been assessed (Ngan et al., 2012); therefore, the direct effect of
paeonol on the bacteria at the sites with periodontitis should also be carefully
evaluated. These limited findings in the current literature all support and are
consistent with the discovery in the present study.
Paeonol is commonly known as an important compound in traditional Chinese
medicine. Paeonol has been thought to be a candidate for preventing various diseases
(Kim et al., 2009; Li et al., 2009) because of the thriving discoveries of its therapeutic
biological effects. Here, we provide an in vivo evidence illustrating that paeonol may
have a preventive potential in periodontitis.
In conclusion, the present in vivo experiments provided an evidence that paeonol
partially prevented the LPS-induced osteoclast formation on dental alveolar bony
surface and the ligature-induced periodontal alveolar bone loss in rats. Moreover, in
the animal model of ligature-induced experimental periodontitis, paeonol ameliorated
the enhanced gingival tissue inflammation (the ICT areas) and pro-inflammatory
cytokine elevations. Therefore, we suggested that paeonol might have preventive
potential on the gingival tissue inflammation and the dental alveolar bone loss during
the process of periodontitis.
Acknowledgements
This study was partially supported by the research grants from Tri-Service
General Hospital (TSGH-C98-111), Taipei, Taiwan, Republic of China.
Conflict of Interest
The authors declare no conflict of interest.
References
Botelho, M. A., J. G. Martins, R. S. Ruela, R. I, J. A. Santos, J. B. Soares, M. C.
Franca, D. Montenegro, W. S. Ruela, L. P. Barros, D. B. Queiroz, R. S. Araujo
and F. C. Sampio. Protective effect of locally applied carvacrol gel on
ligature-induced periodontitis in rats: a tapping mode AFM study. Phytother Res
23(10): 1439-1448, 2009.
Cai, X., C. Li, G. Du and Z. Cao. Protective effects of baicalin on ligature-induced
periodontitis in rats. J Periodontal Res 43(1): 14-21, 2008.
Chae, H. S., O. H. Kang, Y. S. Lee, J. G. Choi, Y. C. Oh, H. J. Jang, M. S. Kim, J. H.
Kim, S. I. Jeong and D. Y. Kwon. Inhibition of LPS-induced iNOS, COX-2 and
inflammatory mediator expression by paeonol through the MAPKs inactivation
in RAW 264.7 cells. Am J Chin Med 37(1): 181-194, 2009.
Chan, Y., C. H. Lai, H. W. Yang, Y. Y. Lin and C. H. Chan. The evaluation of Chinese
herbal medicine effectiveness on periodontal pathogens. Am J Chin Med 31(5):
751-761, 2003.
Chang, B., Y. Lee, Y. Ku, K. Bae and C. Chung. Antimicrobial activity of magnolol
and honokiol against periodontopathic microorganisms. Planta medica 64(4):
367-369, 1998.
Cheng, W. C., R. Y. Huang, C. Y. Chiang, J. K. Chen, C. H. Liu, C. L. Chu and E. Fu.
Ameliorative effect of quercetin on the destruction caused by experimental
periodontitis in rats. J Periodontal Res 45(6): 788-795, 2010.
Chou, T. C. Anti-inflammatory and analgesic effects of paeonol in
carrageenan-evoked thermal hyperalgesia. Br J Pharmacol 139(6): 1146-1152,
2003.
Cyong, J. and Y. Otsuka. A pharmacological study of the anti-inflammatory activity of
Chinese herbs. A review. Acupunct Electrother Res 7(2-3): 173-202, 1982.
de Souza, D. M., L. H. Ricardo, A. Prado Mde, A. Prado Fde and R. F. da Rocha. The
effect of alcohol consumption on periodontal bone support in experimental
periodontitis in rats. J Appl Oral Sci 14(6): 443-447, 2006.
Fiehn, N. E., B. Klausen and R. T. Evans. Periodontal bone loss in Porphyromonas
gingivalis-infected specific pathogen-free rats after preinoculation with
endogenous Streptococcus sanguis. J Periodontal Res 27(6): 609-614, 1992.
Garcia de Aquino, S., F. R. Manzolli Leite, D. R. Stach-Machado, J. A. Francisco da
Silva, L. C. Spolidorio and C. Rossa, Jr. Signaling pathways associated with the
expression of inflammatory mediators activated during the course of two
models of experimental periodontitis. Life Sci 84(21-22): 745-754, 2009.
Graves, D. T. and D. Cochran. The contribution of interleukin-1 and tumor necrosis
factor to periodontal tissue destruction. J Periodontol 74(3): 391-401, 2003.
Graves, D. T., D. Fine, Y. T. Teng, T. E. Van Dyke and G. Hajishengallis. The use of
rodent models to investigate host-bacteria interactions related to periodontal
diseases. J Clin Periodontol 35(2): 89-105, 2008.
