Table S1 Potential open reading frames of the OsHV-1-SB genome.
ORF
Position (nt) a
Length (aa) b
Predicted structure or function
OsHV-1
AVNV
Identity (%)
Length(aa)b
Identity (%)
Length (aa)b
1
2
3
4.1
4.2
5c
6
7
114-560
679-1182
2051-2740
3462-4019
4125-4511
4619-6420
6496-8526
8703-12248
148
167
229
185
128
99
100
99
148
167
254
98
100
99
148
167
307
676
1181
99
99
676
1181
100
99
676
1181
8
9.1
9.2
10
11
12
13
14
15
16
17
18
19
20
12285-13244
13332-13757
13884-15110
15370-16398
16665-19952
20331-20645
20691-21008
21559-22110
22489-23133
23211-23426
23699-23941
23993-24274
24321-25529
25609-27348
319
141
408
342
1095
104
105
183
214
71
80
93
402
579
99
319
99
319
99
99
100
100
99
100
99
99
99
99
99
342
1095
195
105
194
214
76
80
93
402
579
99
99
100
100
99
99
99
99
64
99
100
342
1095
195
105
194
214
71
80
58
402
579
Motifs V and VI characteristic of SF2
helicases
RING finger protein
Membrane protein
secreted protein
Ribonucleotide reductase small
subunit
21
22
23
24
25
26
27
28
29
30
27419-30376
30541-35439
35571-39389
39486-40619
40702-41367
41415-42602
42711-43511
43596-46157
45847-46452
46555-47301
985
1632
1272
377
221
395
266
853
201
248
31
32c
33
34
35
36
37
39
40
41
42
43
47355-47912
48173-50368
50380-51270
51350-51724
51810-52283
52353-52580
52650-53276
53521-54105
54108-55835
55985-58903
58942-60036
60155-60766
185
Primase
Class I membrane protein
Inactive dUTPase
Related via cysteine-rich domain to
ORF31 of genus Rhadinovirus and
UL92 of genus Cytomegalovirus of
the Herpesviridae
99
99
99
99
99
99
99
99
98
100
984
1632
1272
377
221
395
266
853
201
248
97
99
99
99
99
99
99
99
669
1632
1272
350
221
395
266
951
100
248
99
185
99
185
99
99
100
100
296
124
157
75
99
99
100
100
296
124
157
75
99
100
99
99
99
194
575
972
364
203
100
99
99
99
99
194
575
972
364
203
Encodes class I membrane protein
296
124
157
75
208
194
575
972
364
203
Inactive dUTPase
Membrane protein
RING finger protein
BIR protein containing RING finger
125
126
127
44
45
46
47
49
60824-61771
62063-62710
62897-63712
63785-64711
64854-65579
65727-66374
66390-70628
70834-74250
315
215
271
308
241
215
1412
1138
51
75569-78076
835
52
53
54
55
56
57
78193-78735
78819-80366
80425-82848
82925-83344
83617-84465
84215-85165
180
515
807
139
282
316
58
59
60
61
62c
63c
64
65c
85211-86776
86869-90111
90164-91399
91577-93313
93472-95272
95378-97241
97281-98033
98585-100569
521
1080
411
578
250
Contains motifs V and VI
characteristic of SF2 helicases
Ribonucleotide reductase large
subunit
RING finger-like protein
Class I membrane glycoprotein
Multiple transmembrane protein;
chloride channel
Class I membrane protein
RNA ligase
99
99
99
99
99
308
241
215
1412
1138
99
99
99
99
99
308
241
215
1412
1138
99
835
99
835
100
99
99
100
99
100
180
515
807
139
282
316
100
99
99
99
99
99
180
515
807
139
282
316
99
99
99
100
521
1080
411
578
99
99
99
97
521
1080
411
319
99
398
97
250
66
67
68
69
70
71
72
73c
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
100624-104016
