mbt12031-sup-0001-si

- Supplementary information Tunable reporter signal production in feedback-uncoupled arsenic bioreporters Davide Merulla1, Vassily Hatzimanikatis2,3, Jan Roelof van der Meer1,* 1) Department of Fundamental Microbiology, University of Lausanne, 1015 Lausanne Switzerland. 2) Laboratory of Computational Systems Biotechnology, Ecole Polytechnique Fédérale de Lausane (EPFL), CH 1015 Lausanne, Switzerland. 3) Swiss Institute of Bioinformatics (SIB), CH 1015 Lausanne, Switzerland. - Mathematical model - Table S1 - Figures S1-S5 Mathematical model for ArsR- circuits. Symbols mA mRNA of arsR (dimensionless) MA arsR mRNA concentration (M) G genome concentration, 1 molecule/cell ~4·10-9 (M) G is used to scale to dimensionless concentrations, that correspond to relative copy numbers per cell. 𝑀𝐴 𝐺 𝑚𝐴 = mF MF mRNA of gfp (dimensionless) gfp mRNA concentration (M) 𝑀𝐹 𝑚𝐹 = 𝐺 A PA ArsR protein (dimensionless) ArsR protein concentration (M) 𝜌𝐴 = Ρ𝐴 𝐺 F PF GFP protein (dimensionless) GFP protein concentration (M) 𝜌𝐹 = Ρ𝐹 𝐺 g𝑃 plasmid copies per cell. Value: 10 𝐺 ̅𝑚𝐴 = K𝑚𝐴 𝐾 𝐾 copies MA from DNA per G. Value: 8. ̅𝑚𝐴𝑝 = 𝐾 𝐾 copies MA from plasmid per G. Value: 8. ̅𝑚𝐹 = 𝐾 𝐾 copies MF from plasmid per G. Value: 12. 𝑑,𝑚𝐴 K𝑚𝐴𝑝 𝑑,𝑚𝐴 K𝑚𝐹 𝑑,𝑚𝐹 Assumption 1: transcription efficiency same for chromosome and plasmid DNA. t K 𝜑 = 𝐾𝑑,𝑚𝐹 =𝑡1/2,𝑀𝐴 𝑑,𝑚𝐴 1 𝜆 ≅ K𝑚𝐴 𝐾𝑝𝐴 ratio of mRNA half-lives. Value: 1. 1/2,𝑀𝐹 K𝑑𝑝𝐴 ×𝐾 𝑑𝑚𝐴 𝑚𝑅𝑁𝐴 𝑐𝑜𝑝𝑖𝑒𝑠 = 𝑝𝑟𝑜𝑡𝑒𝑖𝑛 𝑐𝑜𝑝𝑖𝑒𝑠 A ArsR protein copies per arsR mRNA. Value: 5. F GFP protein copies per gfp mRNA. Value: 5. K𝑑𝑝𝐴 t ℎ𝐴 = 𝐾 = 𝑡1/2,𝑀𝐴 𝑑𝑚𝐴 1/2,𝑃𝐴 equivalent to the ratio of arsR mRNA half-life over ArsR protein half-life. Value hA: 0.5. KA equilibrium constant for ArsR binding to its DNA binding site. Value KA: 2·1012 (M-1). KC equilibrium constant for binding of AsIII to ArsR. Value KC: 1·107·n (M-n) n number of molecules AsIII bound per molecule of ArsR. Value: 2. KD equilibrium constant for ArsR-As binding to its DNA binding site. Value KD: 2·109 (M-1)  concentration of AsIII (M) D efficiency of transcription from Pars E efficiency of transcription from Px, one of the constitutive promoters Case A: arsR and gfp under control of Pars. No secondary binding site. Only plasmid copies. 