Supplementary Materials:
Table S1: Primers used to generate deletion constructs of PopB
Table S2: Binding kinetics of PopB with PcrH.
Figure S1: Interaction analysis of PopB mutants with PcrH. a) In-vitro interaction of PopB mutants.
Lane 1, 6: supernatant of PcrH; Lane 2, 7: flow through of PcrH from Ni-NTA agarose column pre
equilibriated with refolded PopB mutants (PopBΔ1-60 and PopBΔ1-60,Δ370-390); Lane 3,8: wash from Ni-NTA
agarose column; Lane 4: elution of PopBΔ1-60-PcrH complex; Lane 5: marker and Lane 9: elution of
PopBΔ1-60,Δ370-390 . (b) In-vivo interaction of PopB mutants. Lane 1, 6: supernatant of PopBΔ1-40 –PcrH and
PopBΔ290-390-PcrH; Lane 2, 7: flow through from Ni-NTA agarose column; Lane 3, 8: wash from Ni-NTA
agarose column; Lane 5: marker; Lane 4: elution of PopBΔ1-40-PcrH; Lane 9: elution of PopBΔ290-390-PcrH
complex. Surfaceplasmon resonance (SPR) assay of PopB-PcrH interaction. Sensograms showing binding
of (c) wild type PopB, (d) PopBΔ1-60,Δ370-390 and (e) PopBΔ1-100 to PcrH. The coloured lines correspond to
sensogram obtained from software generated fits using 1:1 binding model to obtain ka and kd, using
various concentration of PcrH.
Figure S2: Far UV CD predicts that PopB mutants (PopBΔ1-100 and PopBΔ1-60/Δ370-390) possess wellformed secondary structure with increased helicity compared to wild type PopBWT
Figure S3: creation of 3D models of various deletion mutants of PopB protein that yielded significant
binding difference with respect to full length PopB-PcrH complex.
Figure S4: 3D structures of various deletion mutants of PopB that yielded significant binding difference
with respect to full length PopB-PcrH complex.
Figure S5: Docking score comparison for the PopB-PcrH complex, based on the blind and residues
specific directed docking studies. Panel A shows the blind docking solutions, clustered on the basis of the
interactions of the PcrH concave part either on the front part of PopB, where PcrH were found to interact
with α1, α2, α4 and α9 of PopB or the rear part of PopB, where PcrH were found to interact with 51-59
region of PopB within 5Å distance. The shape complementary score comparison shows the binding of
PcrH onto the front part of PopB has greater binding preference with comparatively higher binding score
over the binding of PcrH at the rear part of PopB model (51-59 region).
Panel B. The directed docking analysis was performed considering two different docking scenarios, i)
where all the interface residues of the front part of PopB and concave part of the PcrH were provided as
the seed region and ii) where only the 51-59 region of PopB and concave part of the PcrH were provided
as the seed region for the docking. The shape complementary docking scores for the respective scenarios
clearly suggest that the binding of concave part of PcrH with the front part of PopB model has
comparatively higher preference of binding than at the rear part of PopB model (51-59 region).
Figure S6: Estimation of the binding affinity of the peptide resembling the 51-59 (TGVALTPPS) region
of PopB with PcrH and some non-related protein structures. ∆G of binding (kcal/mol) of PcrH complexed
with the peptide resembling the 51-59 of PopB was estimated. Region 51-59 of the PopB protein was
further utilized to extract similar segments using both sequence and structure based searches against all
other proteins. Top three most similar segments were further docked onto the PcrH structure and the
corresponding binding affinities of the complexes were calculated. Panel A shows the crystal structure P.
aeruginosa PcrH (PDB ID: 4JL024) complexed with peptide resembling the 51-59 region of PopB and
their corresponding ∆G of binding in kcal/mol. Panel B shows the structural representation of PcrHpeptide complex where the peptide was removed from the complex crystal structure and further docked
onto the PcrH crystal structure using the docking protocol used in this study.
