Making an Affinity Library in Yeast
Making a mutant library using degenerate oligos is a similar process to the random error
prone method with some extra work to design primers and run a SOE PCR.
We order our primers from IDT and specify for those codons we want mutated to be NNS
where N is any nucleotide and S is a G or C. We use S at the 3rd position because you
can still get all of the amino acids and you decrease the library size you need to generate
(32 condons possible instead of 64). You also exclude the possibility of two stop codons.
The largest number of amino acids we have mutated is 5 amino acids (15 nucleotides)
because of the large library size needed to cover that many amino acids. To fully cover 5
amino acids would require a library size of 3x107 (325) and most of the time the library
sizes people make is around 1x106.
Usually you will need to order two primers and can use the standard flanking primers you
used for error prone PCR before. One of the new primers will be around ~80bp. (50 bp
for overlap, the 15 NNS bp, and then 15 more unmated bps). The other primer only needs
the 50 b.p. overlap region. I included a powerpoint slide to illustrate the process.
Here is an example of the primers for an affinity library (3.L2 TCR).
Forward = 5' to 3' (88 bp)
CATCACTGGTACTCTAGCTACAGACACCGCGGTGTACTTCTGTGCTACAACCT
CANNSNNSNNSNNSNNSCCTACGTTTGGGAAAGGG
Reverse = 5' to 3' (52 bp)
GGTTGTAGCACAGAAGTACACCGCGGTGTCTGTAGCTAGAGTACCAGTGATG
To make degenerate libraries we use Splicing by Overlap Extention PCR (SOE PCR)
(Starwalt SE et al. 2003 Protein Engineering). This involves making two PCRs with a 50
base pair overlap that are then spliced together using a second PCR using the flanking
primers and the first PCRs as templates. The flanking primers should have ~100 b.p.
overlap with the digested vector so when the SOE PCR is finished you can do the same
homologous recombination procedure to get the mutated PCR product into the yeast
display vector.