𝑔 𝑑𝑚𝐴 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 − 𝑚𝐴 = 𝐾 𝐴 𝑑𝜏 𝐺 𝑔 𝑑𝑚𝐹 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝑝 − 𝜑 · 𝑚𝐹 = 𝐾 𝐹 𝑑𝜏 𝐺 𝑑𝜌𝐴 ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 − ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝑑𝜏 𝑑𝜌𝐹 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 − ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝑑𝜏 in steady state: 𝑑𝑚𝐴 𝑑𝜌𝐴 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 thus: 𝑔𝑝 𝐺 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑚𝐴 = 𝐾 𝐴 and: ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 , 𝑖𝑛 𝑜𝑡ℎ𝑒𝑟 𝑤𝑜𝑟𝑑𝑠: 𝜌𝐴 = 𝐾 ̅𝑚 · 𝜆𝐴 · 𝑚𝐴 ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝐴 with: 𝜂𝑝 = 1 𝛼𝐷 ·𝜌𝐴 +1 and: 𝛼𝐷 = 𝐾𝐴 +𝐾𝐶 ·𝐾𝐷 ·𝜖 𝑛 1+𝐾𝐶 ·𝜖 𝑛 ·𝐺 substitute 𝑚𝐴 , then 𝑔 ̅𝑚 )2 · 𝑝 · 𝜆𝐴 (𝐾 𝑔 𝐴 𝐴 𝐺 ̅𝑚 )2 · 𝜂𝑝 · 𝑝 · 𝜆𝐴 = 𝜌𝐴 = (𝐾 = 𝐴 𝐺 𝛼𝐷 · 𝜌𝐴 + 1 𝛼𝐷 · 𝜌𝐴 + 1 ̅𝑚 )2 · with 𝐴 = (𝐾 𝐴 𝑔𝑝 𝐺 then: 𝛼𝐷 · (𝜌𝐴 )2 + 𝜌𝐴 = 𝐴 · 𝜆𝐴 solve: Will give two solutions of type a = b ± c. Only the expression with '+' makes biologically sense. 1 1 2 𝐴 √ 𝜌𝐴 = − + ( ) + 2𝛼𝐷 2𝛼𝐷 𝛼𝐷 similarly, in steady state: 𝑑𝑚𝐹 𝑑𝜌𝐹 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 then: ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝜑 · 𝑚𝐹 = 𝐾 𝐹 and 𝑔𝑝 𝑔 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 , in other words: 𝑚𝐹 = 𝐾 𝐹 𝐺 𝐺 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 , in other words: 𝜌𝐹 = 𝐾 ̅𝑚 · 𝜆𝐹 · 𝑚𝐹 ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝐹 substitute 𝑚𝐹 𝑔 ̅𝑚 )2 · 𝑝 · 𝜆𝐹 (𝐾 𝐹 𝐺 𝜌𝐹 = 𝛼𝐷 · 𝜌𝐴 + 1 Case B: arsR under Px and gfp under control of ArsR/Pars. No secondary binding site. Only plasmid copies. 𝑔 𝑑𝑚𝐴 ̅𝑚 · 𝜂𝐸 · 𝑝 − 𝑚𝐴 = 𝐾 𝐴 𝑑𝜏 𝐺 𝑔 𝑑𝑚𝐹 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝑝 − 𝜑 · 𝑚𝐹 = 𝐾 𝐹 𝑑𝜏 𝐺 𝑑𝜌𝐴 ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 − ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝑑𝜏 𝑑𝜌𝐹 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 − ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝑑𝜏 Constant ArsR: 𝑑𝑚𝐴 𝑑𝜌𝐴 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 thus: ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 , in other words: 𝑚𝐴 = ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 then: ̅𝑚 · 𝜂𝐸 · 0= 𝐾 𝐴 ℎ𝐴 · 𝜌𝐴 