1
SUPPORTING INFORMATION
2
3
4
5
Figure S1 Time window determination (a) 1 µM Cholesterol esterase, 500 Vcm-1, 9.90 nL
hydrodynamic injection with PDA 280 nm detection; (b) Equilibrium mixture of 100 nM DNA
and 1.0 µM Cholesterol esterase; 500 Vcm-1 separation, LIF detection ,RB: 3xTGK, SB:
nuclease-free water, 50 µm id capillary.
6
7
8
9
Figure S2 Bulk affinity determination post NC (round 0); (a) 100 nM DNA library; (b)
Equilibrium mixture of 100 nM DNA and 1.2 µM Cholesterol esterase; 500 Vcm-1 separation,
LIF detection, RB: 3xTGK, SB: nuclease free water 50 µm id capillary.
Figure S3 The secondary structure of aptamer (a) CES 4 and (b) CES 4T checked on the
OligoAnalyser 3.1 program using the ionic conditions of 100 mM [Na+] and 5 mM [Mg2+] ion
concentrations.
Figure S4 NEECEM analysis of CES 4; 100 nM aptamer and 200 nM cholesterol esterase were
incubated for 30 minutes and injected onto the capillary by hydrodynamic injection (9.90 nL),
500 Vcm-1 separation with LIF detection. The areas of the free DNA, dissociated DNA and
complex peak were used to determine KD and 3 experiments were performed for each sequence.
Figure S5 Typical NECEEM based specificity analysis for (a) 1 µM α glycol acid protein, (b)
1 µM amylose; (c) trypsin inhibitor and (d) bovine catalase proteins were incubated with 0.1 µM
of CES 4 and CES 4T aptamer and injected onto the capillary by hydrodynamic injection
(9.90 nL), 500 Vcm-1 separation with LIF detection. The areas of the free DNA, dissociated
DNA and complex peak were used to determine KD and 3 experiments were performed for each
sequence.
10
Table S-1 A summary of the binding affinities of the full aptamer sequence using NECEEM.
11
1
1
2
3
4
5
6
Figure S1. Time window determination (a) 1 µM Cholesterol esterase, 500 Vcm-1, 9.90 nL
hydrodynamic injection with PDA 280nm detection; (b) Equilibrium mixture of 100 nM DNA
and 1.0 µM Cholesterol esterase; 500 Vcm-1 separation, LIF detection ,RB: 3xTGK, SB:
nuclease-free water, 50 µm id capillary.
2
1
2
3
4
5
6
Figure S2. Bulk affinity determination post NC (round 0); (a) 100 nM DNA library; (b)
Equilibrium mixture of 100 nM DNA and 1.2 µM Cholesterol esterase; 500 Vcm-1 separation,
LIF detection, RB: 3xTGK, SB: nuclease free water 50 µm id capillary.
7
8
9
10
11
12
13
14
3
(a)
(b)
Figure S3. The secondary structure of aptamer (a) CES 4 and (b) CES 4T checked on the
OligoAnalyser 3.1 program using the ionic conditions of 100 mM [Na+] and 5 mM [Mg2+] ion
concentrations
4
Figure S4. NEECEM analysis of CES 4; 100 nM aptamer and 200 nM cholesterol esterase
were incubated for 30 minutes and injected onto the capillary by hydrodynamic injection (9.90
nL), 500 Vcm-1 separation with LIF detection. The areas of the free DNA, dissociated DNA
and complex peak were used to determine KD and 3 experiments were performed for each
sequence.
5
Figure S5. A typical NECEEM based specificity analysis for (a) 1 µM α glycol acid protein, (b)
1 µM amylose; (c) trypsin inhibitor and (d) bovine catalase proteins were incubated with 0.1
µM of CES 4 and CES 4T aptamer and injected onto the capillary by hydrodynamic injection
(9.90 nL), 500 Vcm-1 separation with LIF detection. The areas of the free DNA, dissociated
DNA and complex peak were used to determine KD and 3 experiments were performed for
each sequence.
6
Table S1. A summary of the binding affinities of the full aptamer sequence using NECEEM.
Name
CES 1
Random Region
CACTTCCTGCTTGTGCCAAGGGTGACGAGTTATTTTAAAA
3.6 ± 0.36 µM
CES 2
CTCGAGCCTAGGCTAGCTCTAGACCACACGTGTGGGGGCCC
211.17 ± 6.8 nM
CES 3
CTGTTTAAGACTGTAAATCATAAATTGCAATCTTTCGTGG
162.17 ± 28 nM
CES 4
TGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC
116.6 ± 4.7 nM
CES 5
CCCCCTCTCCCGCGGGGGGGTATGTAAATATAAACAGGGGG 204.16 ± 8.6 nM
CES 6
CTAAGAATACTTTGGGCTACCGTATTTGGAGGTTCCATAA
7
NECEEM KD
541.17 ± 82 nM
Download

Template for Electronic Submission to ACS Journals