Supplemental Materials
Figure S1
Figure S1. Ectopic expression of DNMT1-ΔRFTS enhances invasion
activity without proliferation. (A) Neither full-length nor mutant DNMT1
overexpression changed proliferation rates in the presence or absence of EGF.
Data were normalized to vector cells cultured with EGF. (B) DNMT1-ΔRFTS and
DNMT1-ΔR/C cells showed slightly enhanced invasion. Invasion ability was
quantified by the CultureCoat 24 Well Low BME Cell Invasion Assay. Data were
normalized to vector cells. n = 4; *, P < 0.05 in comparison to vector cells.
Figure S2
Figure S2. Ectopic expression of DNMT1 alleles does not radically alter
global methylation intensities. (A) Pairwise unsupervised clustering followed
by Pearson correlations of normalized ratios from HELP assay indicated that the
majority of methylation intensities are little changed in DNMT1-expressing cells in
comparison to vector cells. DNMT1 and DNMT1-ΔRFTS cells shared more
similarity than vector cells. (B) Volcano plot allows visualization of methylation
differences between DNMT1 and DNMT1-ΔRFTS cells.
Figure S3
Figure S3. The methylation levels of LINE1 were not changed in DNMT1 or
DNMT1-ΔRFTS cells. (A) Bisulfite sequencing of LINE1. (B) Quantitation of
LINE1 bisulfite sequencing. n = 20. ns, indicates no significant difference in
comparison to vector cells.
Figure S4
Figure S4. Ectopic expression of DNMT1-ΔRFTS in H358 cells is sufficient
to enhance proliferation, invasion and soft-agar colony formation. (A) H358
stable cell lines were established to express full-length DNMT1 or DNMT1ΔRFTS near the endogenous DNMT1 levels. The levels of DNMT1 were
determined by western blotting. (B) Both DNMT1 and DNMT1-ΔRFTS increased
the proliferation rate in H358 cells. Data were normalized to vector cells. (C)
DNMT1-ΔRFTS showed slightly enhanced invasion. Invasion ability was
quantified by the CultureCoat 24 Well Low BME Cell Invasion Assay. Data were
normalized to vector cells. n = 4. (D) DNMT1-ΔRFTS cells showed the greatest
colony formation in soft agar. *, P < 0.05; ***, p < 0.001 in comparison to vector
cells.
Figure S5
Figure S5. Ectopic expression of DNMT1-ΔRFTS in H358 cells caused gene
silencing of DAPK and DUOX1 and demethylation of SAT2. (A) Expression of
DAPK, DUOX1 and SAT2 was analyzed using RT-qPCR. (B) Bisulfite
sequencing of SAT2. (C) Quantitation of SAT2 bisulfite sequencing. n = 20. *, p <
0.05; **, p < 0.01; ***, p < 0.001 in comparison to vector cells.
