Supplementary Methods
Production and injection of dsRNA
For the production of dsRNA, the following primer pairs containing either T3
or T7 promoter tails (underlined) were used to amplify specific regions of N2 Bristol
genomic DNA: SPD-2 (aattaaccctcactaaaggtgcatgcgaataagacgaag, taatacgactcactatagg
ttgcggacacagaaaacaaa), ZYG-1 aattaaccctcactaaaggtggacggaaattcaaacgat, taatacgactc
actataggaacgaaattcccttgagctg), SAS-5 (aattaaccctcactaaaggaggacaaaacccccagtacc, taa
tacgactcactataggagaagcgagtccgttgtcat), SAS-6 (aattaaccctcactaaaggccgctccgatgattttga
at, taatacgactcactataggccaagaacaggcttgaatga), SAS-4 (aattaaccctcactaaaggtcctgtggtac
agcttccaa, taatacgactcactatagggtgaggctcaaacgggaata). The PCR products were gel
purified and used as templates for 50l T3 and T7 transcription reactions (Ambion).
The reactions were cleaned using an RNeasy kit (QIAGEN) and the RNA eluted in a
final volume of 60l. The complementary T3 and T7 reactions were pooled and
mixed with 60l of 3X injection buffer (60mM KPO4 pH 7.5, 9 mM K-Citrate pH
7.5, 6% PEG 6000). Annealing was performed by first incubating the sample at 68C
for 10 min followed by a 30 min incubation at 37C. The resulting dsRNA (1-1.3
mg/ml) was injected in L4 hermaphrodites and the worms incubated in the presence
of the dsRNA for 24 hours at 20°C (SPD-2), 24 hours at 25°C (ZYG-1), 26-27 hours
at 25°C (SAS-4), 24 hours at 20°C (SAS-5) or 24 hours at 20°C (SAS-6) to ensure the
full penetrance of the centriole duplication phenotypes.
Feminization of worms
For the centriole protein recruitment assays, feminized worms were used to
ensure that the centriole pair contributed by the sperm was unlabelled and provided
only by males, not hermaphrodites. This was necessary since the GFP::SAS-4,
GFP::SAS-5 and GFP::SAS-6 chimeras are expressed in the male germline of
hermaphrodites (data not shown). Transgenic lines were fed bacteria expressing
dsRNA to FOG-1 (C. Eckmann, MPI-CBG). Bacteria were grown overnight at 37°C
in 2ml LB containing tetracycline (5g/ml) and ampicillin (100g/ml).
The
following day, bacteria were washed 3 times in LB media containing 100g/ml
ampicillin. Washed bacteria were resuspended in 100l LB media and seeded on 6
cm NGM plates containing carbenicillin (25g/ml) and IPTG (1mM). The feeding
plates were incubated overnight at 30°C before seeding them with 3-5 adult
hermaphrodites and incubating either at 25°C for 3 days, at 20°C for 4 days or at
16°C for 5 days at which time only young feminized adults were found. For each
experiment, the efficiency of feminization was monitored and no fertilized eggs nor
recently hatched larvae (L1) could be detected. For microinjection of dsRNA, young
feminized adults containing 3-10 oocytes were used. After 1 hour post-injection
recovery, the mating with WT males was performed on 6 cm NGM plates pre-seeded
with 5-10ul OP50 bacterial suspension. On each mating plate 4 feminized injected
worms and 10 WT males were placed. Plates were then incubated depending on the
RNAi requirements (see above).
GFP worm line used in this study
The GFP::SPD-2 (TH42), GFP::SPD-5 (TH40) and GFP::SAS-4 (TH26) used
in this study have been described previously 1-3. To generate GFP::SAS-5 transgenic
worms (TH61), primers (cgggatccatgaataattacgacgacttaccctgc, tccccccgggtttcctgcgag
cgtatttttcacg) containing BamHI or XmaI sites (in bold) were used in a PCR reaction
using N2 genomic DNA as a template. The resulting fragment was cloned in frame to
GFP to generate an N-terminal GFP::SAS-5 gene fusion in a vector containing pie-1
promoter sequence to ensure expression of the transgene in the germline and spliced
unc-119(+) as a selection marker. To generate GFP::SAS-6 transgenic worms (TH62
and TH64), primers (cgggatccatgactagcaaaattgcattattcg, ggactagtttatcgttgagcgggtgg)
containing BamHI or SpeI sites (in bold) were used in a PCR reaction using N2
genomic DNA as a template. The resulting fragment was cloned in frame to GFP to
generate an N-terminal GFP::SAS::6 gene fusion in a vector containing pie-1
promoter sequence to ensure expression of the transgene in the germline and spliced
unc-119(+) as a selection marker. The strains were constructed by high-pressure
ballistic bombardment (BioRad) of DP38 unc-119(ed3) homozygotes.