Holzhausen, M., C. Rossa Junior, E. Marcantonio Junior, P. O. Nassar, D. M.
Spolidorio and L. C. Spolidorio. Effect of selective cyclooxygenase-2 inhibition
on the development of ligature-induced periodontitis in rats. J Periodontol 73(9):
1030-1036, 2002.
Huang, H., E. J. Chang, Y. Lee, J. S. Kim, S. S. Kang and H. H. Kim. A genome-wide
microarray analysis reveals anti-inflammatory target genes of paeonol in
macrophages. Inflamm Res 57(4): 189-198, 2008.
Kim, S. A., H. J. Lee, K. S. Ahn, E. O. Lee, S. H. Choi, S. J. Jung, J. Y. Kim, N. Baek
and S. H. Kim. Paeonol exerts anti-angiogenic and anti-metastatic activities
through downmodulation of Akt activation and inactivation of matrix
metalloproteinases. Biol Pharm Bull 32(7): 1142-1147, 2009.
Kim, S. H., S. A. Kim, M. K. Park, Y. D. Park, H. J. Na, H. M. Kim, M. K. Shin and
K. S. Ahn. Paeonol inhibits anaphylactic reaction by regulating histamine and
TNF-alpha. Int Immunopharmacol 4(2): 279-287, 2004.
Li, C. H. and S. Amar. Morphometric, histomorphometric, and microcomputed
tomographic analysis of periodontal inflammatory lesions in a murine model. J
Periodontol 78(6): 1120-1128, 2007.
Li, H., M. Dai and W. Jia. Paeonol attenuates high-fat-diet-induced atherosclerosis in
rabbits by anti-inflammatory activity. Planta medica 75(1): 7-11, 2009.
Lindhe, J. and S. Nyman. Clinical trials in periodontal therapy. J Periodontal Res
22(3): 217-221, 1987.
Listgarten, M. A. Nature of periodontal diseases: pathogenic mechanisms. J
Periodontal Res 22(3): 172-178, 1987.
Liu, Y. C., U. H. Lerner and Y. T. Teng. Cytokine responses against periodontal
infection: protective and destructive roles. Periodontol 2000 52(1): 163-206,
2010.
Lohinai, Z., P. Benedek, E. Feher, A. Gyorfi, L. Rosivall, A. Fazekas, A. L. Salzman
and C. Szabo. Protective effects of mercaptoethylguanidine, a selective inhibitor
of inducible nitric oxide synthase, in ligature-induced periodontitis in the rat. Br
J Pharmacol 123(3): 353-360, 1998.
Mi, X. J., S. W. Chen, W. J. Wang, R. Wang, Y. J. Zhang, W. J. Li and Y. L. Li.
Anxiolytic-like effect of paeonol in mice. Pharmacol Biochem Behav 81(3):
683-687, 2005.
Mimura, K. and S. Baba. Studies on the biotransformation of paeonol by means of
isotope tracer techniques.--Synthesis and physicochemical properties of
carbon-13 and deuterium labeled compounds. Radioisotopes 28(12): 739-744,
1979.
Ngan, L. T., J. K. Moon, T. Shibamoto and Y. J. Ahn. Growth-inhibiting, bactericidal,
and urease inhibitory effects of Paeonia lactiflora root constituents and related
compounds on antibiotic-susceptible and -resistant strains of Helicobacter pylori.
Journal of agricultural and food chemistry 60(36): 9062-9073, 2012.
Okubo, T., F. Nagai, T. Seto, K. Satoh, K. Ushiyama and I. Kano. The inhibition of
phenylhydroquinone-induced oxidative DNA cleavage by constituents of
Moutan Cortex and Paeoniae Radix. Biol Pharm Bull 23(2): 199-203, 2000.
Page, R. C. The role of inflammatory mediators in the pathogenesis of periodontal
disease. J Periodontal Res 26(3 Pt 2): 230-242, 1991.
Robinson, M., D. Hart and G. H. Pigott. The effects of diet on the incidence of
periodontitis in rats. Lab Anim 25(3): 247-253, 1991.
Rotelli, A. E., T. Guardia, A. O. Juarez, N. E. de la Rocha and L. E. Pelzer.
Comparative study of flavonoids in experimental models of inflammation.
Pharmacol Res 48(6): 601-606, 2003.
Schwartz, J., F. L. Stinson and R. B. Parker. The passage of tritiated bacterial
endotoxin across intact gingival crevicular epithelium. J Periodontol 43(5):
270-276, 1972.
Tsai, H. Y., H. Y. Lin, Y. C. Fong, J. B. Wu, Y. F. Chen, M. Tsuzuki and C. H. Tang.
