Supplementary material
Materials and Methods
Plant Material
The original seeds from the T-DNA insertion lines in Columbia (Col-0) background
At1g68830 (SALK 073254) and At5g01920 (SALK 060869 and SALK 064913) were
germinated and selected on kanamycin-containing plates (a selectable marker in the TDNA region) before they were transplanted in soil. Plants from the T3 kanamycinresistant generation were selfed, and the progeny were subjected to DNA extraction and
PCR analysis. For STN7 the oligos used were At073254-Fw
(CAAACAATTAAGTTTGCACC), At073254-R (TGAGGACTCATGTTTTGTGTC),
At060869-Fw (GGGCCACTATTGAGATGATTG), At064913-R
(CGTCATCAACAAGAGTAGAATTC) and T-DNA Left Border
(ATCAGCTGTTGCCCGTC). For STN8 the oligos GGGCCACTATTGAGATGATTG
and CGTCATCAACAAGAGTAGAATTC were used. Plants homozygous for the TDNA insertion were identified based on the PCR analysis. The homozygous stn7 was
backcrossed to the wild type and the F1 progeny were selfed. Homozygous stn7 plants
were recovered and used for the experiments. Double mutants were obtained by crossing
homozygous stn7 with homozygous stn8 and the progeny were analysed by PCR.
Complementation with Stn7 and Stn7-HA
1
A 7253-bp STN7genomic fragment containing a region encompassing 4056 bp upstream
of the start codon and 379 bp downstream of the stop codon was excised by digesting the
BAC clone T6L1 with XhoI. The fragment was inserted into the pSK vector at the XhoI
site. This XhoI fragment was cloned in the unique SalI restriction site of the binary plant
transformation vector pPZP312, derived from a pPZP vector with a Basta selectable gene
under the control of the 5’ mas promoter and the 3’ mas terminator 1 giving rise to
plasmid pPZP-At1g. This plasmid was then introduced into the A. tumefaciens strain
GV3101. Transformation of Arabidopsis plants was achieved by the floral-dip method
using Silwet L-77 2. Seeds harvested from transformed plants were germinated on ½ MS
medium (Sigma) containing 10 mg L-1 of Basta and 0.8% agar for 2 weeks, and Bastaresistant Arabidopsis plants were selected. Seedlings were then transplanted to peat and
tested for the presence of STN7.
A full-length cDNA clone of STN7 (accession number AY094447) was obtained from the
Riken Institute. To remove a point mutation in this full-length cDNA we also used an
EST from the STN7 gene (accession number AV552222) from the Kasuza resource
center. To introduce the 3' end of STN7 cDNA in frame with the triple HA tag in the
binary vector pCF399, the STN7 cDNA was first subcloned in a sense orientation in Xho1
and Sac1 restriction sites of pSK producing the pSK-AT1c plasmid. The 3' end of the
Stn7 ORF was then engineered by PCR to introduce a Sal1 restriction site in frame
immediately before the stop codon using oligonucleotides At075552R1
(TGCTCTTGCATCAGCACTTAG) and At1cSalSac-R
(GCGAGCTCCCGTCGACCTCCTCTCTGGGGATCCATCGG) producing plasmid
pSK-At1cSalSac. The mutagenized cDNA was then excised by Xho1 and Sal1 and
2
ligated in frame with the HA tag in the Sal1 site of plasmid pCF399 derived from the
pPZP312 vector containing a 35S promoter and a Rbcs terminator, yielding plasmid
pCF399-At1cHA. The 2.1 kb PpuM1 fragment of this plasmid, comprising the STN7 3'
end, a 3xHA tag and the RbcS terminator, was then introduced in the pPZP-At1g plasmid
producing a chimeric STN7 gene/ HA-tagged cDNA construct named pPZP-At1cgHA. In
order to reinsert all introns (except intron 9) a 2.3 kb Nco1 / BglII fragment was excised
from STN7 gene and reintroduced in pPZP-At1cgHA yielding plasmid pPZPMidiAT1HA.
DNA sequencing was performed by Fasteris (Geneva).