Immunofluorescence microscopy
For immunofluorescence labelling, worms were dissected onto poly-lysine
coated microscope slides (Sigma), embryos freeze-cracked in liquid nitrogen for 2
min before fixing in methanol at -20C for 20 min. Embryos were rehydrated in PBS
for 10 min and non-specific sites blocked for 20 min in PBS-BT (PBS containing 2%
BSA and 0.05% Tween-20). Primary antibodies were applied at 1 g/ml for 60 min
at RT in PBS-BT before washing 3 times for 5 min in PBS-BT. Secondary antibodies
were applied for 60 min at RT in PBS-BT, the samples washed as above before
mounting. Three dimensional data sets were acquired on a DeltaVision imaging
system (Applied Precision) equipped with a Olympus IX70 microscope, a Coolsnap
camera (Roper Scientific) and a 100x 1.4 NA PlanApochromat objective (Olympus).
Images were computationally deconvolved using the SoftWork software package
(version 3.4.4) and shown as two-dimensional projections.
Antibodies used in this study
Rabbit polyclonal antibodies against SAS-4 used in this study have previously
been described 2. Sheep anti-GFP polyclonal antibodies were from Francis Barr 4.
Anti -tubulin monoclonal antibody DM1 was from Sigma. Direct labelling of antiSAS-4 (Alexa Fluor647) and anti-GFP (Alexa Fluor488) antibodies was
performed using Alexa Fluor® carboxylic acid succinimidyl ester dyes according to
the manufacturer’s recommendation and used at a final concentration of 1 g/ml
(Molecular Probes). Antibodies to ZYG-1 used in this study were generated against a
GST-fusion protein. Specific primers for ZYG-1 (aagcgatcgccgcgggatggacgacgaca,
aagcggccgcacaactgtgaacggtttcga) containing SgfI or NotI (in bold) were used in a
PCR reaction using N2 cDNA as template. The fragments were cloned in frame to
GST in a pGEX vector (Amersham Pharmacia Biotech) using the indicated restriction
sites and the purified fusion proteins injected into rabbits. For affinity purification,
the same fragment was cloned in frame to MBP in the pMAL-c2 vector and the fusion
proteins purified essentially as suggested by the manufacturer (New England
Biolabs).
The MBP::ZYG-1 fusion protein was coupled to 1 ml NHS HiTrap
columns (Amersham Pharmacia Biotech), and the affinity purification of the serum
performed using standard procedure.
Specimen preparation for correlative light and electron microscopy
Laser-induced chemical fixation of isolated and staged embryos was carried out
essentially as described 5.
For the preparation of isolated embryos for electron
tomography hermaphrodites were dissected in M-9 buffer containing 20% BSA
(Sigma-Aldrich). Isolated embryos were collected into capillary tubing and early
embryonic development was observed using light microscopy. Staged embryos were
transferred to specimen carriers and ultra rapidly frozen using the Leica
EMPACT2+RTS high-pressure freezer
6
.
The staged embryos were freeze-
substituted over 2 days at -90°C in anhydrous acetone containing 1% OsO4 and 0.1%
uranyl acetate and subsequently infiltrated and thin-layer embedded in Epon/Araldite.
Serial semi-thick sections (300-400 nm) were cut using a Leica Ultracut UCT
microtome.
Sections were collected on Formvar-coated copper slot grids and
poststained with 2% uranyl acetate in 70% methanol followed by Reynold’s lead
citrate.
Intermediate-voltage electron tomography
For electron tomography, 15-nm colloidal gold particles (Sigma-Aldrich) were
attached to both surfaces of the semi-thick sections to serve as fiducial markers for
subsequent image alignment. The specimens were placed in a tilt-rotate specimen
holder (Model 650; Gatan, Pleasanton, CA) and tomographic data sets recorded using
a TECNAI F30 intermediate-voltage electron microscope (FEI, The Netherlands)
operated at 300 kV. Images were captured every 1° over a ± 60° range using a Gatan
2K x 2K CCD camera at a pixel size of 1 nm. For the collection of double tilt data
sets the grids were then rotated 90°, and a similar tilt series was acquired. For image
processing, images were transferred to a Dell Linux workstation, and the tilted views
were aligned using the positions of the colloidal gold particles as fiducial points.