Paeonol inhibits RANKL-induced osteoclastogenesis by inhibiting ERK, p38
and NF-kappaB pathway. European journal of pharmacology 588(1): 124-133,
2008.
Wong, R. W., U. Hagg, L. Samaranayake, M. K. Yuen, C. J. Seneviratne and R. Kao.
Antimicrobial activity of Chinese medicine herbs against common bacteria in
oral biofilm. A pilot study. Int J Oral Maxillofac Surg 39(6): 599-605, 2010.
Legends for Figures
Figure 1. The periodontal or dental alveolar bony loss measured by dental
radiography. The radiographic film on left presents the shadow of the rat
hemi-mandible, as well as the molars in the jaw. The right image, the high
magnification of the radiography, presents the measurements of the ratio of
periodontal bone supporting (PBSr) and the distance from the cemento-enamel
junction (CEJ, arrow) to the most coronal level of alveolar bone (arrowhead) at the
distal and mesial root surfaced of first mandibular molar, respectively. (Abbreviations
in radiography: A, the root apex; B’, the deepest bony defect; B-B’, the level of
deepest bony defect; C, the cusp tip; PBSr = the distance of AB/the distance of AC
×100%)
Figure 2. Effect of paeonol on LPS-induced periodontitis on palatal surface of
molars. The upper histographs present the palatal histology of rats in PBS, LPS (5
μg/mL) and LPS-plus-paeonol groups (5μg/mL LPS and 40mg/kg paeonol). The
lower plots show that the histometric comparison of the number of osteoclast and the
nucleus number per ostoclast among the three animal groups. (TRAP staining,
magnification  40 and  200 for the first and second rows, respectively; arrowheads
indicate the bony surfaces of dental alveoli and arrow points out an osteoclast within
the lacuna) (n = 5; *p < 0.05)
Figure 3. The effect of paeonol on the ligature-induced bone loss around the
mandibular first molars examined by digital dental radiography. The bone loss
was determined by the ratio of periodontal bone support (PBSr) (A) and by the
radiographic distance from CEJ to bone (B). On the right and left first mandibular
molars, the ratio was calculated along the long axis of distal root and the distance was
recorded on the mesial surfaces of the root, respectively. (a-c: subgroups by post-hoc
analysis, if significant difference obtained with the repeated measures analysis of
variance at p < 0.05)
Figure 4. The effect of paeonol on the ligature-induced bone loss examined by
micro-CT. Upper images present the reconstructed 3-dimensional morphology of the
maxillary and mandibular molars. The tomographic distances from CEJ to bone were
recorded at 4 sites of earh first molars on the right and left jaws, including the mesioand disto-buccal, and the mesio- and disto-palatal sites. The lower plot showed the
effects of paeonol on the distances between CEJ and bone crest were analyzed among
four animal groups using the repeated measures analysis of variance. (N-L:
non-ligature group, Lig: ligature group, L+P40: the group of ligature plus 40mg/kg
paeonol, and L+P80: the group of ligature plus 80mg/kg paeonol) (*: significant
difference at p < 0.05 by the repeated measures analysis of variance; a-c: subgroups
by post-hoc analysis, if significant difference obtained)
Figure 5. Histological observations and histometric measurements of the
maxillary interdental tissue in four animal groups. Histographs present the
inter-proximal periodontal tissue between the maxillary first and second molars of rats
from the non-ligature, the ligature (Lig) and the two Lig+paeonol groups, with the
daily dose of 40 or 80 mg/kg paeonol (H & E stain, 40X). Arrows indicate the level of
cemento-enamel junction (CEJ) and arrowheads indicate the most coronal level of
alveolar bone crest (ABC). The histolographs at higher magnifications (200X) are
shown in the second row. The lower plots demonstrate the comparisons of histometric
measurements, including the periodontal tissue loss, the histological bone level
(distance from enamel to bone), the connect tissue attachment, and the gingival tissue
inflammation among the animal groups. (JEc: the most coronal level of epithelial
cells, JEa: the most apical level of epithelial cells, ICT area: the surface area of
inflammatory cell-infiltrated connective tissue) (a-c: subgroups by One-way ANOVA
and Duncan post-hoc, at p < 0.05)
Figure 6. The effect of paeonol on the gingival mRNA expression of
pro-inflammatory cytokines. The upper left illustrates the representative gel images
of mRNA expressions of IL-1ß , TNFα , IL-6, and GAPDH. The quantitative
comparisons of the relative intensities (to GAPDH) of mRNA expression of the
pro-inflammatory cytokines in 4 groups were presented in the three drew plots. (a-c:
subgroups by One-way ANOVA and Duncan post-hoc, at p < 0.05)