SUPPLEMENTAL MATERIAL
Supplemental Methods
Metabolite Profiling
For measurement of amino acids, biogenic amines, and other polar plasma metabolites we used
hydrophobic interaction chromatography (HILIC) with 150 x 2.1 mm Atlantis HILIC columns (Waters;
Milford, MA) as previously described.1 Briefly, formic acid, ammonium acetate, LC/MS grade solvents,
and valine-d8 were obtained from Sigma-Aldrich (St. Louis, MO), with the remainder of isotopicallylabeled analytical standards obtained from Cambridge Isotope Labs, Inc (Andover, MA). Plasma samples
(10 μL) were prepared for LC/MS analyses via protein precipitation with the addition of 9 volumes of
74.9:24.9:0.2 v/v/v acetonitrile/methanol/formic acid containing stable isotope-labeled internal standards
for valine-d8 and phenylalanine-d8. The samples were centrifuged (10 min, 10,000 rpm, 4ºC). After
centrifugation, the supernatants were injected directly, followed by HILIC with the same mobile phases
(mobile phase A: 10 mM ammonium formate and 0.1% formic acid, v/v; mobile phase B: acetonitrile
with 0.1% formic acid, v/v). Multiplexing was used to enable the measurement of 105 metabolite
transitions divided between the 2 LC systems, and each sample was injected once on each. Each column
was eluted isocratically with 5% mobile phase A (over 1 minute), followed by a linear gradient to 60%
mobile phase A (over 10 minutes). MS analyses were performed using electrospray ionization and
multiple reaction monitoring scans in the positive ion mode. Declustering potentials and collision
energies were optimized for each metabolite by infusion of reference standards prior to sample analyses.
The dwell time for each transition was 30 msec, the ion spray voltage was 4.5 kV, and the source
temperature was 425ºC.
Analyses of polar metabolites in the negative ionization mode were conducted using a 5500
QTRAP triple quadrupole mass spectrometer (AB SCIEX; Foster City, CA) coupled to an ACQUITY
UPLC (Waters; Milford, MA). Plasma samples (30µL) were prepared via protein precipitation with the
addition of four volumes of 80% methanol containing inosine-15N4, thymine-d4 and glycocholate-d4
internal standards (Cambridge Isotope Laboratories; Andover, MA). The samples were centrifuged (10
min, 9,000 x g, 4°C), and the supernatants were injected directly onto a 150 x 2.0 mm Luna NH2 column
(Phenomenex; Torrance, CA) that was eluted at a flow rate of 400µL/min with initial conditions of 10%
mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide in water) and 90% mobile
phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol) followed by a 10 min linear
gradient to 100% mobile phase A. MS analyses were carried out using electrospray ionization and
selective multiple reaction monitoring scans in the negative ion mode. Declustering potentials and
collision energies were optimized for each metabolite by infusion of reference standards before sample
analyses. The ion spray voltage was -4.5 kV and the source temperature was 500°C. Internal standard
peak areas were monitored for quality control and individual samples with peak areas differing from the
group mean by more than 2 standard deviations were re-analyzed. MultiQuant software (Version 1.1; AB
SCIEX; Foster City, CA) was used for automated LC-MS peak integration and metabolite peaks were
manually reviewed for quality of integration and compared to reference standards to confirm
identification. Using sample preparation and MS replicates of human samples, we have previously
documented coefficients of variation (CV) for the metabolites in the platform: 54% of metabolites have
CV ≤10% and 74% have CV ≤20%.2
Animal Model Studies
All animals had access to standard mouse chow and water, ad libitum, during the experiment. Each mouse
was weighed weekly and housed in groups of 4 mice per cage.
Quantitative Real Time Polymerase Chain Reaction
Total RNA from mouse lungs were extracted and purified via the RNeasy mini kit (Qiagen)
according to the manufacturer’s instructions.
The RNA concentration was determined using the NanoDrop ND-1000 spectrophotometer (NanoDrop
Technologies). cDNA was synthesized in a 20-µL reaction mixture with 1µg of total RNA using the RT2
First-Strand Kit (Qiagen). Quantitative RT-PCR was performed using a 7500 FAST Real-Time PCR
System (Applied Biosystems) with the RT2 SYBR® Green ROX qPCR mix (Qiagen). ). The IDO1
primers (Forward TGGCGTATGTGTGGAACCG and Reverse CTCGCAGTAGGGAACAGCAA) were
purchased through Invitrogen . All data were normalized to 18SrRNA and quantitative measures obtained
using the D-D-CT method.