Table S1. Target list of TSGs have been found with hypermethylationmediated gene silencing in lung cancers
Function
Gene
Cell cycle
P16
Function
Gene
CDH1
CDH13
APC
TIMP3
Cell adhesion
RARß
TSLC1
DUOX1
LAMA3
DUOX2
RECK
Growth/ Differentiation
IGFBP3
GATA4
DAPK
WWOX
RASSF1A
MTHFR
FHIT
Apoptosis
DNA repair
MGMT
FAS
NORE1A
BCL2
Detoxification
GSTP1
SEMA3B
Table S2. KEGG pathway enrichment analysis
Pathway
Gene Counts
p value
Focal Adhesion
Fructose and mannose metabolism
Leukocyte transendothelial migration
Tight junction
ECM-receptor interaction
Neurotrophin signaling pathway
Pathways in cancer
31
11
19
19
11
14
28
9.12E-07
1.28E-05
1.13E-04
5.73E-04
0.021146166
0.024730832
0.034601812
Lysosome
Phenylalanine metabolism
Tyrosine metabolism
13
5
7
0.024611161
0.028973119
0.030538571
Hyper-
Hypo-
Table S3. DNMT1 RFTS domain mutations were found in cancer (COSMIC
database)
Cancer Type
Mutation Position
Melanoma
P351L
Stomach
K352E
Uterine
Q358R
Melanoma
L365F
Melanoma
D373N
Lung squamous
T382R
Bladder
I388M
Stomach
H416Y
Melanoma
P421L
HEC251 (endometrial)
D423N
Stomach
E428K
Colorectal
E432K
22RV1 (Prostate Cancer)
L433F
Bladder
D470N
Uterine
F479L
Uterine
E485K
Colorectal
E485K
Melanoma
E504K
Colorectal
Q517P
Ovary
T523A
Melanoma
I531R
Esophagus
T534M
HS994T (Skin Cancer)
S549F
Colorectal
A554T
A554P
Head & Neck
E559Q
Esophagus
E566K
Prostate
D583N
SW620 (Large Intestine)
L587M
Table S4. Primer List
Forward
Reverse
Plasmid construct
TA cloning
RFTS deletion
CXXC deletion
R/C deletion
CACCATGCATCATCATCATCATCATCCGGC
GCGTACCGCCCCA
ACCAAGCTGGTCTACCAGATC
TCACCCAAAAAAATGCACCAG
TCACCCAAAAAAATGCACCAG
GTCGACCTAGTCCTTAGCAGCTTCCT
GAGCTACCACGCAGACATCA
CTCCCCATTTCTTGGAGACA
ATGTGCCAGATACCCAAAGC
CATCGAATGGAAATGAAAGGAGTC
GAGTCAACGGATTTGGTCGT
CGAGGAAGTAGAAGCGGTTG
CCAGGGATGCTGCAAACTAT
CAGCTGACGGATGACTTGAA
ACCATTGGATGATTGCAGTCAA
GACAAGCTTCCCGTTCTCAG
GCTTTTGCTTTCCCAGCCAGGGC
CCATGGGACTTGTGAAGGCGGAC
CATCGAATGGAAATGAAAGGAGTC
ATCGCACTTCTCCCCGAAGCCAA
CTCCCGGGGCGCAGGTAGAG
ACCATTGGATGATTGCAGTCAA
AGGGTGGGTCTTGGAGTTCATG
GTTCTCCTTGTCTTCTCTGTC
AGGGTGGGTCTTGGAGTTCATG
RNA
DNMT1
DAPK
DUOX1
SAT2
GAPDH
MeDIP/ ChIP
DAPK
DUOX1
SAT2
Bisulfite sequencing
DAPK 1st PCR
DAPK 2nd PCR
DUOX1 1st PCR
DUOX1 2nd PCR
SAT2 1st PCR
SAT2 2nd PCR
LINE1
TTTTATTTATTTTTTAGTTGTGTTTT
TTAGTTTTTGTTTTTTTAGTTAGGG
GGTTTTGGATTTGGAGTTTAGATT
GTTTTATGGGATTTGTGAAGG
TGGAATTATTATTAAATGGTAATTTAATGG
TTAATGGAAAGGAATGGAAT
TTATTAGGGAGTGTTAGATAGTGGG
TAAAAACAATCTCTCTCCAACCTAC
AACAATCCCCAAAACCACAT
AAAAAACTAACATTCCCCTTTCTTC
CTACCCTTAAAACTCCCTCCC
AAATAATTACAATCAATTCATTC
TTCCATTAAATAATAACTCC
TACCTAAACAAACCTAAACAATAAC
Chromatin accessibility
DAPK
DUOX1
GTGGGTGTGGGGCGAGTGGGTGT
CGCCTCCCACCCTCTCCCCAGCC
CTCTCGGCTCCTTGCCGCCTTTT
GGCCCGCGGAGCCCTCTCTC
Download

Supplemental Materials