RNA Analysis
Small-scale extraction of RNA from one or two leaves from 4-week-old plants was
performed with the TRIzol reagent (Gibco BRL, Gaithersburg, MD) according to the
manufacturer’s instructions. Reverse transcription reactions were performed in 20 μl with
1 μg of total RNA using 1 μl of Extand reverse transcriptase (Roche) and 10 pmol of
oligo-dT as primer according to the manufacturer’s instructions (Roche) or
with M-MLV Reverse Transcriptase RNase H Minus Point Mutant (Promega) using 2 g
of total RNA extracted from leaves of 2 week-old plants and DNase-treated according to
the manufacturer instructions. PCR were performed with DyNAzyme EXT DNA
polymerase (Finnzyme) using 0.2 nM of sense and antisense primers At1fus4/5fw
(CCTTATAATGTAGAAACTATCATC) and At1fus8/9rw (GGAATGCCATTTGAAG)
for amplification of STN7 cDNA; ex23STN8 (TTCGAGGGAGACCGTG) and ex34STN8
(ACTGTTCAACTGCCAGAG) and AtUbiq1
3
(GATCTTTGCCGGAAAACAATTGGAGGATGGT) and AtUbiq2
(CGACTTGTCATTAGAAAGAAAGAGATAACAGG) as loading control.
Localization of Stn7
Chloroplasts were isolated from four plants at the rosette stage grown under
short day conditions (8h light, 16h dark) maintained 24h in darkness at 4°C
just before harvesting. Leaves were broken in CIB buffer (0.45 M sorbitol,
50 mM Hepes pH 7.8, 10 mM EDTA, 1 mg mL-1 BSA, 2.5 mM MgCl2 and Sigma
protease inhibitor cocktail (P8849 from Sigma)) in a Waring blender. The macerate was
filtered through two layers of Miracloth, debris were eliminated by centrifugation for 5 s
at 1000 g, and the material was concentrated by centrifugation for 7 min at
1000 g, resuspended in 1 ml of CIB and layered on a discontinuous 40%/80%
Percoll gradient. Intact chloroplasts were then isolated at the interface of
the two layers after centrifugation for 15 min at 7000 g. Pure chloroplasts isolated
after three Percoll gradient centrifugations were washed twice in HMS buffer (0.33 M
Sorbitol, 50 mM Hepes pH 7.8, 2.5 mM MgCl2 and Sigma protease inhibitor cocktail),
centrifuged 5 min at 1000 g and resuspended in 0.1 ml HMS. For soluble/insoluble
fractionation, chloroplasts were broken by osmotic lysis and sonication in lysis buffer (20
mM Hepes pH 7.8.5 mM EDTA, 0.1 M NaCl) and ultracentrifugation for 30 min at
100’000 g.
Total extracts were obtained by grinding and vortexing one Arabidopsis leave
in breaking buffer (50 mM Tris pH 8, 10 mM EDTA and Sigma protease inhibitor
cocktail). Debris were eliminated by centrifugation for 5 s at 10 000 g and the
4
supernatant was either used directly, or used to separate soluble and
insoluble material by centrifugation for 30 min at 100 000 g.
Transient expression of GFP-STN7 constructs in A. thaliana protoplasts
The full length STN7 and its N-terminal coding regions were amplified by PCR using
primer FwNcoATGstn7 (TCCGCCATGGCTACAATATC) and, respectively, primers
RwNcosstopstn7ala (GTATCCATGGCCTCCTCTCTGGGGATCCATCGG) and
RwNcoPepTransstn7 (GATACCATGGCAGTGATCGTTAAACCATTAG). The PCR
fragments were subcloned in PCRII plasmid by T/A cloning for sequencing and
subsequently inserted in frame with the EGFP in the NcoI restriction site of pCL60 (gift
of F. Kessler, University of Neuchâtel, Switzerland), which harbors a CaMV 35S
promoter and a Tnos terminator. Preparation and transfection of protoplasts from A.
thaliana was performed as described 3,4. Protoplasts were resuspended in TE
supplemented with Sigma protease inhibitor cocktail and broken by repeated pipetting
through a 25G1 needle. Based on chlorophyll contents, equal amounts of extracts were
further fractionated between soluble (S1) and insoluble fractions by ultracentrifugation
30 min at 100 000 g. Proteins weakly associated to the membranes were recovered by
resuspending the pellet in 0.1 M Na2CO3. After 30 min the extract was centrifuged for 30
min at 100 000 g. The two supernatants (S1 and S2) and the pellet (P) were analysed on a
12.5 % SDS PAGE.
