Small RNA library preparation using RNA Ligase truncted 2 for Illumina sequencer (Revised
09/10/10)
A. Collect small RNA
1. For each library, use at least 10 μg starting total RNA (or comparable amount of purified small
RNAs. (If using purified small RNAs, 15 mg of starting tissue for small RNA purification kit
(Cat# 21300 from Norgen) should be enough. Omission of the following steps in A is OK and
proceed to step B).
2. Run TBE Argarose gel to check total RNA quality. To purified small RNA from total RNA,
following:
3. Make and assemble 15% Urea tris-borate-EDTA (TBE) polyacrylamide (PAGE) gel (see
protocol). Pre-run for 15-20 min at 200 V and wash the wells with 1xTBE.
4. While pre-run the gel, prepare DNA 25 bp ladder (Cat# SM1191, Fermentas), home-made
DNA primer mix marker (20 and 30 nucleotide (nt) long) into 20 ul with loading dye. Mix 10 ug
RNA with 10ul 2X RNA loading dye (Ambion).
5. Heating the RNA sample and DNA primer samples 65 oC for 5-10 min. Quick cool down in ice.
Brief centrifuge.
6. Size fractionation RNA on a 15% Urea PAGE gel about ~2 hour at 200 V (the first dye can go
until 2cm from the bottom).
7. Pry apart the cassette and stain the gel with H2O/ethidium bromide in a clean container for 510 minutes wash in H2O.
8. View the gel on a Dark Reader transilluminator. Using a clean scalpel, cut out a band of gel
corresponding to the 18–30 nt bands in the marker lane.
9. RNA with gel now should be grinded with the blue stick in 1.5 ml centrifuge tube. Centrifuge.
10. RNA was eluted from the polyacrylamide gel debris in 300 μL of 0.3 M NaCl for four hrs at
room temperature or overnight at 4°C.
11. The resulting gel slurry was centrifuged and supernatant was collected by passing through
Spin X filter tubes and precipitated by addition of 2.5X (750 μL) of ethanol and 2-4 μL of
mussel glycogen blue (15mg/mL; Invitrogen).
12. Put in -80 oC for 30 min and centrifuge 4 oC for 25min at maximal speed (14K).
13. After washing with 750 ul -20oC 75% ethanol, the pellets were allowed to air dry and add
RNase free 5.0 ul water.
B. miRNA 3’ adapter ligation
(3’ adaptor pre-adenylated 5′-AppUCGUAUGCCGUCUUCUGCUUGidT-3′; p, phosphate; idT,
inverted deoxythymidine)
14. Add the following in the indicated order to each tube of PAGE gel isolated small RNA.
Starting volume of small RNA is (5.0 μl)
3’ adapter (pre Adenylated) (1.0 μl, 80
ng/ul or 10 uM)
Heat to 90oC for 30sec and cool down in
ice immediately.
Then add:
10X T4 RNL 2 buffer (1 μl)
50 mM MgCl2 (1.0 ul)
RNase OUT (0.5 μl)
T4 RNA ligase 2, truncated (1.5 μl)
The total volume should be 10 μl
15. Incubate at 37 °C for 6 hour and hold 4 oC for overnight.
16. Stop the reaction by adding 10 μl of RNA gel loading dye and keep in -20 oC.
17. Assemble the gel electrophoresis apparatus per the manufacturer’s instructions. Pre-run the
15% TBE-urea gel for 15–30 minutes at 200 V. Wash the wells using 1X TBE.
18. Heat the ligated sample at 65 °C for 5-10 minutes in a thermal cycler just before loading on the
gel and cool down in ice, prepare 25 bp DNA ladder and 20/30 nt PCR-primer marker into 20
ul volume.
19. Centrifuge the heated tubes to collect the entire column of the tube. Load both the entire DNA
ladder and sample RNA on the same gel with several lanes between them.
20. Run the gel at 200 V for ~2 hours (the first dye can go down to about 2cm from the bottom).
21. Pry apart the cassette and stain the gel with H2O/ethidium bromide in a clean container for 10
minutes. 30–60 (22+22nt) base pair fraction was excised.
22. Use the blue stick to grind the RNA and gel.
23. RNA was eluted from the polyacrylamide gel slice into 300 μL of 0.3 M NaCl overnight at 4°C.
24. Filter with spin-X and centrifuge and collect the supernatant.
25. Add 4 μl of glycogen blue and 2.5X (750 μl) of room temperature 100% ethanol. Incubate at 80°C for 30 minutes.
26. Immediately centrifuge to 14K for 25 minutes on a 4°C microcentrifuge.
27. Remove the supernatant. Wash the pellet with 750 μl of -20 oC 75% ethanol.
28. Remove the supernatant. Allow the RNA pellet to air dry. Resuspend the RNA pellet in 6.0 μl
of ultra pure water.
