Supplementary Information
Construction of hCERTL/GPBP
Human CERTL/GPBP ORF was constructed by inserting a 78-bp DNA into
hCERT/GPBP∆26. For this, a 1.2-kbp DNA (template, pBS/hCERT, primers, #3 and #7) and
0.7-kbp DNA (template, pBS/hCERT, primers, #8 and #5) were amplified by PCR, and
purified. Then, PCR was conducted with a mixture of these two purified fragments as a
template and a primer set (#3 and #7). The 1.9-kbp product was cloned into pBlueScript to
obtain pBS/hCERTL. hCERTL was also subcloned into pLIB.
Isolation of CERT cDNA from CHO-K1 and LY-A cells
To determine the full-length cDNA sequence of CHO-K1 cell-derived CERT
(cCERT), 5’-rapid amplification of cDNA ends (RACE) and 3’-RACE were performed with a
SMART RACE cDNA amplification kit (Clontech), Pyrobest DNA polymerase (Takara), and
the gene-specific primer #19 for 5’-RACE or primer #20 for 3’-RACE. The contig of the
RACE products gave a 2473-bp DNA sequence that contains a 1794-bp ORF (GenBank
accession no., AY323813).
The cCERT ORF sequence from LY-A cells was obtained by reverse transcriptionPCR. A total RNA fraction was prepared from LY-A cells with an RNA extraction kit
(Nippon gene). Then, first-strand cDNA was prepared with the SuperScript First Strand
synthesis system (Invitrogen), and PCR was conducted with primers #21 and #22 and
Pyrobest DNA polymerase. The amplified product was cloned into pBlueScript, and
sequenced. The ORF encoded by the cloned DNA was named cCERT(G67E), according to
its mutation. Of note, two independent PCRs gave an identical sequence, indicating that the
Page 1 of ‘Supplementary Information’
G67E mutation is not a PCR artifact. Similarly, the cCERT ORF from CHO-K1 cells was
amplified and cloned.
For construction of DNA encoding cCERTs having an FL
(AspTyrLysAspAspAspLys)-epitope sequence at the carboxyl terminus, a PCR product
(template, pBS/cCERT; primers, #23 and #6) was digested with Cla I and Xho I, and the
resultant 0.3-kbp fragment was purified. Then, the Cla I/Xho I region of each of the cCERT
and cCERT(G67E) ORFs was replaced by the purified fragment. The resultant ORF was
subcloned into pLIB.
For fusion of GFP to the carboxy terminus of cCERTs, a 1.8-kbp PCR product
(template, pBS/cCERT or pBS/cCERT(G67E); primers, #3 and #24) was digested with Eco
RI and Xho I. The resultant fragment was inserted into Eco RI/Sal I sites of pEGFP-N3
(Clontech).
Construction of deletion mutants of CERT
DNA constructs encoding the following mutants were made by PCR with pBS/hCERT
as a template. Sets of primers used are: #9 and #5 for hCERT∆PH, #3 and #10 for
hCERT∆ST, #13 and #14 for PH hCERT, #15 and #16 for MR hCERT, and #17 and #18 for
ST hCERT. PH cCERT and PH cCERT(G67E) were similarly constructed by using
pBS/cCERT and pBS/cCERT(G67E), respectively, as the template. For hCERT∆MR, a 0.4kbp DNA (template, pBS/hCERT, primers, #3 and #11) and a 0.8-kbp DNA (template,
pBS/hCERT, primers, #12 and #5) were amplified by PCR, and purified. Then, PCR was
performed with a mixture of these two purified fragments as a template and a primer set (#3
and #7) to obtain a 1.1-kbp product encoding hCERT∆MR. hCERT∆PH, hCERT∆ST, and
hCERT∆MR were subcloned into the Eco R I/Xho I sites of pET-28a(+) in-frame. PH
Page 2 of ‘Supplementary Information’
hCERT, PH cCERT, PH cCERT(G67E), MR hCERT, and ST hCERT were subcloned into
the Hin d III/Xho I sites of pET-28a(+).