𝜌𝐴 = ̅𝑚 · 𝜆𝐴 · ℎ𝐴 ̅𝑚 · 𝜆𝐴 𝐾 𝐾 𝐴 𝐴 𝑔𝑝 𝜌𝐴 − ̅𝑚 · 𝜆𝐴 𝐺 𝐾 𝐴 thus: 𝑔 𝑔 𝜌𝐴 ̅𝑚 · 𝜂𝐸 · 𝑝 𝑜𝑟: 𝜌𝐴 = 𝜆𝐴 · (𝐾 ̅𝑚 )2 · 𝜂𝐸 · 𝑝 = 𝐾 𝐴 𝐴 ̅𝑚 · 𝜆𝐴 𝐺 𝐺 𝐾 𝐴 similarly, in steady state: 𝑑𝑚𝐹 𝑑𝜌𝐹 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 then: ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝜑 · 𝑚𝐹 = 𝐾 𝐹 and 𝑔𝑝 𝑔 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 , in other words: 𝑚𝐹 = 𝐾 𝐹 𝐺 𝐺 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 , in other words: 𝜌𝐹 = 𝐾 ̅𝑚 · 𝜆𝐹 · 𝑚𝐹 ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝐹 substitute 𝑚𝐹 𝜌𝐹 = 𝑔𝑝 ·𝜆 𝐺 𝐹 𝛼𝐷 · 𝜌𝐴 + 1 ̅𝑚 )2 · (𝐾 𝐹 Case A2: arsR and gfp under control of Pars. No secondary binding site. Chromosome arsR and plasmid copies. 𝑔 𝑑𝑚𝐴 ̅𝑚 · 𝜂𝐷 (𝜌𝐴 ) + 𝐾 ̅𝑚 𝑝 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 − 𝑚𝐴 = 𝐾 𝐴 𝐴 𝑑𝜏 𝐺 𝑔 𝑑𝑚𝐹 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝑝 − 𝜑 · 𝑚𝐹 = 𝐾 𝐹 𝑑𝜏 𝐺 𝑑𝜌𝐴 ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 − ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝑑𝜏 𝑑𝜌𝐹 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 − ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝑑𝜏 under steady state: 𝑑𝑚𝐴 𝑑𝜌𝐴 = 0 and = 0 𝑑𝜏 𝑑𝜏 thus: ̅𝑚 · 𝜂𝐷 (𝜌𝐴 ) + 𝐾 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑚𝐴 = 𝐾 𝐴 𝐴 𝑔𝑝 𝐺 and: ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 , in other words: 𝜌𝐴 = 𝐾 ̅𝑚 · 𝜆𝐴 · 𝑚𝐴 ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝐴 with: 𝜂𝐷 = 1 𝛼𝐷 ·𝜌𝐴 +1 assume: D = p and: 𝛼𝐷 = 𝐾𝐴 +𝐾𝐶 ·𝐾𝐷 ·𝜖 𝑛 1+𝐾𝐶 ·𝜖 𝑛 ·𝐺 substitute 𝑚𝐴 , then 𝑔 ̅𝑚 )2 · (1 + 𝑝 ) 𝜆𝐴 · (𝐾 𝑔 𝐴 𝑝 𝐺 ̅𝑚 )2 · 𝜂𝐷 · 𝜆𝐴 + (𝐾 ̅𝑚 )2 · 𝜂𝐷 · 𝜌𝐴 = (𝐾 · 𝜆𝐴 = 𝐴 𝐴 𝐺 𝛼𝐷 · 𝜌𝐴 + 1 𝐴 = 𝛼𝐷 · 𝜌𝐴 + 1 ̅𝑚 )2 · (1 + with 𝐴 = 𝜆𝐴 · (𝐾 𝐴 then: 𝑔𝑝 𝐺 ) 𝛼𝐷 · (𝜌𝐴 )2 + 𝜌𝐴 = 𝐴 solve (similar remark on the two possible solutions; only '+' makes biologically sense) 1 1 2 𝐴 𝜌𝐴 = − + √( ) + 2𝛼𝐷 2𝛼𝐷 𝛼𝐷 similarly, in stead state: 𝑑𝑚𝐹 𝑑𝜌𝐹 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 then: ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝜑 · 𝑚𝐹 = 𝐾 𝐹 and 𝑔𝑝 𝑔 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 , in other words: 𝑚𝐹 = 𝐾 𝐹 𝐺 𝐺 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 , in other words: 𝜌𝐹 = 𝐾 ̅𝑚 · 𝜆𝐹 · 𝑚𝐹 ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝐹 substitute 𝑚𝐹 𝑔 ̅𝑚 )2 · 𝑝 · 𝜆𝐹 (𝐾 𝐹 𝐺 𝜌𝐹 = 𝛼𝐷 · 𝜌𝐴 + 1 Case B2: arsR under Px and gfp under control of ArsR/Pars on plasmid. No secondary binding site. Additional chromosomal arsR copy. 