C. miRNA 5’ adapter ligation
The 5′ RNA adapter (5′-GUUCAGAGUUCUACAGUCCGACGAUC[-OH]-3′ or use user designed
barcoded adapter) was subsequently ligated to the precipitated RNA with T4 RNA ligase (Ambion) in
the presence of RNaseOut (Invitrogen) 6hrs at 20°C.
29. Add the following in the indicated order to each tube of 5’ RNA adapter-ligated small RNA.
Starting volume of small RNA is 6.0 μl
5’ adapter (1.0 μl, 100 uM)
10X T4 RNA ligase buffer (1 μl)
RNase OUT (1 μl)
T4 RNA ligase (1 μl)
The total volume should be 10 μl.
30. Incubate at 20°C for 6 hours or overnight in a thermal cycler.
31. Stop the reaction by adding 10 μl of 10X RNA gel loading dye. Put into -20oC.
32. Prepare 10% Gel Electrophoresis Reagents and Apparatus. Pre-run the 10% TBE-urea gel for
15–30 minutes at 200 V. Wash the wells using 1X TBE.
33. While the gel is pre-running, heat the ligated sample and ladder tubes at 65°C for 5 minutes in
a thermal cycler just before loading on the gel. Centrifuge the heated tubes.
34. Load both the entire ladder and sample RNA on the same gel with several lanes between them.
35. Run the gel at 200V for ~2 hour. Remove the gel from the apparatus.
36. Recover the Isolated RNA. Pry apart the cassette and stain the gel with H2O/ethidium bromide
in a clean container for 10 minutes.
37. 60–100 (22+22+26nt) nt fraction was excised. Grind RNA gel with blue stick.
38. Add 300 μl of 0.3 M NaCl to the gel debris in the 2 ml tube. Elute the DNA by rotating the tube
gently at room temperature for 4 hours or 4oC for overnight.
39. Centrifuge and collect supernatant.
40. Add 4 μl of glycogen and 2.5X (~750 μl) of room temperature 100% ethanol. Incubate at -80°C
for 30 minutes. Immediately centrifuge to 14K for 25 minutes on a 4°C microcentrifuge.
41. Remove the supernatant and discard it. Wash the pellet with 750 μl 75% ethanol. Centrifuge
for 8min 14K, 4oC.
42. Remove the supernatant and discard it. Allow the RNA pellet to air dry.
43. Resuspend the RNA pellet in 4.5 μl of ultra pure water.
D. Reverse transcription to convert ssRNA into ssDNA
The RNA was converted to single-stranded cDNA using Superscript II reverse transcriptase
(Invitrogen) and Illumina’s small RNA RT-Primer (5′-CAAGCAGAAGACGGCATACGA-3′) following
the manufacturer’s instructions.
44. Combine the following in a sterile, RNase-free, PCR microtube:
Purified 5’ and 3’ ligated RNA (4.5 μl)
RT primer (0.5 μl)
The total volume should be 5 μl
Heat the mixture at 65°C in a thermal cycler for 10 minutes. Place the tube on ice.
Add the following reagents in the order listed to the cooled tube:
5X first strand buffer (2 μl)
12.5 mM dNTP mix (0.5 μl)
100 mM DTT (1 μl)
RNase OUT (0.5 μl)
The total volume should now be 9 μl (5 μl of template preparation and 4 μl of reverse transcription).
Heat the sample to 48°C in a thermal cycler for 3 minutes.
Add 1 μl SuperScript III Reverse Transcriptase. Incubate in a thermal cycler at 44°C for 1 hour.
E. PCR amplification
The resulting cDNA was PCR-amplified with Hotstart Phusion DNA Polymerase (NEB) in 15 cycles
using Illumina’s small RNA primer set (5′-CAAGCAGAAGACG GCATACGA-3′; 5′AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3' (Or the primer specific for
the 5’adapter)).
Premix the following reagents in the listed order in a separate tube.
Ultra pure water (28 μl)
5X Phusion* HF buffer (10 μl)
Primer 1 (0.5 μl, 25 uM)
Primer 2 (0.5 μl, 25 uM)
25 mM dNTP mix (0.5 μl)
Phusion* DNA Polymerase (0.5 μl)
The total volume should be 40 μl.
Add 40 μl of PCR master mix into a sterile, nuclease-free 0.2 ml PCR tube.