We verified the absence of unwanted mutations in the cloned PCR products by
sequencing.
Additional information to the assay of ceramide extraction
Egg yolk PtdCho and PtdEtn were purchased from Avanti-Polar Lipids. [Palmitoyl-1C] N-palmitoyl-D–erythro-sphingosine (55 mCi/mmol), [oleoyl-1-14C]dioleoyl -rac-glycerol
14
(55mCi/mmol), [cholinemethyl-14C]sphingomyelin (55 mCi/mmol), [dipalmitoyl-1-14C] L-αdipalmitoylphosphatidylcholine (55 mCi/mmol), [2-palmitoyl-9,10-3H(N)] L-αdipalmitoylphosphatidylcholine (40 Ci/mmol), and D-erythro -[3-3H]sphingosine (20
Ci/mmol) were purchased from American Radiolabeled Chemicals. [1,2(n)-3H]cholesterol
(49 Ci/mmol) was from Amersham Bioscience. Assays of the extraction of various lipid
types by hCERT were performed similarly using various radioactive lipids in place of
ceramide, except for the assay of extraction of PtdCho, where 0.3 µg of donor vesicles
consisting of egg yolk PtdCho, PtdEtn, and [dipalmitoyl-1-14C] L-α-dipalmitoyl PtdCho
(195:65:65, mol/mol) were incubated with 600 pmol of CERT or CERT∆ST.
Extraction of ceramide from isolated ER membranes was performed as follows. The
ER membranes were isolated from CHO-K1 cells by the method of Balch et al (W. E. Balch,
W. G. Dunphy, W. A. Braell, and J. E. Rothman , 1984: Cell, 39, 405-416). The isolated ER
membranes (2 mg protein) were incubated in 10 ml of 50 mM Hepes-NaOH buffer (pH 7.4)
containing 2.5 mM dithiothreitol, 10 µM palmitoyl CoA and 1 µM D-erythro -[33
H]sphingosine (2.0 Ci/mmol) at 37°C for 30 min. After centrifugation (105 x g, 4°C, 1 hour),
the precipitated membranes were suspended in 5 ml of HNE [50 mM Hepes-NaOH (pH 7.4)
containing 100 mM NaCl and 0.5 mM EDTA], centrifuged again, and resuspend in 500 µl of
Page 3 of ‘Supplementary Information’
HNE. Then, the labelled ER membranes (200 µg) were incubated in 100 µl of HNE in the
presence or absence of purified hCERT (450 pmol; 32 µg) or bovine serum albumin (4.5
nmol; 297 µg) at 37°C for 30min, and centrifuged at 105 x g at 4°C for 1 hour. Then, lipids
were extracted from the supernatant and pellet fractions, and separated by TLC with a solvent
of chloroform/methanol/acetic acid (94/5/5, vol/vol). Radioactive lipids separated on TLC
plates were analysed with BAS1800 image analyser.
Assay of intermembrane transfer of ceramide
Porcine-derived lactosylceramide was purchased from Matreya, and Ricinus
communis lectin was from Honen Co. Donor vesicles consisting of PtdCho, PtdEtn,
lactosylceramide, and [14C]ceramide (55 mCi/mmol) (64:16:8:1, mol/mol), and acceptor
vesicles consisting of PtdCho and PtdEtn (4:1, mol/mol). If necessary, [2-palmitoyl-9,103
H(N)] L-α-dipalmitoylphosphatidylcholine (40 Ci/mmol) was also added to the donor
vesicles at 0.007 mol%. Small single bilayer vesicles were formed in buffer A (20 mM
Hepes-NaOH (pH 7.4) containing 50 mM NaCl and 1 mM EDTA) by sonication with a
probe-type sonicator. After sonication, the donor preparation was centrifuged, and the
supernatant fraction was used as donor vesicles. In the standard assay, donor vesicles (35 µg),
acceptor vesicles (320 µg), and purified recombinant hCERT (2 pmol) were incubated in 100
µl of buffer A at 37°C for 10 min. After addition 30 µl of 2.5 mg/ml of Ricinus communis
lectin to the reaction mixture, the mixture was incubated on ice for 15 min, and then
centrifuged (12,000 x g, 3 min, 4°C). The radioactivity of the supernatant was determined as
a measure of the ceramide transferred to acceptor vesicles. Background radioactivity from
CERT-free controls was subtracted from the radioactivity of each sample.