104430-106220
106300-108390
108458-109849
109920-110933
111220-112581
112479-113045
113266-114945
115043-115399
115455-116165
116637-118673
118791-122585
122870-126094
126109-126549
126613-126963
127086-127727
127675-128565
128660-129766
129772-130128
130133-132136
132140-132547
132562-133074
133167-135413
135465-136199
136260-137144
137261-138343
1130
596
696
463
337
453
188
118
236
678
1264
1074
146
116
213
296
368
118
667
135
170
748
244
294
360
SF2 helicase
Class I membrane protein
Membrane protein
dUTPase
Class I membrane protein
Membrane protein
Membrane protein
BIR protein lacking RING finger
Class I membrane protein
99
99
99
99
82
99
100
1130
596
693
463
200
453
188
99
99
99
99
82
99
99
1130
596
694
463
200
453
188
100
100
99
99
99
100
99
100
98
99
100
99
100
99
99
99
99
100
118
236
678
1264
1151
146
116
213
296
368
118
667
135
170
748
244
294
360
100
99
99
99
99
99
99
100
98
99
99
99
99
99
99
99
99
100
118
247
678
1263
1074
146
116
213
296
368
118
667
135
170
748
244
294
360
92
93
94
95
138392-139081
139017-140231
140236-141279
141272-142297
229
404
347
341
96
97
98
99
100
101
102
103
104
105c
106
107
108
109
142363-143085
143175-143720
144223-145977
146346-147098
147589-153225
153312-153941
153982-156270
156283-157554
157702-161313
161450-163060
163205-164077
164735-166804
167020-167832
167885-170509
240
181
547
250
1878
209
762
423
1203
110
111
112
113
114
3
170604-171389
171479-172348
172472-173860
173867-174823
175046-176233
177069-177758
261
289
462
318
395
229
290
689
270
874
Similar to a family of uncharacterized,
conserved eukaryotic proteins
RING finger protein
RING finger protein
BIR protein lacking RING finger
DNA polymerase
Multiple transmembrane protein
BIR protein containing RING finger
ATPase subunit of DNA-packaging
terminase
Multiple transmembrane protein
99
99
99
99
229
404
347
310
99
99
99
99
229
404
347
341
100
100
99
99
99
99
99
99
99
240
181
547
250
1878
209
762
423
1203
100
99
98
99
99
99
99
99
99
240
181
547
250
1878
209
762
176
1200
97
99
99
100
465
689
270
874
97
99
99
100
464
689
270
874
99
100
99
99
43
99
261
289
462
318
494
254
99
99
99
99
43
99
261
289
462
318
494
307
2
1
116
118
119
120
121
124
122
121
120
119
118
116
178626-179129
179248-179694
180868-181638
182520-183188
183557-184315
184579-184908
186069-186716
187530-188954
190596-191750
192451-193098
194259-194588
194850-195608
195977-196645
197527-198297
a
167
148
256
222
252
109
215
474
384
215
109
252
222
256
RING finger protein
RING finger protein
RING finger-like protein
RING finger protein
indicated the positions of the ORFs in the genome
the lengths of amino acid residues encoded by the ORFs
c indicated disrupted genes which contain more than one small ORFs
b indicated
100
99
99
98
99
99
98
97
99
98
99
99
99
99
167
148
256
222
192
76
215
474
384
215
76
192
222
256
100
98
96
98
100
98
100
97
99
100
100
100
100
97
167
148
250
222
252
109
215
474
384
215
109
252
222
250
Table S2. Primers used for genomic sequencing of OsHV-1-SB.