Add 10 μl of single strand reverse-transcribed cDNA.
Amplify the PCR in the thermal cycler using the following PCR protocol: a. 30 seconds at 98°C b. 15
cycles of: 10 seconds at 98°C 30 seconds at 60°C 15 seconds at 72°C c. 10 minutes at 72°C d. Hold
at 4°C
45. Prepare the 10% Gel Electrophoresis Reagents and Apparatus. Pre-run the Gel 15min.wash
wells with 1xTBE.
46. Mix 50 μl of amplified cDNA construct with 10 μl of 6X DNA loading dye. Load 5 μl 25 bp
ladder and loading dye mix in one well on the 10% PAGE gel. Load two wells with 20 μl each
of amplified construct and loading dye mix on the 10% TBE PAGE gel.
47. Run the gel for ~60 minutes at 200 V (the frontal dye can run out from the gel).
48. Pry apart the cassette and stain the gel with the ethidium bromide in a clean container for ~10
minutes.
49. Using a clean scalpel, cut out approximately a ~92 bp (or calculate the size based on the
adapter and PCR primers) band in the sample lanes. Place the band into the 0.5 ml
microtube. Grind with blue stick.
50. Add 100 μl of gel elution buffer (5:1, LoTE: 7.5 M ammonium acetate) to the gel debris in the 2
ml tube. Elute the DNA by rotating the tube gently at room temperature for 2 hours or overnight
4oC.
51. Centrifuge and collect the supernatant.
52. Addition of 1100 μL of ethanol, 133 μL of 7.5 M ammonium acetate, and 4 μL of mussel
glycogen. Immediately centrifuge to 14K for 20 minutes microcentrifuge.
53. Remove and discard the supernatant, leaving the pellet intact. Wash the pellet with 500 μl of
room temperature 75% ethanol.
54. The pellet was allowed to air dry at 25°C and dissolved in EB buffer (Qiagen) or H2O by
incubation at RT for 10 min.
55. The purified PCR products were quantified and diluted to 10 nM for sequencing on the Illumina
sequencer.
After 1. Ryan D. Morin et al. Application of massively parallel sequencing to microRNA profiling and
discovery in human embryonic stem cells. http://genome.cshlp.org/content/18/4/610.long
2. Illumina small RNA preparation protocol V1.0 and V1.5
3. Francois Vigneault, A Michael Sismour & George M Church. Efficient microRNA capture and barcoding via enzymatic oligonucleotide adenylation
Denaturing Urea PAGE - Small Gel (25 ml)
1. Prepare denaturing polyacrylamide gel solution.
6%
10%
15%
10XTBE
2.5ml
2.5ml
2.5ml
Urea (ultrapure)
10.5g
10.5g
10.5g
40% Acrylamide 3.75ml 6.25ml 9.375ml
ddH2O
11.25ml 8.75ml 5.625 ml
Total Volume
25ml
25ml
25ml
Mix in 50 ml beaker. Use a stir-bar to help urea get dissolved completely.
2. Pour gel. Add 25 μl TEMED and 125 μl 10% APS. Pour gel to ~ 0.5 cm from top. Insert clean, dry
comb at an angle to prevent trapping of bubbles. Push all the way down, but don't trap any bubbles.
Wait for 20 min until the left over gel get solidified.
3. Load samples. Blow out wells with syringe and needle. A load volume of up to 20 ul will give tight
bands.
4. Run gel.
5. Ethidium bromide staining. Gently agitate for 10 minutes in 10X (5 μg/ml) EtBr in ddH2O.
10X TBE buffer:
108g Tris base
55g Boric acid
40mls 0.5M EDTA (pH 8.0)
Add H20 to 1 Liter
After: http://plaza.ufl.edu/johnaris/Protocols/Electrophoresis/SmallUreaPage.pdf
Preordered 3’ adapter adenylation reaction
A. Make 3’ adapter RNA/DNA template duplex
1. Mix 20 ul 3’ RNA adapter (synthesized by IDT 100 uM) with 24 ul 100 uM adapter DNA template.
2. Incubate in PCR machine 94oC for 2min, the from 80oC step down -0.5oC to ~10oC per 5sec.
keep in 4’oC
B. 5’end adenylation.
3. Incubate the 100 uM RNA/DNA duplex from Step A with T4 DNA ligase (NEB, 2000 u/ul, Quick
ligation kit, Cat# SM2200) at 37 oC for 3hr.