Supplemental Results: Supplemental Tables
arginine
ornithine
citrulline
SDMA
ADMA
Arg/OnC
anthranilic acid
kynurenic acid
kynurenine
quinolinate
allantoin
xanthosine
inosine
hypoxanthine
xanthine
urate
aconitate
isocitrate
citrate
malate
succinate/methylmalonate
fumarate
tryptophan
3-hydroxyanthranilic acid
serotonin
5-HIAA
5-hydroxytryptophan
orotate
creatinine
cAMP
aminoisobutyric acid
VMA
cystathionine
cystathionine
VMA
aminoisobutyric acid
cAMP
creatinine
orotate
5-hydroxytryptophan
5-HIAA
serotonin
3-hydroxyanthranilic acid
tryptophan
fumarate
succinate/methylmalonate
malate
citrate
isocitrate
aconitate
urate
xanthine
hypoxanthine
inosine
xanthosine
allantoin
quinolinate
kynurenine
kynurenic acid
anthranilic acid
Arg/OnC
ADMA
SDMA
citrulline
ornithine
arginine
Supplemental Table 1. Pearson correlation coefficients between levels of metabolites in pathways related to invasive indices of RV-PV function.
1.00
0.26
1.00
0.18
0.50
1.00
-0.17
0.38
0.55
-0.03
0.54
0.39
0.60
1.00
0.68
-0.46
-0.46
-0.55
-0.44
1.00
-0.19
0.32
0.32
0.55
0.39
-0.45
1.00
-0.13
0.30
0.49
0.61
0.45
-0.44
0.69
1.00
-0.27
0.33
0.34
0.57
0.50
-0.53
0.54
0.54
1.00
-0.32
0.30
0.35
0.63
0.51
-0.56
0.55
0.56
0.83
1.00
-0.28
0.02
0.19
0.32
0.00
-0.33
0.25
0.34
0.16
0.29
1.00
-0.34
0.29
0.41
0.75
0.51
-0.59
0.48
0.57
0.51
0.63
0.44
1.00
-0.13
0.28
0.34
0.54
0.45
-0.38
0.31
0.42
0.43
0.45
0.37
0.77
1.00
-0.07
0.29
0.19
0.36
0.39
-0.28
0.27
0.31
0.31
0.31
0.30
0.41
0.50
1.00
-0.27
0.21
0.29
0.60
0.38
-0.45
0.41
0.53
0.51
0.55
0.40
0.79
0.82
0.49
1.00
-0.27
0.05
0.01
0.21
0.01
-0.27
0.29
0.16
0.33
0.31
0.31
0.03
0.00
0.33
0.12
1.00
-0.26
0.07
0.10
0.34
0.08
-0.31
0.34
0.32
0.22
0.32
0.48
0.28
0.16
0.27
0.27
0.52
1.00
-0.32
0.24
0.17
0.48
0.17
-0.47
0.48
0.44
0.51
0.49
0.44
0.37
0.25
0.44
0.42
0.61
0.70
1.00
-0.26
0.00
0.18
0.32
0.10
-0.30
0.26
0.33
0.22
0.18
0.33
0.18
0.13
0.24
0.16
0.45
0.67
0.51
1.00
-0.44
0.09
0.21
0.44
0.20
-0.51
0.38
0.44
0.29
0.35
0.47
0.41
0.25
0.42
0.35
0.37
0.64
0.55
0.60
1.00
-0.25
0.04
0.16
0.20
0.05
-0.30
0.46
0.27
0.23
0.18
0.37
0.13
0.09
0.33
0.16
0.50
0.51
0.50
0.48
0.63
-0.21
0.01
-0.07
0.05
-0.03
-0.16
0.08
0.07
-0.02
-0.01
0.02
0.03
-0.11
0.28
0.01
0.39
0.23
0.18
0.14
0.24
0.09
1.00
0.18
-0.18
-0.12
-0.23
-0.04
0.30
-0.05
-0.18
0.03
-0.18
-0.35
-0.32
-0.19
-0.05
-0.13
0.08
-0.24
-0.22
-0.12
-0.20
-0.02
0.11
1.00
-0.06
0.19
0.18
0.27
0.38
-0.21
0.37
0.31
0.47
0.56
-0.06
0.34
0.23
0.32
0.31
0.09
-0.06
0.13
-0.22
0.04
0.01
0.19
0.26
1.00
0.10
-0.32
-0.02
-0.10
-0.09
0.25
0.04
0.14
-0.07
-0.16
0.04
-0.18
-0.04
0.16
0.02
0.14
0.03
0.00
0.13
0.12
0.33
-0.18
0.21
-0.15
1.00
-0.07
0.24
0.43
0.33
0.14
-0.33
0.28
0.34
0.17
0.08
0.05
0.19
0.18
0.15
0.12
0.19
0.07
0.28
0.24
0.22
0.19
0.08
-0.02
0.01
0.02
1.00
-0.01
-0.04
-0.04
-0.12
0.01
0.02
0.00
0.13
-0.03
