Supplementary Methods
Generation of MR1 “knockout” mice
Based on the MR1 genomic sequence (GenBank Accession Number: AF035672 (ref 4 of
main text)), two 6 kb fragments flanking exons 2 and 3 were amplified with the oligo pairs
(5’-3’) 5’-TGGGAGGCAGCGGCCGCCTAATTTCTGAGTTCG-3’ (Not I),
5’-AAATATCTCCTCGAGTGGGTCCCTGAGGAG-3’ (Xho I)
and 5’-GAATGTAACACCTCGAGGGGCACCTCTATCAA-3’
(Xho I), 5’-TTGCCTGGGCCCGGGCATGCTTCCCTCCATATAAT-3’ (Apa I)
respectively, using Expand PCR (Roche Biochemicals). The fragments were digested with
the appropriate restriction enzymes and sequentially cloned into pBluescript (SK+). An Xho I
fragment containing a neomycin resistance gene driven by the phosphoglycerate kinase
promoter (pgk-neor) flanked by loxP sites (a generous gift from Philippe Kastner, IGBMC,
Illkirch) was inserted between the two and a clone containing pgk-neor oriented opposite to
MR1 transcription was chosen. The targeting fragment was excised from the vector with Not
I and Mun I and purified by gel electrophoresis; 14 g of the fragment was electroporated into
1.107 E14.1 ES cells (original vial generously provided by Toru Myazaki, Dallas). 13 of 284
colonies expanded were correctly targeted as assessed by Southern blot analysis using EcoR I
and EcoR V digested genomic DNA and 3’ and 5’ external probes. Chimeras capable of
transmitting the mutation were obtained from four MR1 clones injected into C57BL/6
blastocysts. Heterozygote offspring were bred to mice expressing the Cre recombinase under
control of the CMV promoter1; the pgk-neor fragment was efficiently deleted in heterozygous
mutant mice carrying the Cre transgene as assessed by PCR and Southern blot analysis. PCR
typing of genomic DNA isolated from tail tissue was carried out using the following oligos:
MR1 5’ 8763-8783 AGCTGAAGTCTTTCCAGATCG, MR1 9188-9168 rev
ACAGTCACACCTGAGTGGTTG, MR1 10451-1043, GATTCTGTGAACCCTTGCTTC
and pgk-neo 3' GAGATCAGCAGCCTCTGTTCC which (at 60oC anneal) amplify all three
possible alleles: endogenous (+) 425 bp, neo insertion (neo) 320 bp, and post cre deletion (-),
371bp.
Lamina propria and IEL Cell preparation
Briefly, the gut was flushed several times with PBS to eliminate intestinal content, and after
peyer’s patches removal, the intestine was opened longitudinally and washed again in cold
PBS. The epithelium was eliminated by incubating 5 cm pieces twice in 60 ml of PBS + 3
mM EDTA for 10 min, then twice in 15 ml of CO2-independant medium containing 1%
dialysed FCS, 1 mM EGTA and 1.5 mM MgCl2 for 15 min, at 37°C under shaking. IEL were
recovered by centrifugation on a Lympholyte M gradient. To obtain lamina propria
lymphocytes, the gut pieces were vortexed for 2 min, cut in 0.5 cm pieces and stirred for 90
min at 37°C in 30 ml of CO2-independant medium supplemented with 20% FCS, 100 U/ml
collagenase and 5 U/ml DNase I. At the middle and at the end of the incubation, the
suspension was flushed several times through a syringe to increase dissociation. The pellet
was washed, filtered through a 22 m cell strainer and the LPL were separated by
centrifugation over a lympholyte M gradient.
Surface biotinylation and Western Blot
Surface biotinylation followed by streptavidin bead precipitation and western blot with an
anti-GFP enabled to check for membrane expression of MR1A. Briefly, 107 cells were
surface biotinylated, and resuspended in lysing buffer in the presence of antiproteases (0.5 %
Triton, 300 mM NaCl, 50 mM Tris, pH 7.4, and 10 µg/ml leupeptin, chemostatin, aprotinin,
pepstatin, and N-ethyl maleimide) and precipitated with streptavidin agarose beads. The
precipitate was electrophoresed on a 8 % polyacrylamide SDS gel in denaturing conditions.
After transfer on polyvinylidone fluoride membranes (Millipore), membranes were revealed
with anti-GFP antibody and chemiluminescence (Roche) and visualized in a Storm 860
machine (Molecular Dynamics).
T-T hybridoma
Among 356 growing wells, 58 were positive for the mV19-J33 canonical sequence. As the
mV19-J33+ cell starting frequency was around 2-5 %, there is clearly a bias towards the
fusion of mV19-J33 positive cells, which might reflect their in vivo activation. 9
hybridomas were V6 and 16 were V8 confirming the results obtained with another
previously published batch (ref 3 main text).
Supplementary references
1.
Schwenk, F., Baron, U. & Rajewsky, K. A cre-transgenic mouse strain for the
ubiquitous deletion of loxP- flanked gene segments including deletion in germ cells.
Nucleic Acids Res 23, 5080-1. (1995).