Molecular biology
Final things to do
Finishing the finishing project
We now need to resolve all the issues with your finishing project.
1. Load your final set of data into Consed.
2. If you do not have one contig, you should try to manually join the two contigs. A previous handout
described the procedure. This will have to be done before the restriction digests (next step).
3. The major issue to resolve is to make sure that the computer restriction digests match the ones performed
at Washington University. At least two of the three digests must agree with the gel picture data. If they
are not correct, then something is wrong with your assembly. If you manually joined your contigs, then
you will have to redo the join. Before you check the restriction digest, find the ends of the fosmid and
convert the bases past the end to x’. The fosmid sequence at the end is:
AGGTCGACTCTAGAGGATCCC [insert] GGATCCCCGGGTACCGAGCTCGAAT
The [insert] is the Drosophila sequence you finished.
4. The other issues are to mark/explain all of the discrepancies for the contig. Remember that single clone
regions are okay as we did most of the sequencing off the fosmid.
5. You may have some reads that have been put in the wrong place (they usually have a lot of high quality
discrepancies). You need to deal with these by either putting them into a separate contig or by tagging
the item and explaining why you left them where they are.
6. After you are finished, go through the checklist to double-check that all issues have been resolved or
explained.
7. You need to save your final data with a filenumber of 0. To do this, when you save your data before
exiting Consed, change the next number to a 0 (instead of 17 or whatever number it suggests).
8. Show your final assemblies to your instructor to make sure all of the problems are resolved.
Submitting the finishing project
1. Make sure you’ve checked off (or explained) each item on the finishing list. The form will be filled out and
submitted by computer. The restriction digests are important for confirming that your fosmid sequence is
correct, and you need 2 of the restriction enzymes to give good results (no red lines unless it’s a doublet,
under 1 kb, or over 10 kb and within 5% of the correct size).
Go back to the assembly view and double check that you have a single contig, no unexplained
misassemblies and that everything looks good. We also don’t have any PCR only regions, as we did not do
this to close the contigs. Tag the ends of the fosmid. You can select several bases to tag the ends, as it
makes it easier to find them.
For the restriction digests, there are four to check (EcoRI, EcoRV, HindIII, and SacI). Check using "entire
single contig" and enter your contig number. After selecting the four and Ok, you change between the four
enzymes using a box in the lower left of the window.
The file containing the checklist (so you can electronically fill it out, is at
http://public.clunet.edu/~revie/molbiol/FinishingChecklist.txt
Save the file, then open it and fill it out. Include explanations of discrepancies and unfinished parts of the
project.
2. Submit the finishing by emailing it to your instructor (revie@clunet.edu). Be sure to include both your
names on the project. Include the checklist and the final ace file (ending in .0).
1