Panel C-E show docking modes and corresponding ∆Gs of interaction (kcal/mol) of completely unrelated
protein segments that are sequentially (>=70%) and structurally (root mean square deviation [RMSD]:
<=1Å) similar to the 51-59 (TGVALTPPS) region of PopB. The PopB segment was found to be most
similar with a nucleoplasmin core protein (PDB ID: 1K5J; region: 93-99), a putative aminotransferase
protein (PDB ID: 3EZ1; region: 368-373A) and a bacterial alanine racemase (PDB ID: 4A3Q; region:
101-107), respectively. These segments were further docked onto the PcrH structure (PDB ID: 4JL0) and
the corresponding ∆Gs of interaction (kcal/mol) are shown in the respective panels.
Docking protocol
The chain A subunit of the crystallographic structure of a regulatory protein, PcrH from P.
aeruginosa (PDB ID: 2XCC) was docked to the best fit model of PopB using the protein-protein
docking mode of PatchDock docking program1. Further, based on the mutation analysis, we have
generated structures of the corresponding mutants of the PopB and they are also allowed to dock
with PcrH, in order to identify the probable docking mode of each mutant. In this study we
carried out the following two different modes of docking analysis:
1. Blind docking studies.
2. Directed docking studies.
In the blind docking analysis, the crystallographic structure of a regulatory protein, PcrH (PDB
ID: 2XCC) was allowed to dock with the best wild type and mutant models of PopB structures.
The best docking solutions from the most populated clusters interacting with the ‘head’ part (α1,
α2, α4, α9) of PopB were selected and subjected to FireDock2 and PDBePISA3 server for the
calculation of global energies and free energies (G) of binding respectively.
In case of directed docking studies the binding residues were provided for both the PopB and
PcrH structures. In case of mutant PopB-PcrH directed docking, the deleted residues of mutant
PopB structures were excluded from the list of binding residues list. In each directed docking
experiment, a constant number of 34 AA from α1, α2, α3, α4, α5, α6, α7 were provided as the
seed region for PcrH, whereas 36 AA from α1, α2, α4, α9 were provided as the seed residues for
model PopB (wild type).
The number of seed residues varied for each mutant of PopB. Following is a list of mutant PopB
models and their respective seed residues.
PopB Mutant
Region Deleted
Total Number of Seed Residues
Δα1
2-48 AA
34
Δα2
65-91 AA
22
Δα4
111-128 AA
31
Δα9
370-390 AA
24
Δα1+Δα9
2-48 & 370-390 AA
23
Δα1+Δα2+Δα9
2-48 , 65-91& 370-390 AA
9
Δ1_60+Δα9
1-60 & 370-390 AA
22
Δ1_80
1-80 AA
23
Δ100-390
1-100 AA
20
Top 100 docking solutions were screened for both docking experiments and the best docked
complex was identified based on critical manual inspection satisfying favorable interactions
between two proteins. Selected docked solutions were further refined and re-scored using the
FireDock refinement server2. Approximate G of binding of the selected docked complexes was
calculated using the PDBePISA server3.
Calculation of global energies by FireDock2
The global energy can be termed as the binding energy of the docking complex which changes
upon complex formation.
∆ =   − (  +   )
Where,
  =    ℎ   
  =    ℎ  
  =    ℎ  
Upon complex formation the interacting residues within 6Å are considered as the interface
(intef) residues and remaining residues are considered as non-interface (nintrf) residues and


   = 
+ 
Further the complex energy is splitted into intra molecular (intra) and inter molecular(inter)
energy.
The final ∆G can be described as






∆ =    = 
− (
+ 
) = _
+ ∆_
+ ∆_
Calculation of binding energy by PDBePISA3 (∆)
The binding free energy of a complex (∆ ) is estimated as follows:
∆ = ∆ + ℎ ℎ +   +  
Where, ∆ is the solvation energy gain upon complex formation. ℎ ,,  are numbers
of formed hydrogen bonds, salt bridges and disulphide bonds, respectively. ℎ ,,  stands
for their free energy effects.