5
Protein extraction and immunoblot analysis
Thylakoid membranes were prepared as described 5. The chlorophyll content of the
protein samples was determined as described 6 and all the samples were loaded on a
chlorophyll basis. All the thylakoid membrane proteins were resolved by SDS-PAGE in
12 or 15 % acrylamide gels. Immunoblotting was performed by incubation with different
polyclonal antibodies and detection with the ECL system (Amersham Biosciences, Inc.).
State 1-state 2 transitions
An intact leaf from 30 min dark-adapted plants was fixed to a light guide, and maximum
fluorescence yield (Fm) was measured during exposure to a saturing flash (0.8 s, 6000
μmol m-2 s-1) using a pulse amplitude modulation fluorometer (Hansatech Ltd., King’s
Lynn, England). The leaf was kept in the dark for 5 min and a first Fm measurement was
performed. Then the leaf was illuminated for 15 min with 80 μmol m-2 s-1 blue light (PSII
light) from high intensity light source LS2 (Hansatech Ltd., King’s Lynn, England)
equipped with a Scott BG38 filter. Subsequently a far-red light (PSI light) provided by a
LED source with a peak wavelength at 735 nm was switched on (Hansatech Ltd., King’s
Lynn, England), and after 15 min the maximal fluorescence yield in state 1 (Fm1) was
determined. The far-red light was switched off and the maximum fluorescence yield
(Fm2) was measured after 15 min of blue light excitation. The relative change in
fluorescence was calculated as ΔF= ((Fm1-Fm2)/Fm1) x 100.
6
Low temperature emission spectra
Chlorophyll fluorescence emission spectra of thylakoid membrane suspensions were
recorded in liquid nitrogen (77 K). Thylakoid membranes were prepared as described 7,
and the chlorophyll concentration of the membrane preparations was determined in 80 %
acetone 6. Chlorophyll fluorescence emission spectra were recorded with a Jasco FP-750
spectrofluorimeter using thylakoid preparations diluted to an equal chlorophyll
concentration (5 μg/ mL) in a matrix consisting of ice and quartz particles 8 in 20 mM
HEPES/NaOH, 3 mM MgCl2, pH 7.5 buffer. Excitation light was at 435 nm (10 nm slit
width), and emission was detected from 650 to 800 nm (5 nm slit width). Thylakoid
membranes (400 μL) were frozen in liquid nitrogen. Chlorophyll fluorescence emission
spectra exhibit one peak at 685 nm due to chlorophyll a associated with PSII and one at
735 nm from chlorophyll a molecules associated principally with PSI. All spectra were
normalized at 685 nm.
Plant growth under controlled conditions of light
In order to limit variations in photosynthetic activity due to stomatal regulation and
increase the reproducibility of gas exchange measurements, experiments were carried out
under non-photorespiratory conditions (1.2 % O2, 750 µmol CO2 L-1 air). The gas flow
rate at the leaf level was 250 mol air s-1 and the temperature was 25°C. Air humidity was
controlled by a dew point generator (LI-COR Biosciences, LI-610) set at 17°C. Gas
exchange and chlorophyll fluorescence were measured at different actinic light intensities
supplied with light emitting diodes (90 % red light, 10 % blue light) following a 20 min
equilibration period under a light intensity of 150 µmol m-2 s-1. Fluorescence levels, Fs
7
(stationary fluorescence level in the light), Fm’ (maximal fluorescence in the light
measured following a saturating pulse) and F0’ (basal fluorescence of light-adapted
leaves, recorded after rapid reoxidation of the PQ pool using far-red light), were used to
calculate non-photochemical quenching (NPQ = 1-Fm’/Fm) and photochemical quenching
(qP = (Fm’-Fs)/(Fm’-F0’)) under different light intensities 9.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Hajdukiewicz, P., Svab, Z. & Maliga, P. The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation. Plant Molecular Biology
25, 989-994 (1999)
Clough, S. J. & Bent, A. F. Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16, 735-43. (1998).