𝑔 𝑑𝑚𝐴 ̅𝑚 · 𝜂𝐷 (𝜌𝐴 ) + 𝐾 ̅𝑚 · 𝜂𝐸 · 𝑝 − 𝑚𝐴 = 𝐾 𝐴 𝐴𝑝 𝑑𝜏 𝐺 𝑔 𝑑𝑚𝐹 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝑝 − 𝜑 · 𝑚𝐹 = 𝐾 𝐹 𝑑𝜏 𝐺 𝑑𝜌𝐴 ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 − ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 𝑑𝜏 𝑑𝜌𝐹 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 − ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝑑𝜏 Under steady state: 𝑑𝑚𝐴 𝑑𝜌𝐴 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 then: ̅𝑚 · 𝜆𝐴 · ℎ𝐴 · 𝑚𝐴 , in other words: 𝑚𝐴 = ℎ𝐴 · 𝜌𝐴 = 𝐾 𝐴 substitute: ̅𝑚 · 𝜂𝐷 (𝜌𝐴 ) + 𝐾 ̅𝑚 0= 𝐾 𝐴𝑝 𝐴 · 𝜂𝐸 · 𝑔𝑝 𝜌𝐴 − ̅𝑚 · 𝜆𝐴 𝐺 𝐾 𝐴 thus: 𝑔 𝜌𝐴 ̅𝑚 · 𝜂𝐷 (𝜌𝐴 ) + 𝐾 ̅𝑚 𝑝 · 𝜂𝐸 · 𝑝 = 𝐾 𝐴 𝐴 ̅𝑚 · 𝜆𝐴 𝐺 𝐾 𝐴 with: 𝜂𝐷 = 1 𝛼𝐷 ·𝜌𝐴 +1 and: 𝛼𝐷 = 𝐾𝐴 +𝐾𝐶 ·𝐾𝐷 ·𝜖 𝑛 1+𝐾𝐶 ·𝜖 𝑛 ·𝐺 substitute: 2 ̅𝑚 ) 𝜆 · (𝐾 𝑔 𝐴 ̅𝑚 · 𝐾 ̅𝑚 𝑝 · 𝜂𝐸 · 𝑝 + 𝐴 𝜌𝐴 = 𝜆𝐴 · 𝐾 𝐴 𝐴 𝐺 𝛼𝐷 · 𝜌𝐴 + 1 substitute: ̅𝑚 )2 𝐴 = 𝜆𝐴 · (𝐾 𝐴 and ℎ𝐴 · 𝜌𝐴 𝜌𝐴 = ̅𝑚 · 𝜆𝐴 · ℎ𝐴 ̅𝑚 · 𝜆𝐴 𝐾 𝐾 𝐴 𝐴 ̅𝑚 · 𝐾 ̅𝑚 𝑝 · 𝜂𝐸 · 𝐵 = 𝜆𝐴 · 𝐾 𝐴 𝐴 𝑔𝑝 𝐺 solve: 1 − 𝛼𝐷 · 𝐵 1 − 𝛼𝐷 · 𝐵 2 𝐴+𝐵 √ 𝜌𝐴 = − ( )+ ( ) +( ) 2𝛼𝐷 2𝛼𝐷 𝛼𝐷 similarly, in steady state 𝑑𝑚𝐹 𝑑𝜌𝐹 = 0 𝑎𝑛𝑑 = 0 𝑑𝜏 𝑑𝜏 then: ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝜑 · 𝜑 · 𝑚𝐹 = 𝐾 𝐹 and 𝑔𝑝 𝑔 ̅𝑚 · 𝜂𝑝 (𝜌𝐴 ) · 𝑝 , in other words: 𝑚𝐹 = 𝐾 𝐹 𝐺 𝐺 ̅𝑚 · 𝜆𝐹 · 𝜑 · ℎ𝐹 · 𝑚𝐹 , in other words: 𝜌𝐹 = 𝐾 ̅𝑚 · 𝜆𝐹 · 𝑚𝐹 ℎ𝐹 · 𝜑 · 𝜌𝐹 = 𝐾 𝐹 𝐹 substitute 𝑚𝐹 𝑔 ̅𝑚 )2 · 𝑝 · 𝜆𝐹 (𝐾 𝐹 𝐺 𝜌𝐹 = 𝛼𝐷 · 𝜌𝐴 + 1 Supplementary Table S1. List of all the primers used in the present work showing sequence, length and melting temperature (Tm). Primer code 010907 110711 090722 070817 100107 100108 100109 100110 100111 100112 Function Length Sequence 5'-3' 29 Calculated Tm (°C) 59.4 Seq. constitutive promoter Seq. constitutive promoter Seq. coupled sys. mCherry insertion Seq. uncoupled sys. mCherry insertion Chromosomal K.O. Chromosomal K.O. Chromosomal K.O. Chromosomal K.O. Chromosomal K.O. Chromosomal K.O. 29 61.6 CGCACAACTCTCCCATCTCCCTG 23 60.8 TAACCTTCGGGCATGGCACTCTT 24 65 CTGCCAGGAATTGGGGATCGGAAG 27 26 30 30 27 30 59.9 61.9 65.2 62.0 60.8 59.2 GAATTCTTGGTATGGACGAAATGTTGC ACTAGTCGCTTCTGACATATTGCGCTCCTG GAATTCCTTTGAAAGCGTTTATGCGC ACTAGTCGCTTCAGTAACATAATGCCTCCC