Table S1
Name of Construct
PopBΔ1-20 (S)
PopBΔ1-45 (S)
PopBΔ1-60 (S)
PopBΔ1-80 (S)
PopBΔ1-100 (S)
PopBΔ370-390 (As)
PopBΔ350-390 (As)
PopBΔ330-390 (As)
PopBΔ310-390 (As)
PopBΔ290-390 (As)
PopBWT (S)
PopBWT (As)
PopBΔ1-60/ 370-390
PopBΔ1-60/ 350-390
Deletion
First 20 amino acid
from N-terminal
First 45 amino acid
from N-terminal
First 60 amino acid
from N-terminal
First 80 amino acid
from N-terminal
First 100 amino acid
from N-terminal
Last 20 amino acids
from C-Terminal
Last 40 amino acids
from C-Terminal
Last 60 amino acids
from C-Terminal
Last 80 amino acids
from C-Terminal
Last 100 amino acids
from C-Terminal
First 60 amino acid
from N-terminal &
Last 20 amino acids
from C-Terminal
First 60 amino acid
from N-terminal &
Last 40 amino acids
from C-Terminal
Primer sequence 5’----------------------3’
TTAGAATTCGCATATGATCCCGGCGCTCGG
TTAGAATTCGCATATGGCTTCCGCGAGCGG
TTAGAATTCGCATATGGCCAGCCAGCAGCG
TTAGAATTCGCATATGGTGGGCGAGGATGT
TTAGAATTCGCATATGTCCGCCGGCCTGAT
TTAAGTCGACTCAGAAGATCCGCTCCATGA
TTAAGTCGACTCAGCGCTCGATCACGCCCT
TTAAGTCGACTCAGCGGTTCGCGGCCTT
TTAAGTCGACTCAGTCCAGGGTCAGGTC
TTAAGTCGACTCAGGCCAAACTGCCGAA
TTAGAATTCGCATATGAATCCGATAACGCTTGA
TTAAGTCGACTCAGATCGCTGCCGGTCGGC
Primer sequence of PopBΔ1-60 (S) & PopBΔ370-390 (As)
Primer sequence of PopBΔ1-60 (S) & PopBΔ350-390 (As)
Note: S:- Sense Primer, As:- Antisense Primer. The N-Terminal deletion constructs of PopB were generated using
sense primer [PopBΔ1-20 (S), PopB Δ1-45 (S), PopB Δ1-60 (S), PopB Δ1-80 (S) and PopB Δ1-100 (S)] of the respective
deletions and PopBWT (As). The C-Terminal deletion constructs of PopB were generated using antisense primer
[PopB Δ370-390 (As), PopB Δ350-390 (As), PopB Δ330-390 (As), PopB Δ310-390 (As), PopB Δ290-390 (As)] of the respective
deletions and PopBWT (S).
Table S2
PopB mutants
Figure S1
Interaction with PcrH
PopBWT
In vitro and in vivo
studies
yes
SPR studies
KD (10-6 )M
0.372±0.02
PopBΔ1-20
yes
0.402±0.06
PopBΔ1-40
yes
0.485±0.03
PopBΔ1-60
yes
0.592±0.07
PopBΔ1-80
yes
6.52±0.14
PopBΔ1-100
no
782.56±23.02
PopBΔ390-370
yes
0.469±0.03
PopBΔ390-350
yes
0.487±0.05
PopBΔ390-330
yes
0.525±0.03
PopBΔ390-310
yes
0.575±0.06
PopBΔ390-290
yes
0.577±0.04
PopBΔ1-60/ Δ390-370
no
28.52±0.34
PopBΔ1-60,/Δ390-350
no
30.83±0.46
Figure S2
Figure S3
Figure S4
Figure S5
Figure S6
References
1.
Schneidman-Duhovny D, Inbar Y, Nussinov R, Wolfson HJ. PatchDock and SymmDock:
servers for rigid and symmetric docking. Nucleic Acids Res 2005;33(Web Server
issue):W363-367.
2.
Mashiach E, Schneidman-Duhovny D, Andrusier N, Nussinov R, Wolfson HJ. FireDock:
a web server for fast interaction refinement in molecular docking. Nucleic Acids Res
2008;36(Web Server issue):W229-232.
3.
Krissinel E, Henrick K. Inference of macromolecular assemblies from crystalline state. J
MolBiol 2007;372(3):774-797.
Download

prot24666-sup-0001-suppinfo