Primer name
1F
1R
2F
2R
3F
3R
4F
4R
5F
5R
6F
6R
7F
7R
8F
8R
9F
9R
10F
10R
11F
11R
12F
12R
13F
13R
14F
14R
15F
15R
16F
16R
17F
17R
18F
18R
19F
19R
20F
20R
21F
Sequence(5’-3’)
TCCCGCCAATACCCATAATGCAa
TGTGCCCGTTAGACTGGGAAAGa
CACGCCTCTTTCCCAGTCTAACa
AGGAGCCAGACCAAAACCATTC a
AATTGGGATGCGATCGTTTCCTGa
TGGACTTTGAGGCTCCCATTTGT a
AGGAAGGCAACAGGATAGAAATG a
ACAAGGAGGTTGGAAGTCGTAGAa
TGGATAAATGACCGGCGAGAAAGa
TGAAATCACCAACACTGGAGGCTa
AAGGATCTGTCTAAGCCTCCAGTa
CTCGTTGAAACATCTACCGTCAT a
TTAGGTATGCCAGCCAGAGTTCAa
CTTCCACCCGGAGAAAGGATTAAa
TATGAACATGCCGCTTCTACTTC a
CAATGCCTATAAAGACCCTGAAa
TTTATCGGTGCAAATTCAGGGTCa
CTAAATGGTCGCCTCAAGGTTGGa
CATACAATAGTTGGGTGGTCAAa
GATGATGTGGGTTCTGGTCTAAa
AGGAAATTAACACCCGAGACAAa
AGCACAAACACTACCGCATACAa
TCTGTTCATGTATGCGGTAGTGTa
ATAGCCTGCCGATATTCCTTGCa
TTAGTATGGCAAGGAATATCGGa
AAGGTGGTTCTGGAGTTGAGACa
CAGGGTGATTGTCTCAACTCCAGa
ACCCGACAGTGAACTCCCTACTCa
ATGTAAATCCAAACCCTGTGCGTa
GTAGTTTCATCGGTTCCAGCCTCa
ATATTCTATAATCCCAGGAGCGa
GATGTAACCAATGTACCACCGTa
CTGAACGGTGGTACATTGGTTACa
CCTATTCTCCCGGTCGTGATACAa
GTATCACGACCGGGAGAATAGGa
TTTACGAAACTGGGAGACCACAa
CATGTTCGCTACTTGGAATGTCa
AGGAGGACATCTGGCGGTA
CGTGCTGAGACGGAATGTG
TGTTGACTACGCCAATGACT
AAGCGTCTCATCGAACTACGGGa
Size (bp)
3468
3149
3874
3340
3318
3735
3222
3195
3132
3677
3680
2912
3132
3008
3533
3546
3393
3260
3584
3275
3764
21R
22F
22R
23F
23R
24F
24R
25F
25R
26F
26R
27F
27R
28F
28R
29F
29R
30F
30R
31F
31R
32F
32R
33F
33R
34F
34R
35F
35R
36F
36R
37F
37R
A3
A4
39F
39R
Gp3
Gp4
41F
41R
42F
42R
43F
ATGTGGTCACCTTTGTGCCTGTa
TGGATGTGGTTTTGGATACGAAa
AGTGGTGGTGGCTCTTACTCTGa
CACCGCAAATCTCCGATATGATa
ATGAATTTCCAAGATAAAGATATCGGGA
CCTTTCATTCACGGCATCCT
TCCACTCGGAACCCCTGAGATAa
ATTGCACAATATCTCAGGGGTTCa
ATCCACCATAGATTGCGTCAGTa
GTGAAGAAACACTGACGCAATCa
AATAATCCTCGGGACCCAAGTTa
ACCGGGTGACCCAGTGTTTAAa
GGTGGATTCATGTGCGATCATa
CTGTGATCTTGTCGAACAATTCa
TTCGGTCATGTACTCTATCTCCTGa
CTGTGGGATGTATAGCCGTGGAGa
CCTGATTGGAGGGCAGAATGTAa
GAAGTTGACTTTCTTTCCCTTGCa
ACTGAGGTTGTGGGGTGTATTGTa
TTTTCCCAGCAAACAGACCTATa
GACATACCCAGTATTGCACCTTa
TCTACACTCTGAGACCATTCCTa
GATTTGTACCCAGACCAGTCATa
AGGTTTCGGCGAGTCGATGAa
ATGGCTTGCTGTTTTACACGTTCTa
GAGACGCATTAAAATGATGGAAGa
ACAGTCTGGAAATTCTCGTAGCCa
CGGGCTACGAGAATTTCCAGACa
CGATGATTCAGACAGGCAAGCTa
ACCAACAGCTTGCCTGTCTGAAa
GGAATGTCGCTTTGTACCACTGa
CAGAACCTGTAATAGCAAACGAa
GGGAGATGTACGACGATGTGAAa
GCCAACCGTTGGAACCATAACAb
GGGAATGAGGTGAACGAAACTATAGACCb
TTTGTCCGAGAATTTGGTATCCa