GAAGCGACTAGTCGCCTGAAATAAAGC GGGATCCCATATTGATCAGAGATATATCCT AATTCACATAACCAAAAACGCATATGATG Supplementary Figure S1. Nucleotide alignment of the arsRR73 and the chromosomal arsRK12 genes. Promoter name Promoter sequence relative mRNA pII gagctcCAATCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTCG AGTCCCTATCAGTGATAGAGATGGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCttggatcc 0,063856 pJJ gagctcCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTC GAGTCCCTATCAGTGATAGAGATTGACCTCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCttggatcc 0,159416 pAA gagctcCAATTCCGACGTCTAAGAAACCATTATTATTATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTCCGTCTTCACCTC GAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAAATACTGAGCACATCAGCAGGACGCACTGACCttggatcc 0,236732 pK gagctcCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTCTCGTCTTCACCTC GAGTCCCTATCAGTGATAGGGATTGACATCCCTATCAGTGATAGAGACACTGGGCACATCAGCAGGACGCACTGACCttggatcc 0,29891 pV gagctcCAATTCCGACGTCTGAGAGGCCATTATTATCGTGGCATTGGCCTATAAAGGCAGGCGTGTCACGAGACCCTCTCGTCTCCGC CTCGGGTCCCTATCAATGGTAGAGATTGACATCCCCATCAGTGGTGGAGATACTGAGCACATCAGCAGGACGCACTGACCttggatcc 0,574349 pLtet0 gagctcCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACCTC GAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCttggatcc 1 Figure S2. Relevant part of the DNA sequence of the different promoters used for uncoupled expression of arsRR773. A pPR-arsR-ABS-egfp aagttatctcacctaccttaaggtaatagtgtgattaatcatatgcgtttttggttatg tgttgtttgacttaatatcagagccgagagatacttgttttctacaaaggagagggaaat g abs minus 35 minus 10 120 RBS ttgcaactaacaccacttcagttatttaaaaacctgtccgatgaaacccgtttgggtat cgtgttgttgctcagggagatgggagagttgggcgtgtgtgadcttkgcatggcactgga t 240 ArsR ArsR caatcacagcccaaaatatcccgtcatctggcgatgctacgggaaagtggaatccttct ggatcgtaaacagggaaaatgggttcactaccgcttatcaccgcatattccttcatgggc t 360 ArsR ArsR gcccagattattgagcaggcctggttaagccaacaggacgacgttcaggtcatcgcacg caagctggcbtcagttaactgcbccggtagcagtaaggctgtctgcatctaaaaaatttg c 480 ArsR ArsR ctgaattccaagttatccacctaccttaaggtaatagtgtgattcatcatatgcgtttt tggttatgtgaattaatcactagtgaattccctaactaactaaagattaactttataagg a 600 RBS abs ggaaaaacatatgagtaaaggagaagaacttttcactggagttgtccc 649 GFP B pAAUN cagcttagatgcagacagccttactgctaccggAgcagttaactgaAgccagcttgcgt