-0.07
0.08
0.03
0.09
0.29
0.06
-0.07
-0.01
-0.05
-0.12
0.11
0.24
-0.20
-0.03
0.06
0.92
-0.14
1.00
-0.25
0.12
0.38
0.50
0.27
-0.42
0.31
0.49
0.34
0.34
0.51
0.72
0.76
0.40
0.84
0.06
0.32
0.36
0.29
0.38
0.23
-0.07
-0.24
0.06
0.19
0.25
0.13
1.00
-0.19
0.05
0.46
0.63
0.29
-0.35
0.44
0.60
0.38
0.43
0.54
0.52
0.39
0.34
0.52
0.35
0.33
0.48
0.37
0.43
0.22
0.05
-0.03
0.23
0.15
0.32
0.05
0.54
1.00
-0.18
0.22
0.29
0.32
0.20
-0.37
0.39
0.33
0.38
0.41
0.19
0.36
0.20
0.45
0.21
0.42
0.18
0.48
0.30
0.25
0.33
0.20
-0.20
0.24
-0.09
0.38
0.12
0.20
0.37
1.00
-0.33
0.35
0.45
0.67
0.49
-0.63
0.48
0.36
0.51
0.61
0.19
0.72
0.53
0.29
0.50
0.04
0.17
0.32
0.24
0.37
0.14
0.08
-0.15
0.40
-0.29
0.19
-0.20
0.37
0.37
0.33
1.00
-0.22
0.15
0.39
0.47
0.09
-0.40
0.31
0.33
0.33
0.32
0.45
0.40
0.29
0.43
0.29
0.40
0.40
0.58
0.49
0.48
0.37
0.18
-0.23
-0.17
0.11
0.36
0.09
0.42
0.43
0.48
0.33
1.00
-0.36
0.40
0.06
0.42
0.25
-0.55
0.39
0.34
0.48
0.52
0.52
0.46
0.37
0.27
0.46
0.34
0.29
0.48
0.07
0.30
0.25
0.10
-0.27
0.21
-0.17
-0.04
-0.08
0.33
0.29
0.11
0.40
0.25
1.00
1.00
1.00
Supplemental Table 2. Relationships between IDO-TM scores and co-morbidities as well as medication exposures
IDO-TMs
P value
β-coefficients
BMI
-0.026
0.83
Hypertension
0.080
0.52
Diabetes
0.151
0.21
Smoking
0.040
0.74
Beta-blocker
0.127
0.29
ACE I/ARB
-0.009
0.94
CCB
-0.084
0.48
Diuretic
0.193
0.11
Statin
0.166
0.17
ASA
0.184
0.18
Coumadin
0.146
0.23
Supplemental References
1.
2.
Lewis GD, Farrell L, Wood MJ, Martinovic M, Arany Z, Rowe GC, Souza A, Cheng S, McCabe EL, Yang E, Shi X, Deo R, Roth FP,
Asnani A, Rhee EP, Systrom DM, Semigran MJ, Vasan RS, Carr SA, Wang TJ, Sabatine MS, Clish CB, Gerszten RE. Metabolic
signatures of exercise in human plasma. Science translational medicine.2:33ra37.
Wang TJ, Larson MG, Vasan RS, Cheng S, Rhee EP, McCabe E, Lewis GD, Fox CS, Jacques PF, Fernandez C, O'Donnell CJ, Carr SA,
Mootha VK, Florez JC, Souza A, Melander O, Clish CB, Gerszten RE. Metabolite profiles and the risk of developing diabetes. Nature
medicine. 2011;17:448-453.
Supplemental Figure
50
Subject 1
Subject 2
40
Mean PA Pressure
(mmHg)
Slope 4.9mmHg/L/min
30
20
Slope 1.4 mmHg/L/min
10
0
0.0
5.0
10.0
15.0
Cardiac Output (L/min)
Supplemental Figure Legend : Representative changes in mean pulmonary arterial pressure relative to changes in cardiac output (PQ) during
exercise in two subjects. Although neither patient has resting pulmonary hypertension, serial measurements of pulmonary arterial pressure and
cardiac output during exercise demonstrate a much steeper PQ in subject 1 compared to subject 2. These distinct responses to exercise illustrate
the advantage of integrating multi-point assessment of pressure flow relationships during exercise to resting hemodynamic measurements in
assessing pulmonary vascular function.