AACACCGACCATGAATCTAGGGa
GGTTGTGGGTTTGGAAATGTAGAc
GGCGTCCAAACTCGATTAAAc
GCCGGTGAATGGATGTTATGTCa
TAACCACGCTGGCTACGACTAAa
CGCCTTTACCATTCATAACAAGa
CCAGCATTACTGACATCCCTTAa
AACCGAGGTGTAAGGGATGTCAa
3770
2139
2366
4624
3975
3131
4078
3720
3925
4456
4120
3555
3113
3731
3596
4123
1001
4369
698
3158
3050
3678
43R
GATGCTCCGTGCTTGAGCCTATa
44F
CCCGTTATTAGTCATCAGCTCCa
3570
a
44R
TCAACGAGCAATCCCCTTTATA
45F
CCGAAAATCTGATTGGCTGCTATa
2952
45R
GACACCTGGGTATTGCGAGT
46F
TTTGTTCACCAGACCCTTCC
3195
a
46R
ATCCTTGGTGGAGTGTATAACC
47F
ACAAAACTGCGGTTATACACTCa
3251
a
47R
TCTTCGCCTACATATTTACTGG
48F
GAAGATGAAGAGGAAGACGAAAAGa
3460
a
48R
TGGGGAATACAACGTGAGATAA
49F
GCTGATTAAGATTGGCAAAGAAa
2583
a
49R
AACACGCTAGATATGGTCGGTA
50F
TACCGACCATATCTAGCGTGTTa
3069
a
50R
GGGTAACGGTTTATCATTCACA
51F
AGGATGATGTGAATGATAAACCGa
2512
a
51R
TGCTTTGCTCAAAACCCTCTATA
52F
TTTATCTGATGCCGACAGAGTCAa
2927
a
52R
TCATCTTCAAAAGCGTCGATG
53F
CAGCAAAGTTTACATCGACGCTTa
3998
53R
GCGCTTTCGCATTCCACATC
ORF114For
GGTTGGATCTCTTGGGAATGGd
2742
54R
AAGATAGGCGACACGGGACT
55F
TGGCAACGTCCCTATCGTAA
2191
a
55R
ACTTCGTGTTGTTGTTGAGCCAT
56F
GAGAAGAAGCAGCAACAGGTTAAa
2165
a
56R
TTGTGGGTGTATCTGCTAGTGTC
57F
ACAGGGATTACGTGTACCACAGa
2400
a
57R
GCATAGGATAGCCATCAGCAAG
58F
GATCCAATCACAGGCGATACCTa
2550
58R
ACAGTTTGGTGGAGGAGGTG
ORF121Rev
ACATCCAATGAAAACAGCCGGAAd
2093
59R
GGCGGGGAAAATAAGTCCTG
60F
ACCACTTAACCCACAACCATATa
4449
a
60R
AAGACTCCCAAGCAAGTTATGA
61F
GCGCTATTGCCCATGTTAAAATa
3133
61R
AGGCGATACCTTGCTGATGG
62F
CCATTCATTCTCCAATCCCTC
3984
62R
GGGGCGTGTCTAACCTCCTA
a: Weicheng Ren. Detection methods, sequence of the complete genome of acute viral necrosis
virus Isolated from Scallop, Chlamys farreri. PhD dissertation, Ocean University of China,
Qingdao, China; 2009.
b: Renault T, Lipart C, Arzul I. A herpes-like virus infecting Crassostrea gigas and Ruditapes
philippinarum larvae in France. J Fish Dis. 2001;24(6):369-76.
c
: Arzul I, Nicolas JL, Davison AJ, Renault T. French scallops: A new host for Ostreid herpesvirus-1.
Virology. 2001;290(2):342-9.
d
: Martenot C, Travaille E, Lethuillier O, Lelong C, Houssin M. Genome exploration of six variants
of the Ostreid Herpesvirus 1 and characterization of large deletion in OsHV-1 mu Var
specimens. Virus Res. 2013;178(2):462-70.
Download

Table S1. - Springer Static Content Server

get an essay or any other
homework writing help
for a fair price!
check it here!