Tomograms were computed for each tilt axis using the R-weighted back-projection
algorithm 7. For double tilt data sets, the two tomograms were aligned to each other
and combined 8. Tomograms were displayed and analyzed using the IMOD software
package 9. This program allowed to step through serial slices extracted from the
tomogram and to track and model objects of interest in 3-D. The ratio of the section
thickness, as defined by settings of the microtome, to the section’s thickness
measured after microscopy was used to calculate a “thinning factor”, which was then
applied to correct the tomogram’s dimension along the beam axis 10-12.
Modeling and analysis of tomographic data
In total, we recorded 5 serial double-tilt data sets of centrosomal poles at pronuclear
appearance, 5 at pronuclear migration, 5 at pronuclear rotation, and 6 at mitosis
(Supplementary Table 1). In addition, we acquired 2 data set of zyg-1(RNAi), 2 of
sas-4(RNAi), and 3 of sas-6(RNAi) isolated embryos. Using serial slices extracted
from the tomograms, we modeled the central tube and the centriolar microtubules of
mother and daughter centrioles in both wild-type and RNAi embryos. Centriole
formation and the structure of assembly intermediates were analyzed by extracting a
slice of image data 1-voxel thick and adjusting its orientation to contain the centriole
in either longitudinal orientation or in cross section. A projection of the 3-D model
was then displayed and rotated to study its 3-D geometry. For this display in 3-D,
substructures of the centriole were shown as tubular graphic objects. Measurements
of centriole components were extracted from model contour data.
Reference
1.
2.
3.
4.
5.
6.
Cowan, C. R. & Hyman, A. A. Centrosomes direct cell polarity independently
of microtubule assembly in C. elegans embryos. Nature 431, 92-6 (2004).
Kirkham, M., Muller-Reichert, T., Oegema, K., Grill, S. & Hyman, A. A.
SAS-4 is a C. elegans centriolar protein that controls centrosome size. Cell
112, 575-87 (2003).
Pelletier, L. et al. The Caenorhabditis elegans centrosomal protein SPD-2 is
required for both pericentriolar material recruitment and centriole duplication.
Curr Biol 14, 863-73 (2004).
Neef, R. et al. Phosphorylation of mitotic kinesin-like protein 2 by polo-like
kinase 1 is required for cytokinesis. J Cell Biol 162, 863-75 (2003).
Dammermann, A. et al. Centriole assembly requires both centriolar and
pericentriolar material proteins. Dev Cell 7, 815-29 (2004).
Manninen, A. et al. Caveolin-1 is not essential for biosynthetic apical
membrane transport. Mol Cell Biol 25, 10087-96 (2005).
7.
8.
9.
10.
11.
12.
Gilbert, P. F. The reconstruction of a three-dimensional structure from
projections and its application to electron microscopy. II. Direct methods. Proc
R Soc Lond B Biol Sci 182, 89-102 (1972).
Mastronarde, D. N. Dual-axis tomography: an approach with alignment
methods that preserve resolution. J Struct Biol 120, 343-52 (1997).
Kremer, J. R., Mastronarde, D. N. & McIntosh, J. R. Computer visualization
of three-dimensional image data using IMOD. J Struct Biol 116, 71-6 (1996).
O'Toole, E. T., Giddings, T. H., McIntosh, J. R. & Dutcher, S. K. Threedimensional organization of basal bodies from wild-type and delta-tubulin
deletion strains of Chlamydomonas reinhardtii. Mol Biol Cell 14, 2999-3012
(2003).
O'Toole, E. T. et al. Morphologically distinct microtubule ends in the mitotic
centrosome of Caenorhabditis elegans. J Cell Biol 163, 451-6 (2003).
O'Toole, E. T., Winey, M. & McIntosh, J. R. High-voltage electron
tomography of spindle pole bodies and early mitotic spindles in the yeast
Saccharomyces cerevisiae. Mol Biol Cell 10, 2017-31 (1999).