gcgatgacctgaacgtcgtcctgttggcttaaccaggcctgctcaataatctgggcagcc c arsR 120 arsR atgaaggaatatgcggtgataagcggtagtgaacccattttccctgtttacgatccaga aggattccactttcccgtagcatcgccagatgacgggatattttgggctgtgattgatcc a 240 arsR arsR gtgccatgcAaagAtcacacacgcAcaactctcccatctccctgagcaacaacacgata cccaaacgggtttcatcggacaggtttttaaataactgaagtggtgttagttgcaacatt t 360 arsR arsR ccctctcctttGGATCCaaGGTCAGTGCGTCCTGCTGATGTGCTCAGTATTTCTATCAC TGATAGGGATGTCAATCTCTATCACTGATAGGGACTCGAGGTGAAGACGGAAGGGCCTCG T 480 Promoter AA Alper 2005 PNAS Promoter AA Alper 2005 PNAS RBS -10 -35 Tet Operator Tet operator GATACGCCTATTTTTATAGGTTAATGTCATAATAATAATGGTTTCTTAGACGTCGGAAT TGgagctcagattaatcatatgcgtttttggttatgtgttgtttgacttaatatcagagc c Promoter AA Alper 2005 PNAS abs 600 minus 35 sintetic Ars Promoter gagagatacttgttttctacaaagtaactagtaattcatcatatgcgtttttggttatg tgaattaatcactagtgaattcggcttattccctaactaactaaagattaactttataag g minus 10 abs 720 to...p sintetic Ars Promoter aggaaaaacatatgagtaaaggagaagaacttttcactggagttgtcc c 769 gfp Figure S3. Relevant construction details of the feedback (A) and uncoupled (B) circuits. Sequences show part of the arsR gene, the various promoters, the ArsR Binding Sites (ABS) and the start of the egfp reporter gene. Figure S4. Arsenite-dependent EGFP fluorescence in cultures of E. coli MG1655 with different uncoupled arsR-reporter circuits (pAAUN, pLtetOUN, pJJUN, pVUN, pKUN) compared to the feedback-controlled arsR-egfp circuit on pPR-arsR-ABSegfp. NFU, culture density normalized fluorescence after 120 min induction time using fluorimeter measurements. Data symbols represent the average from independent biological triplicates. Whiskers, SD (when not visible lay within the symbol size). Figure S5. Time response kinetics of the EGFP fluorescence signal in E. coli MG1655 carrying the different feedback and uncoupled bioreporter circuits, at different arsenite concentrations between 0 and 20 µg/L and measured in fluorimetry. NFU, culture density normalized fluorescence. Data points show triplicate averages ± one SD.

mbt12031-sup-0001-si

Related documents

Products

Support

mbt12031-sup-0001-si

Related documents

Add this document to collection(s)

Add this document to saved

Suggest us how to improve StudyLib