1 ul duplex
2 ul 10x T4 DNA ligase buffer (with ATP)
2 ul DNA ligase (NEB, 2000 u/ul)
15 ul H2O
20 ul total volume
Pilot reaction
5 ul annealed oligonucleotide duplex
50 μl of 2X Quick Ligation Reaction Buffer (NEB)
10 μl of T4 DNA ligase (2000 U/μl, NEB)
35 ul H2O
100ul Total Volume
Keep at 37oC for 2-4hrs
Denature at 65 oC for 5-10 min. Immediately keep in ice. Run 15% PAGE denaturing gel to isolate
adenylated adapter (there will be three bands, the biggest band is DNA template, then two RNA
bands. Adenylated adapter is 1 nt bigger than un-adenylated adapter).
Ethanol precipation with Glycogen into 10 ul H2O. Measure the concentration (~100ng/ul)
3′RNA adapter: 5′-pUCGUAUGCCGUCUUCUGCUUGidT-3′ (5’ phosphate, 3’ blocked) to be
adenylated.
DNA template design
5′-pUCGUAUGCCGUCUUCUGCUUGidT-3′
3-CTGAGTGATATAGCATACGGCAGAAGACGAAC5’ DNA
DNA template ordered as PCR primer: 5’CAAGCAGAAGACGGCATACGATATAGTGAGTC-3’
5′ RNA adapter: 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′ (or user-specified, barcoded adapter)
3′ RNA adapter: 5′-pUCGUAUGCCGUCUUCUGCUUGidT-3′;
Illumina’s small RNA RT-Primer (5′-CAAGCAGAAGACGGCATACGA-3′) which is antisense to 3’RNA adapter.
PCR primers: 3’ primer: 5′-CAAGCAGAAGACG GCATACGA-3′ (the same as RT primer)
5’ primer
5′-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3' (or user specified)
Italic Yellow ones are the same sequence as 5’ RNA adaptor
Small RNA sequencing primer:
CGACAGGTTCAGAGTTCTACAGTCCGACGATC which has the same sequence as PCR primers with “TC” which is on
the adapter
5' RNA Adapter:
5'
3'
3'
5'
3'
RT
5'
3'
--------------------------------------RNA Adapter:
--------------------------------------Primer:
---------------------------------------
---GUUCAGAGUUCUACAGU CCGACGAUC (-) -------------------- - 3'
-------------------- --------- (-) -------------------- - 5'
-------------------- --------- (-)pUCGUAUGCCGUCUUCUGCUU GUidT 3'
-------------------- --------- (-) -------------------- - 5'
-------------------- --------- (-) -------------------- - 3'
-------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 1:
5' -------------------3' -------------------Small RNA PCR Primer 2:
5' AATGATACGGCGACCACCGA
3' --------------------
-------------------- --------- (-) -------------------- - 3'
-------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
CAGGTTCAGAGTTCTACAGT CCGA----- (-) -------------------- - 3'
-------------------- --------- (-) -------------------- - 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA
Small RNA Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT
3' -------------------- --------------------
CCGACGATC (N) TCGTATGCCGTCTTCTGCTT G 3'
GGCTGCTAG (N) AGCATACGGCAGAAGACGAA C 5'
CCGACGATC (-) -------------------- - 3'
--------- (-) -------------------- - 5'
Stock:
3' sRNA Adapter (V1.0)= 10µM
SRA 5' Adapter = 100µM
Other oligos:
SRA RT primer = 100µM
Primer GX1/2 for PCR amplification = 25µM
5’adapter: pXXXXX-OH
3’adapter: pXXXXXX-idT
microRNA: p’XXXXXXXXXXX-OH
http://seqanswers.com/forums/showthread.php?t=198&page=3
Reagents used:
AM2141 T4 RNA Ligase (Cloned) 5 U/µl 2500 U $157.00
M0242S T4 RNA ligase 2 Truncated, 200units/ul $60.00
AM9515 GlycoBlue™ (15 mg/ml) 0.3 ml $62.00
Ultra Pure (RNase DNase free) Water (store at 4°C)
RNaseOUT
0.3 M NaCl, prepare with RNA free water
Phusion* Polymerase (Finnzymes Oy) 5X Phusion* HF Buffer (Finnzymes Oy)
PCR primers, synthesized 25uM each (IDT)
RT Primer, synthesized 100uM (IDT)
Resuspension Buffer (homemade)
2XRNA Loading Dye (Ambion, come with mRNA mMachine and mMessenger kit)
25 bp Ladder (50bp Ladder + 10ul of each 20nt, 30nt 100mM PCR primer)
Synthetic 22 nt miRNA control (IDT)
10 mM dNTP Mix
6X DNA Loading Dye
10X Gel Elution Buffer (Homemade)