Jin, J. B. et al. A New Dynamin-Like Protein, ADL6, Is Involved in Trafficking
from the trans-Golgi Network to the Central Vacuole in Arabidopsis. Plant Cell
13, 1511-1526 (2001)
Bauer, J. et al. Essential role of the G-domain in targeting of the protein import
receptor atToc159 to the chloroplast outer membrane. J. Cell Biol. 159, 845-854
(2002)
Havaux, M., Dall'Osto, L., Cuine, S., Giuliano, G. & Bassi, R. The effect of
zeaxanthin as the only xanthophyll on the structure and function of the
photosynthetic apparatus in Arabidopsis thaliana. J Biol Chem 279, 13878-88.
(2004)
Porra, R. J., Thompson, W. A. & Kriedemann, P. E. Determination of accurate
extinction coefficients and simultaneous equations for assaying chlorophyll a and
b with four different solvents: Verification of the concentration of chlorophyll
standards by atomic absorption spectroscopy. Biochim. Biophys. Acta 975, 384394 (1989)
Robinson, H. H. & Yocum, C. F. Cyclic photophosphorylation reactions catalyzed
by ferredoxin, methyl viologen and anthraquinone sulfonate. Use of
photochemical reactions to optimize redox poising. Biochim Biophys Acta 590,
97-106 (1980)
Weis, E. Chlorophyll fluorescence at 77K in intact leaves: Characterization of a
technique to eliminate artifacts related to self-absorption. Photosynthesis research
6, 73-86 (1985)
Genty, B., Briantais, J. M. & Baker, N. R. The relationship between the quantum
yield of photosynthetic electron transport and quenching of chlorophyll
fluorescence. Biochim. Biophys. Acta 990, 87-92 (1989)
8
Figure legends
Figure S1. Locations of T-DNA insertions in STN7 (At1g68830) and STN8 (At5g01020)
and RT-PCR of STN7 and STN8 transcripts in the wild-type (Col-0), stn7, stn8 and in the
rescued stn7-1R, stn7-4R, stn8-13 and stn8-69 lines. The identity of the fragments
obtained by RT-PCR was confirmed by sequencing. Ubiquitin RNA (Ub) was used as
standard.
Figure S2. The STN7 kinase is localized in chloroplast membranes. A. Total leaf extracts
(T) were separated into a soluble (S) and membrane fraction (M). Isolated chloroplasts
(Tc) were broken and separated in soluble (Sc) and membrane (Mc) fractions. The
chloroplast membrane fraction was treated 5 min with 40 U of calf intestinal phosphatase
(CIP). Proteins from the different fractions were separated by SDS-PAGE and
immunoblotted with antisera against HA, PsaA (PSI membrane protein), phosphoribulose
kinase (PRK, a soluble chloroplast protein) and DET3, a cytosolic protein. The latter
immunoblot shows that the chloroplast fraction is not contaminated with cytosolic
proteins. Note that the signal of STN7 is not enriched in the chloroplast fraction because
of the instability of STN7 during the lengthy chloroplast isolation. PsaA is also
phosphorylated. B. Arabidopsis protoplasts were transformed with STN7-GFP, STN71-88GFP containing the 88 N-terminal amino acids of STN7, and GFP. GFP and chlorophyll
(Chl) fluorescence were observed by confocal laser scanning microscopy using a Leica
DM IRBE microscope and a Leica TCS SP laser. M, merge of GFP and chlorophyll
fluorescence. T, transmission microscopy of transformed protoplasts. C. Immunoblotting
9
of protoplast fractions. Protoplasts were broken and separated in supernatant (S1) and
total membrane fraction. The latter was extracted with carbonate and separated in pellet
(P) and supernatant (S2). Proteins were fractionated by PAGE and detected with GFP
antibodies. The sizes of the detected bands were as expected.
Figure S3. Immunoblot analysis of proteins of the photosynthetic apparatus. Different
loadings of thylakoid proteins from the Col-0 and stn7 lines were separated by SDSPAGE and immunoblotted with antiserum of D1 (PSII), LHCII, PsaA (PSI), LHCI,
Rieske protein (cytochrome b6f
complex)CF1 (ATP synthase) and TAK kinase.
Signals were visualized with ECL.
10