Assay of binding to phosphoinositides.
Page 4 of ‘Supplementary Information’
After being incubated in buffer A (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1%
Tween 20, and 3% bovine serum albumin) at 25 °C for 1 h, PIP-StripsTM (Echelon
Biosciences) were incubated with purified CERT recombinants (15 pmol/ml) in 1 ml of buffer
A at 4°C for 16 h. After being washed eight times with 4 ml of buffer B (10 mM Tris-HCl,
pH 7.5, 150 mM NaCl, and 0.1% Tween 20), the strips were incubated with the anti-Hisprobe antibody (SantaCruz; 1:600 dilution) in 3 ml of buffer B at 25°C for 1 h, washed, and
incubated with a horseradish peroxidase-conjugated secondary antibody. After being washed
with buffer B, the strips were processed for detection with an enhanced chemiluminescence
kit (Amersham Bioscience).
Page 5 of ‘Supplementary Information’
List of oligonuleotides used as PCR primers
#
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
Nucleotide sequence
5’-GCCCTCACTCCTTCTCTAGGCG-3’
5’-CTTAAGCTAGCTTGCCAAACCTACAGG-3’
5’-CAGAATTCACCATGTCGGATAATCAGAGCTGG-3’
5’CAGAATTCACCATGGACTACAAGGACGACGACAAAATGTCGGATAATC
AGAGCTGG-3’
5’-GGCTCGAGCTAGAACAAAATAGGCTTTCCTGC-3’
5’GGCTCGAGCTATTTGTCGTCGTCCTTGTAGTCGAACAAAATAGGCTTT
CCTGC-3’
5’CAGAGGCACTGACTAGATCAATGGAAGACATGGAGGAAGAGCGACTA
TAGGGCTTTTGGACAAATCTATGTGTCC-3’
5’CCATTGATCTAGTCAGTGCCTCTGATGATGTTCACAGATTCAGCTCCCA
GGTTGAAGAGATGGTGCAGAACC-3’
5’-CAGAATTCACCATGGAATCTGGATATGGATCTGAATC-3’
5’-GGCTCGAGCTATTGGACAAATCTATGTGTCCC-3’
5’-CTCTTCAACCTTAGTCTTGTGCTGTTCAATGGC-3’
5’-CAGCACAAGACTAAGGTTGAAGAGATGGTGCAG-3’
5’-CACAAGCTTCGGATAATCAGAGCTGGAAC-3’
5’-GGCTCGAGCTAAGATCTAGTCTTGTGCTGTTCAATGGC-3’
5’-CACAAGCTTCGGAATCTGGATATGGATCTGAATCC-3’
5’-GGCTCGAGCTAAGATCTTTGGACAAATCTATGTGTCCC-3’
5’-CACAAGCTTCGAAGGTTGAAGAGATGGTGCAG-3’
5’-GGCTCGAGCTAAGATCTGAACAAAATAGGCTTTCCTGC-3’
5’-GAGAAAGTGTAGCAAGGATTCCAGCAGTAGTTGC-3’
5’-GAAGATGACTTCCCTACAACTCGTTCTGATGG-3’
5’-TAGAATTCACTGGCGCAGCTCTCG-3’
5’-GGCTCGAGGAATGTCACACAGCCTTGC-3’
5’-AAGATCCCAGCCTTGACTG-3’
5’-GGCTCGAGGAACAAAATAGGCTTTCCTGC-3’
Page 6 of ‘Supplementary Information’